Stem Rust Resistance in 62 Cultivars and Elite Lines from Northern Huanghuai Region of China
by
Yifan Wei
1,†, 
Di Zhao
2,†,
Tingjie Cao
3,
Huiyan Sun
1,
Longmei Zou
1,
Jinjing Yang
1,
Gongjun Zhang
1,
Tong Li
1,
Conghao Zhang
1,
Qiutong Chen
1 and
Tianya Li
1,* 1
College of Plant Protection, Shenyang Agricultural University, Shenyang 110866, China
2
Analysis and Testing Center, Shenyang Agricultural University, Shenyang 110866, China
3
Wheat Research Institute, Henan Academy of Agricultural Sciences, Zhengzhou 450002, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work and share first authorship.
Agronomy 2025, 15(5), 1174; https://doi.org/10.3390/agronomy15051174
Submission received: 30 March 2025
/
Revised: 10 May 2025
/
Accepted: 11 May 2025
/
Published: 12 May 2025
(This article belongs to the Special Issue Mechanism and Sustainable Control of Crop Diseases)
Abstract
:Wheat stem rust, caused by Puccinia graminis f. sp. tritici, is a major disease that severely affects safe wheat production. The Huanghuai region plays a vital role in China’s wheat production and the wheat stem rust epidemic across China. However, due to China’s effective control measures, wheat stem rust rarely occurs in the region, resulting in little research on this disease, including the determination of resistance genes in cultivars and elite lines. For this purpose, this study utilized two predominant races (21C3CTHQM and 34MKGQM) of P. graminis f. sp. tritici to determine the resistance levels of 64 wheat cultivars in the Huanghuai wheat region. Additionally, molecular markers linked with Sr24, Sr25, Sr26, Sr31, and Sr38 were used to analyze the presence of these genes. The results indicated that among the 62 wheat cultivars and elite lines, 13 cultivars contained Sr31, four cultivars were detected to contain Sr38, and none contained Sr24, Sr25, or Sr26. Field tests in 2023 showed that three (4.8%) cultivars exhibited immunity to both races, while 20 (32.3%) and 23 (37.1%) cultivars showed resistance to moderate resistance, and 39 (62.9%) and 36 (58.1%) cultivars were moderately susceptible to susceptible. In 2024, one (1.6%) and four (6.5%) cultivars demonstrated immunity to both races, 22 (35.5%) and 23 (37.1%) cultivars showed resistance to moderate resistance, and 39 (62.9%) and 35 (56.5%) cultivars were moderately susceptible to susceptible. With over 50% of the cultivars displaying susceptibility, the overall resistance level was relatively low, indicating that stem rust outbreaks could recur if a sufficient inoculum is present. It is crucial to explore new resistance sources, discover novel resistance genes, and breed wheat cultivars with durable resistance and desirable agronomic traits to enhance the overall resistance to stem rust in Chinese wheat-growing regions.
1. Introduction
Wheat stem rust, caused by Puccinina graminis Pers.:Pers. f. sp. tritici Erikss. & E. Henn. (Pgt), is a fungal disease that poses a significant threat to wheat production worldwide [1]. Historical records show that before the 1970s, wheat-growing regions in China suffered severe yield losses due to multiple stem rust outbreaks [2]. Nine major epidemics were reported in the spring wheat region of Northeast China from 1923 to 1964, with the 1923 and 1948 outbreaks alone causing production losses of 740 million kg and 560 million kg, respectively. In 1956 and 1958, the Jianghuai wheat region lost 1 billion kg of yield due to stem rust [3]. According to reports, the losses from wheat stem rust in the United States were approximately 2.7 billion kg, accounting for approximately 40% of crop production in the United States, and Canada also lost 5.4 billion kg [4]. After 1970, due to the promotion and utilization of resistant cultivars, especially those carrying Sr31, derived from the 1B/1R translocation line, which was widely introduced into commercial wheat cultivars, wheat stem rust was effectively controlled in China [5]. Over the next 30 years, except for the epidemics in Ethiopia in 1993 and 1994, the disease was largely absent in most countries [6]. However, in 1998, a new race with virulence to the resistance gene Sr31 was first detected in a wheat nursery in Uganda and was designated as Ug99 (TTKSK) [7]. This race has evolved into an increasingly virulent variant that has spread across different regions [8]. Because 90% of global wheat cultivars are susceptible to Ug99, stem rust poses a significant threat to wheat production once again [9]. Meanwhile, with continuous changes in the pathogenicity of Ug99, new virulent races continue to emerge. In 2006 and 2007, a race of Ug99 lineage with high virulence against resistance genes Sr24 and Sr36 was discovered [10]. The threat posed by Ug99 has received considerable attention in recent years. Currently, 14 variants of Ug99 have been identified in 15 countries [6]. The virulent race within the Ug99 population, TTKTT, is particularly concerning because of its ability to overcome the resistance genes SrTmp and Sr24. In 2023, race TTKTT was detected in Nepal, a neighboring country of China [11]. The emergence of this mutant race further indicates that the transmission pattern of Ug99 is consistent with the rust transmission model predicted by CIMMYT’s geographic information experts (Figure 1). According to this model, the pathogen crossed the Red Sea from Africa, moved through Yemen, Iran, and Iraq, and has now reached Nepal. Given this trajectory, it is likely only a matter of time before Ug99 invades China, where it could pose a severe threat to the nation’s wheat production.
Between 2005 and 2010, wheat cultivars grown on an estimated 75–80 million hectares were screened across 22 major wheat-producing countries in Africa and Asia, including China. Data indicate that only 5–10% of the wheat total area in these countries was expected to exhibit sufficient resistance to Ug99 [10]. In most wheat-growing regions worldwide, existing environmental conditions are conducive to stem rust infections, which could lead to epidemic outbreaks. This situation, coupled with the widespread cultivation of susceptible wheat cultivars and the prevalence of breeding materials currently susceptible to Ug99 and other newly identified races, poses a significant threat to global wheat production and food security. Although predicting the timing and location of major epidemics is challenging, the outbreak of Ug99 could severely affect a large number of wheat-growing households in Africa and Asia, particularly those with limited alternative sources of livelihood. Massive production losses can also affect rural and national economic growth and the rise in wheat prices. Therefore, understanding the resistance of wheat cultivars (lines) and the status of resistance genes is crucial for identifying and screening resistant materials.
Before the 1970s, wheat stem rust was a major threat to wheat production in China. Due to the introduction and utilization of disease-resistance genes, the disease has been effectively controlled and has rarely or only sporadically occurred in recent years. Consequently, resistance to wheat stem rust is no longer the primary breeding objective for approving wheat cultivars in most Chinese provinces, leaving the resistance levels of newly developed cultivars to this disease largely unknown. Nonetheless, wheat stem rust continues to evolve through virulence variations that overcome the existing varietal resistance. The emergence of new strains, such as Ug99 and TTTTF, represents a significant global threat to the safe production of wheat. The Huanghuai region, serving as a critical transitional area for the oversummering of wheat stem rust, significantly influences the regional prevalence of this disease. In addition, it is the largest wheat production area in China. However, the resistance levels of cultivars in this region to wheat stem rust and the specific resistance genes they harbor remain unknown. This study aimed to assess the resistance of wheat cultivars in the Huanghuai region to the predominant races of P. graminis f. sp. Tritici in China and to identify the resistance genes present using molecular markers. These findings can provide crucial data and resources for breeding programs aimed at enhancing resistance to wheat stem rust in China.
2. Materials and Methods
2.1. Wheat Lines and P. graminis f. sp. tritici Races
The 62 wheat materials used in this study were collected from various agricultural academies in Henan Province. The susceptible variety Little Club (LC) and the single- gene positive control lines, including LcSr24Ag (Sr24), Agatha/9*LMPG (Sr25), Eagle (Sr26), Sr31/6*LMPG (Sr31), and Trident (Sr38), were provided by the Plant Immunology Research Laboratory of Shenyang Agricultural University for molecular marker detection. Two races, 21C3CTHQM and 34MKGQM (not in the Ug99 lineage), of P. graminis f. sp. tritici were isolated, identified, and preserved at the Plant Immunology Research Laboratory at Shenyang Agricultural University. The process of detailed isolation, proliferation, and preservation of a single isolate was described by Cao et al. [13]. The virulence/avirulence spectra of 21C3CTHQM and 34MKGQM are presented in Table 1.
2.2. Identification of Adult Plant Resistance in the Field
In 2023 and 2024, resistance evaluation during the adult stage was conducted at the spring wheat experimental site of the Plant Protection College at Shenyang Agricultural University. All winter wheat seeds were vernalized before sowing. The tested wheat seeds were placed in culture dishes covered with double-layer filter paper to promote germination. Once the sprout length reached approximately 3 cm, the dishes were refrigerated at 7 °C. After 20 days of low-temperature vernalization, the wheat was sown in single rows, each 1 m long, with a spacing of 25 cm. The susceptible variety Little Club (LC) was planted every 10 rows as a control and disease inducer.
The wheat was inoculated using the powder dusting method during the jointing stage. Before inoculation, the plants were wetted with 0.05% Tween-20 aqueous solution. The uredinia were then mixed with talc powder at a ratio of 1:30 and dusted onto the wheat plants. After inoculation, the plants were covered with plastic film to maintain moisture for 16 h.
After 14 days of inoculation, if the control variety exhibited complete infection with wheat stem rust, the resistance level was classified according to the established standards for stem rust reaction types (Table 2). Resistance evaluations were conducted every 5 days for a total of three times, with the highest infection response (IR) and severity recorded. Disease severity was assessed based on the percentage of leaf area occupied by uredinia. A proportion of 0.37% was defined as 1% severity, and 37% was considered 100% severity. Severity levels were categorized into 12 classifications: 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 100% [14]. Resistance and susceptibility levels were classified based on the standards for wheat stem rust response types. The IR classification included IM (immune), NIM (nearly immune), R (resistant), MR (moderately resistant), MS (moderately susceptible), and S (susceptible) [15]. The different response types of wheat stem rust are described in Table 2. Disease incidence rate was recorded by evaluating 100 randomly selected individual plants per cultivar. The lesion areas of wheat stem rust were calculated using ImageJ (Java 1.8.0_172) software. The area under the disease progress curve (AUDPC) was calculated according to the method described by Dong et al. [16].
2.3. Molecular Markers of Resistance Genes
DNA was extracted using the CTAB method, and its quality was assessed using 1% agarose gel electrophoresis. The distribution of stem rust resistance genes in 62 wheat cultivars was evaluated using molecular markers closely linked to Sr24, Sr25, Sr26, Sr31, and Sr38 [17,18,19,20,21]. The primers were synthesized by Sangon (https://www.sangon.com), accessed on 15 April 2023. The PCR amplification reaction system and specific reaction conditions are listed in Table 3.
3. Results
3.1. Resistance Evaluation in Adult Stage
The response of different cultivars (lines) to the two races of P. graminis f. sp. tritici in 2023 and 2024 is shown in Table 4, Figure 2. The results indicated that in 2023, three cultivars demonstrated immunity to both races (Table 5). In addition, 20 and 23 cultivars exhibited resistance to moderate resistance, and 39 and 36 cultivars showed moderate susceptibility to susceptibility. In 2024, one and four cultivars displayed immunity to both races, with 22 and 23 cultivars exhibiting resistance to moderate resistance, and 39 and 35 cultivars showing moderate susceptibility to susceptibility. Among them, eight cultivars, including Kexing 3302, Shangmai 207, Xinliang 16, Han 174291, Zhongke 19021, Shi 17T5248, Huaifeng 36, and Liangxing 87, demonstrated high resistance to both races for two consecutive years. More than 40 cultivars showed susceptibility among 62 cultivars, indicating that the overall resistance level of wheat materials to the two races during the adult stage was relatively low.
3.2. Molecular Detection of Stem Rust Resistance Genes
This study used molecular markers closely linked to Sr24 (Sr24 # 12), Sr25 (Gb), Sr26 (Sr26 # 43), Sr31 (Iag95, SCSS30.2576), and Sr38 (VENTRIUP LN2) to detect stem rust genes in 62 wheat cultivars. Specific bands of 500 bp, 191 bp, 207 bp, 576 bp (SCSS30.2576), 1100 bp (Iag95), and 259 bp were amplified from the positive controls containing Sr24, Sr25, Sr26, Sr31, and Sr38, respectively. None of the 62 wheat cultivars amplified the same bands as Sr24, Sr25, or Sr26 (Figure 3A–C), whereas 13 wheat cultivars amplified the same bands as Sr31, and four cultivars amplified bands as Sr38. All the wheat cultivars that tested positive for the Sr31 and Sr38 markers were also resistant to the evaluated races 21C3CTHQM and 34MKGQM, and the resistance of these cultivars to both races may be provided by Sr31 and Sr38.
4. Discussion
Through this study, the results indicated that 40 out of 62 cultivars collected in the region exhibited susceptibility to the tested races. Even more serious is the fact that some cultivars displayed similar infection response types to the susceptible control variety Little Club, which does not contain any resistance genes. The field disease severity and prevalence rates are as high as 100%. These plants start to dry up around 20–25 days after inoculation and have almost no yield at harvest. Only 22 wheat cultivars showed resistance to the tested races, and based on the results of molecular testing, the resistance of these cultivars to both races may be provided by Sr31 and Sr38. The AUDPC of most cultivars in 2024 was greater than that in 2023, which may be related to different climate conditions between the two years. These results indicate that if there is a sufficient inoculum source of wheat stem rust, stem rust may break out and cause epidemics.
Traditional disease management primarily relies on monitoring pathogen populations, understanding genetic variation, and strategically utilizing different resistance genes across various regions. However, these are time-consuming, labor-intensive, and complex [21]. Recently, molecular marker-assisted selection breeding has provided a new perspective for wheat disease management, shortening the breeding time, accelerating the breeding process, improving breeding efficiency, and overcoming many difficulties in conventional breeding methods [22]. To date, 23 molecular markers closely linked to wheat stem rust resistance genes have been reported [23]. Many SSR, SCAR, and STS markers, which have been converted to more accessible formats, have been widely used in research on molecular marker selection for disease-resistant wheat breeding [21,24]. In particular, SSR markers are commonly employed to identify genes associated with rust resistance [25]. Mastering the molecular marker-assisted selection technology to selectively utilize resistance genes can enhance the resistance of breeding materials. The five genes assessed for molecular detection in this study have been extensively used and studied by breeders for their resistance to stem rust, both domestically and internationally. Among the tested cultivars, only 24.2% contained one or more resistance genes against stem rust, indicating that wheat cultivars in the northern Huang Huai region have fewer resistance genes. Among the five genes detected, Sr24, Sr25, Sr26, Sr31, and Sr38, Sr31 is widely used in wheat breeding, with estimates suggesting that nearly 50% of wheat cultivars may contain this gene [5]. Although the resistance gene Sr31 has lost effectiveness against Ug99 races, it still confers significant resistance to the physiological races of wheat stem rust present in China [26]. In this study, 13 of the 62 wheat cultivars tested contained Sr31. The Sr38 gene, originating from Aegilops ventricosa, is associated with the leaf rust resistance gene Lr37 and the stripe rust resistance gene Yr17 [27]. It provides good resistance to three types of wheat rust, making it widely used in global wheat rust resistance breeding [28]. In this study, four cultivars contained Sr38. Given the significant role of Sr38 in the prevention and control of global wheat stem rust and its resistance to wheat stem rust in China, the four cultivars identified in this study can be used in breeding programs to improve the resistance of cultivars in the region. No specific bands for Sr24, Sr25, and Sr26 genes were detected in any of the tested materials. Wheat cultivars containing the Sr24 resistance gene have shown strong resistance to the new races TKTTF and TTRTF [29]. Therefore, considering their resistance to the new race Ug99 and its variants of wheat stem rust, it is recommended that these genes be introduced into domestic wheat resistance breeding to enrich the disease resistance gene pool in China and improve the resistance of cultivars to stem rust.
5. Conclusions
This study evaluated the resistance of 62 wheat cultivars from the northern Huanghuai region to two prevalent races of P. graminis f. sp. tritici in China during the adult stage and combined molecular marker technology to detect the stem rust resistance genes Sr24, Sr25, Sr26, Sr31, and Sr38. The results indicated that the resistance genes present in these wheat cultivars were highly limited. This suggests that if the pathogen virulence changes in the future and new races emerge, wheat stem rust may erupt again in China, leading to severe epidemics and significant yield losses. Therefore, it is crucial to incorporate a broader range of resistance genes into breeding programs to ensure sustained resistance in wheat cultivars.
Author Contributions
Performed the experiments, Y.W., D.Z. and G.Z.; prepared figures and tables, H.S., T.L. (Tong Li) and L.Z.; analyzed the data, Y.W., J.Y., C.Z., Q.C. and D.Z.; writing—review and editing, Y.W., T.C. and T.L. (Tianya Li); funding acquisition, supervision, project administration, and approved the final draft, T.L. (Tianya Li). All authors have read and agreed to the published version of the manuscript.
Funding
This study was supported by the National Natural Science Foundation of China (32472526) and the Natural Science Foundation of Liaoning Province, China (2024-MS-093).
Data Availability Statement
Data are contained within the article.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Pardey, P.G.; Beddow, J.M.; Kriticos, D.J.; Hurley, T.; Park, R.F.; Duveiller, E.; Sutherst, R.W.; Burdon, J.J.; Hodson, D. Right-sizing stem-rust research. Science 2013, 340, 147–148. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.X.; Lin, Q.J.; Ni, X.Y.; Sun, Q.; Chen, R.Z.; Xu, X.F.; Qiu, Y.C.; Li, T.Y. Characterization of wheat monogenic lines with known Sr genes and wheat lines with resistance to the Ug99 race group for resistance to prevalent races of Puccinia graminis f. sp. tritici in China. Plant Dis. 2020, 104, 1939–1943. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.S.; Huang, Z.T. Twenty year’s racial identification and fluctuation analysis of Puccinia graminis var. tritici in China. J. Shenyang Agric. Univ. 1987, 18, 105–108. (In Chinese) [Google Scholar]
- Kumar, S.; Fetch, T.G.; Knox, R.E.; Singh, A.K.; Clarke, J.M.; DePauw, R.; Cuthbert, R.D.; Campbell, H.L.; Singh, D.P.; Bhavani, S. Mapping of Ug99 stem rust resistance in Canadian durum wheat. Can. J. Plant Pathol. 2021, 43, 599–611. [Google Scholar] [CrossRef]
- Jiang, Y.Y.; Chen, W.Q.; Zhao, Z.H.; Zeng, J. Threat of new Puccinia graminis f. sp. tritici race Ug99 to wheat production in China and counter measure. China Plant Prot. 2007, 27, 14–16. (In Chinese) [Google Scholar]
- Sun, H.; Wang, Z.; Wang, R.; Chen, S.; Ni, X.; Gao, F.; Zhang, Y.; Xu, Y.; Wu, X.; Li, T. Identification of wheat stem rust resistance genes in wheat cultivars from Hebei province, China. Plant Sci. 2023, 14, 1156936. [Google Scholar] [CrossRef] [PubMed]
- Pretorius, Z.A.; Singh, R.P.; Wagoire, W.W.; Payne, T.S. Detection of virulence to wheat stem rust resistance gene Sr31 in Puccinia graminis f. sp. tritici in Uganda. Plant Dis. 2000, 84, 203. [Google Scholar] [CrossRef]
- Singh, R.P.; Hodson, D.P.; Huerta-Espino, J.; Jin, Y.; Bhavani, S.; Njau, P.; Herrera-Foessel, S.; Singh, P.K.; Singh, S.; Govindan, V. The emergence of Ug99 races of the stem rust fungus is a threat to world wheat production. Annu. Rev. Phytopathol. 2011, 49, 465–481. [Google Scholar] [CrossRef]
- Jin, Y.; Pretoriou, Z.A.; Singh, R.P. New virulence with in race TTKS (Ug99) of the stem rust pathogen and effective resistant genes. Phytopathology 2007, 97, S137. [Google Scholar]
- Singh, R.P.; Hodson, D.P.; Huerta-Espino, J.; Jin, Y.; Njau, P.; Wanyera, R.; Herrera-Foessel, S.A.; Ward, R.W. Will stem rust destroy the world’s wheat crop? Adv. Agron. 2008, 98, 271–309. [Google Scholar]
- Patpour, M.; Baidya, S.; Basnet, R.; Justesen, A.F.; Hodson, D.; Thapa, D.; Hovmøller, M.S. First report of Ug99 wheat stem rust caused by Puccinia graminis f. sp. tritici in South Asia. Plant Dis. 2024, 108, 2570. [Google Scholar]
- Moscou, M.J.; van Esse, H.P. The quest for durable resistance. Science 2017, 358, 1541–1542. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.Y.; Si, B.B.; Zhu, G.Q.; Xu, X.F.; Li, W.H.; Chen, S.; Zhao, J.; Li, T.Y. Race and virulence of asexual and sexual populations of Puccinia graminis f. sp. tritici in China from 2009 to 2015. Eur. J. Plant Pathol. 2019, 153, 545–555. [Google Scholar]
- Peterson, R.F.; Campbell, A.B.; Hannah, A.E. A diagrammatic scale for estimating rust intensity of leaves and stem of cereals. Can. J. Res. 1948, 26, 496–500. [Google Scholar] [CrossRef]
- Roelfs, A.P.; Singh, R.P.; Saari, E.E. Rust Diseases of Wheat: Concepts and Methods of Disease Management; CIMMYT: Tulantongo, Mexico, 1992. Available online: https://books.google.co.uk/books?hl=ko&lr=&id=GHOD3FOZRfAC&oi=fnd&pg=PR6&dq=Rust+diseases+of+wheat:+Concepts+and+methods+of+disease+management&ots=i0tjiZ60JB&sig=lVJ0q3K2MLTcIWEm7-SU12I51PU#v=onepage&q=Rust%20diseases%20of%20wheat%3A%20Concepts%20and%20methods%20of%20disease%20management&f=false (accessed on 10 May 2025).
- Dong, J.Z.; Yang, J.S.; Wu, W.; Wu, Y.S. The application of three mathematical models in the research of the wheat slow-rusting resistance. J. Heilongjiang Bayi Agric. Univ. 1986, 2, 1–8. (In Chinese) [Google Scholar]
- Gao, F.; Wu, X.X.; Sun, H.Y.; Wang, Z.Y.; Chen, S.; Zou, L.M.; Yang, J.J.; Wei, Y.F.; Ni, X.Y.; Sun, Q.; et al. Identification of wheat rust resistance genes in Triticum wheat cultivars and evaluation of their resistance to Puccinia graminis f. sp. tritici. Agriculture 2024, 14, 198. [Google Scholar] [CrossRef]
- Liu, S.X.; Yu, L.X.; Singh, P.P.; JIN, Y.; Sorrells, M.E.; Anderson, J.A. Diagnostic and co-dominant PCR markers for wheat stem rust resistance genes Sr25 and Sr26. Theor. Appl. Genet. 2010, 120, 691–697. [Google Scholar] [CrossRef]
- Das, B.K.; Saini, A.; Bhagwat, S.G.; Jawali, N. Development of SCAR markers for identification of stem rust resistance gene Sr31 in the homozygous or heterozygous condition in bread wheat. Plant Breed. 2006, 125, 544–549. [Google Scholar] [CrossRef]
- Mago, R.; Spielmeyer, W.; Lawrence, G.; Lagudah, E.; Ellis, J.; Pryor, A. Identification and mapping of molecular markers linked to rust resistance genes located on chromosome 1RS of rye using wheat-rye translocation lines. Theor. Appl. Genet. 2002, 104, 1317–1324. [Google Scholar] [CrossRef]
- Mago, R.; Bariana, H.S.; Dundas, I.S.; Spielmeyer, W.; Lawrence, G.J.; Pryor, A.J.; Ellis, J.G. Development of PCR markers for the selection of wheat stem rust resistance genes Sr24 and Sr26 in diverse wheat germplasm. Theor. Appl. Genet. 2005, 111, 496–504. [Google Scholar] [CrossRef]
- Goutam, U.; Kukreja, S.; Yadav, R.; Salaria, N.; Thakur, K.; Goyal, A.K. Recent trends and perspectives of molecular markers against fungal diseases in wheat. Front. Microbiol. 2015, 6, 861. [Google Scholar] [CrossRef]
- Yu, L.; Liu, S.; Anderson, J.A.; Singh, R.P.; Jin, Y.; Dubcovsky, J.; Brown-Guidera, G.; Bhavani, S.; Morgounov, A.I.; He, Z.; et al. Haplotype diversity of stem rust resistance loci in uncharacterized wheat lines. Mol. Breed. 2010, 26, 667–680. [Google Scholar] [CrossRef]
- Khan, R.R.; Bariana, H.S.; Dholakia, B.B.; Naik, S.V.; Lagu, M.D.; Rathjen, A.J.; Bhavani, S.; Gupta, V.S. Molecular mapping of stem and leaf rust resistance in wheat. Theor. Appl. Genet. 2005, 111, 846–850. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.G.; Qiu, J.; Zhou, Y.L.; Xu, S.C.; Chen, H.G.; Liu, Y.; Gao, L.; Liu, B.; Zheng, C.L.; Chen, W.Q. Multi-disease resistance evaluation of Chinese advanced winter wheat lines for the national regional test. Sci. Agric. Sin. 2015, 48, 2967. [Google Scholar]
- Wei, Y.; Wu, X.; Liu, D.; Sun, H.; Song, W.; Li, T. Stem rust resistance and resistance-associated genes in 64 wheat cultivars from Southern Huanghuai, China. Plants 2024, 13, 2286. [Google Scholar] [CrossRef]
- Bariana, H.S.; McIntosh, R.A. Cytogenetic studies in wheat. XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A. Genome 1993, 36, 476–482. [Google Scholar] [CrossRef] [PubMed]
- Helguera, M.; Khan, I.A.; Kolmer, J.; Lijavetzky, D.; Zhong-qi, L.; Dubcovsky, J. PCR assays for the Lr37-Yr17-Sr38 cluster of rust resistance genes and their use to develop isogenic hard red spring wheat lines. Crop Sci. 2003, 43, 1839–1847. [Google Scholar] [CrossRef]
- Olivera, P.; Newcomb, M.; Szabo, L.J.; Rouse, M.; Johnson, J.; Gale, S.; Luster, D.G.; Hodson, D.; Cox, J.A.; Burgin, L.; et al. Phenotypic and genotypic characterization of race TKTTF of Puccinia graminis f. sp. tritici that caused a wheat stem rust epidemic in southern Ethiopia in 2013-14. Phytopathology 2015, 105, 917–928. [Google Scholar] [CrossRef]
Figure 1.
Transmission mode of wheat rust fungus by wind and human activities [12].
Figure 1.
Transmission mode of wheat rust fungus by wind and human activities [12].
Figure 2.
Schematic diagram of severity grading of wheat stem rust. A: Actual percentage of rust fungus uredinia on wheat stem. B: The transformed disease severity according to the modified Cobb Scale, as described in Roelfs et al. [15].
Figure 2.
Schematic diagram of severity grading of wheat stem rust. A: Actual percentage of rust fungus uredinia on wheat stem. B: The transformed disease severity according to the modified Cobb Scale, as described in Roelfs et al. [15].
Figure 3.
PCR amplification results using different primers in some wheat cultivars (lines). (A) Sr24#12; (B) Gb; (C) Sr26#43; (D) Iag95; (E) SCSS30.2576; (F) VENTRIUP-LN2. LC: Does not contain any resistance gene (negative control); positive controls: single gene lines containing only the tested gene.
Figure 3.
PCR amplification results using different primers in some wheat cultivars (lines). (A) Sr24#12; (B) Gb; (C) Sr26#43; (D) Iag95; (E) SCSS30.2576; (F) VENTRIUP-LN2. LC: Does not contain any resistance gene (negative control); positive controls: single gene lines containing only the tested gene.
Table 1.
Virulence/avirulence patterns of two races of P. graminis f. sp. tritici.
| Race | Ineffective Sr Genes | Effective Sr Genes |
|---|---|---|
| 21C3CTHQM | 6, 7b, 8a, 9a, 9b, 9d, 9f, 9g, 10, 11, 12, 13, 15, 16, 17, 18, 20, 24, 27, 32, 34, 39, Tmp, McN | 5, 9e, 14, 19, 21, 22, 23, 25, 26, 28, 29, 30, 31, 33, 35, 36, 37, 38, 47, Tt3 |
| 34MKGQM | 5, 6, 7b, 8a, 9a, 9b, 9d, 9f, 9g, 12, 15, 16, 22, 24, 27, 28, 29, 39, GT, McN | 9e, 10, 11, 13, 14, 17, 18, 19, 20, 21, 23, 25, 26, 30, 31, 32, 33, 34, 35, 36, 37, 38, 47, Tmp |
Table 2.
Description of wheat rust response types used in phenotyping.
| Infection Types | Classification Criteria | Resistance Evaluation |
|---|---|---|
| 0 | Asymptomatic | Immunity, IM |
| ; | Produce dead spots or chlorosis, no uredinia. | Near immunity, NIM |
| 1 | Uredinia are very small, few in number, often not broken, and there is a dead reaction around them. | Resistance, R |
| 2 | Uredinia are small to medium, with dieback and chlorosis around them. | Moderately Resistant, MR |
| 3 | The urediospore pile is medium in size, rarely heals, and the surrounding tissues have no dieback reaction, but there is slight chlorosis. | Moderately susceptible, MS |
| 4 | The uredinia are large and numerous, often fused together, and the surrounding tissues do not die. The early chlorosis phenomenon is not obvious. | Susceptible, S |
Table 3.
Primers linked to stem rust resistance genes and PCR conditions.
| Gene | Primer | Size (bp) | Sequence of Primer (5′→3′) | PCR Amplification Conditions | |
|---|---|---|---|---|---|
| Temperature (°C)/Time | Number of Cycles | ||||
| Sr24 | Sr24#50 | 500 | CACCCGTGACATGCTCGTA AACAGGAAATGAGCAACGATGT | 94/3 min | 1 |
| 94/30 s; 57/30 s; 72/40 s | 30 | ||||
| 72/5 min | 1 | ||||
| Sr25 | Gb | 191 | CATCCTTGGGGACCTC CCAGCTCGCATACATCCA | 94/3 min | 1 |
| 94/30 s; 60/30 s; 72/40 s | 30 | ||||
| 72/5 min | 1 | ||||
| Sr26 | Sr26#43 | 207 | AATCGTCCACATTGGCTTCT CGCAACAAAATCATGCACTA | 94/3 min | 1 |
| 94/30 s; 56/30 s; 72/40 s | 30 | ||||
| 72/5 min | 1 | ||||
| Sr31 | SCSS30.2576 | 576 | GTCCGACAATACGAACGATT CCGACAATACGAACGCCTTG | 95/5 min | 1 |
| 95/15S; 60/15S; 72/30 s | 35 | ||||
| 72/5 min | 1 | ||||
| Sr31 | Iag95 | 1100 | CTCTGTGGATAGTTACTTGATCGA CCTAGAACATGCATGGCTGTTACA | 94/3 min | 1 |
| 94/30 s; 55/60 s; 72/70 s | 30 | ||||
| 72/5 min | 1 | ||||
| Sr38 | VENTRIUP-LN2 | 259 | GGGGCTACTGACCAAGGCT TGCAGCTACAGCAGTATGTACACAAAA | 94/3 min | 1 |
| 94/30 s; 65/30 s; 72/30 s | 30 | ||||
| 72/5 min | 1 | ||||
Table 4.
Average area under the disease progress curve (AUDPC) values across three single-race nurseries and infection responses (IRs) in adult plants from 2023 to 2024.
Table 4.
Average area under the disease progress curve (AUDPC) values across three single-race nurseries and infection responses (IRs) in adult plants from 2023 to 2024.
| Cultivar (Lines) | 21C3CTHQM | 34MKGQM | Sr Gene | ||||||
|---|---|---|---|---|---|---|---|---|---|
| 2023IR a | AUDPC | 2024IR | AUDPC | 2023IR | AUDPC | 2024IR | AUDPC | ||
| Qingmai H068 | 100S100 | 250.0 | 100S100 | 250.0 | 70S40 | 212.5 | 100S100 | 400.0 | - |
| RZ1901 | 70S70 | 175 | 100S100 | 120.5 | 100S100 | 262.5 | 70S50 | 200.0 | - |
| Taikemai 46 | 100S100 | 250.0 | 100S100 | 130.0 | 40MS50 | 100.0 | 30MR30 | 75.0 | - |
| Shannong 711006 | 30MS50 | 75.0 | 70S70 | 575.0 | 30MS50 | 75.0 | 30MS50 | 75.0 | - |
| LS1471 | 100S100 | 250.0 | 100S100 | 475.0 | 80S60 | 212.5 | 100S100 | 300.0 | - |
| Kexing 3302 | 5R5 | 12.5 | 5R5 | 37.5 | 0 | 0 | 0 | 0 | 38 |
| Hanke 4898 | 100S100 | 675.0 | 100S100 | 250.0 | 100S100 | 262.5 | 100S100 | 350.0 | - |
| YF6092 | 50S60 | 125.0 | 50S50 | 125.0 | 100S100 | 275.0 | 100S100 | 350.0 | - |
| Cunmai 116 | 60S70 | 150.0 | 70S50 | 175.0 | 100S100 | 262.5 | 100S100 | 512.5 | - |
| Zhongyuanguoke10 | 100S100 | 250.0 | 100S100 | 550.0 | 70S70 | 212.5 | 70S60 | 175.0 | - |
| Shannong K43057 | 100S100 | 250.0 | 100S100 | 425.0 | 30MR30 | 75.0 | 50MR50 | 150 | - |
| U1912 | 100S100 | 250.0 | 50S50 | 125.0 | 70MS60 | 175.0 | 50MS50 | 225.0 | - |
| Luqingmai 6 | 70S80 | 175.0 | 100S100 | 425.0 | 100S100 | 275.0 | 100S100 | 250.0 | - |
| Linmai 1900 | 60MS50 | 150.0 | 50MS50 | 125.0 | 100S100 | 275.0 | 100S100 | 250.0 | - |
| Jinghua 301 | 100S100 | 300.0 | 100S100 | 550.0 | 100S100 | 425.0 | 100S100 | 250 | - |
| Keda 166 | 100S100 | 750.0 | 100S100 | 510.0 | 100S100 | 150.0 | 100S100 | 100.0 | - |
| Jiushenghe 169 | 50MR50 | 650.0 | 50MR40 | 125.0 | 30MR40 | 75.0 | 30MR20 | 75.0 | 31 |
| Shangmai 207 | 10R5 | 37.5 | 10R10 | 50.0 | 10R10 | 25.0 | 10R10 | 25.0 | 31, 38 |
| Taikemai 51 | 70S60 | 175.0 | 50S50 | 125.0 | 50MS50 | 125.0 | 30MS30 | 75.0 | - |
| Xingmai 40 | 40S50 | 150.0 | 100S100 | 500.0 | 70MS80 | 175.0 | 40MS60 | 100.0 | - |
| Kemai 316 | 40S50 | 112.5 | 50S50 | 125.0 | 50MS60 | 125.0 | 30MR10 | 75.0 | - |
| Shannong K31565 | 100S100 | 350.0 | 100S100 | 575.0 | 100S100 | 262.5 | 100S100 | 250.0 | - |
| Kemai 301 | 20MR20 | 62.5 | 20MR40 | 50.0 | 50MS80 | 125.0 | 50MS50 | 150.0 | - |
| Jimai 5086 | 100S100 | 250.0 | 100S100 | 300.0 | 100S100 | 275.0 | 100S100 | 300.0 | - |
| Linmai 12 | 30MR30 | 75.0 | 40MR50 | 100.0 | 5R5 | 12.5 | 10R10 | 25.0 | - |
| 19CA29 | 20R10 | 50.0 | 50MR50 | 150.0 | 40MR40 | 100.0 | 10R20 | 25.0 | - |
| Nongda 8136 | 5R5 | 12.5 | 10MR20 | 25.0 | 80MS70 | 200.0 | 60MS50 | 150.0 | - |
| Xinong 862 | 50MR60 | 125.0 | 40MR60 | 150.0 | 10MR30 | 100.0 | 20R10 | 50.0 | 31 |
| Xinong 303 | 50MR70 | 150.0 | 50MR50 | 175.0 | 50MR70 | 125.0 | 50MR50 | 175.0 | 31 |
| Xinong 5195 | 20MR70 | 75.0 | 30MR60 | 250.0 | 40MR40 | 100.0 | 30R10 | 75.0 | 31 |
| Fumai 1508 | 100S100 | 475.0 | 70S70 | 625.0 | 100S100 | 275.0 | 100S100 | 275.0 | - |
| Jimai 220014 | 50MS50 | 25.0 | 100S100 | 250.0 | 20MR10 | 100.0 | 30MR30 | 75.0 | - |
| Xinshiji 9 | 70MS60 | 175.0 | 50MS50 | 150.0 | 20MR10 | 50.0 | 40R30 | 100.0 | - |
| Xinliang 16 | 10R10 | 25.0 | 20R20 | 50.0 | 20R70 | 50.0 | 20R20 | 50.0 | 31 |
| SN1463 | 100S100 | 300.0 | 100S100 | 300.0 | 100S100 | 250.0 | 100S100 | 250.0 | - |
| Anke 2105 | 100S100 | 450.0 | 100S100 | 625.0 | 100S100 | 275.0 | 100S100 | 300.0 | - |
| Shi 6158 | 10R5 | 125.0 | 40R10 | 100.0 | 50MR50 | 150.0 | 40MR20 | 100.0 | - |
| Han 174291 | 10R5 | 125.0 | 10R10 | 25.0 | 30R60 | 75.0 | 5R5 | 12.5 | 31 |
| Womai 19 | 0 | 0 | 10R30 | 25.0 | 40MR30 | 125.0 | 20R10 | 150.0 | 31, 38 |
| Liumai 1186 | 100S100 | 300.0 | 100S100 | 550.0 | 100S100 | 52.5 | 100S100 | 350.0 | - |
| Jimai CHC4 | 100S100 | 300.0 | 100S100 | 600.0 | 100S100 | 52.5 | 100S100 | 350.0 | - |
| Jimai 5858 | 100S100 | 400.0 | 100S100 | 475.0 | 100S100 | 55.0 | 100S100 | 350.0 | - |
| Guanmai 99 | 80S80 | 250.0 | 100S100 | 525.0 | 80S70 | 90.0 | 100S100 | 250.0 | - |
| Zhongke 19021 | 0 | 0 | 0 | 0 | 5R5 | 5.0 | 10R10 | 25.0 | 31 |
| JK64109 | 50S40 | 150.0 | 100S100 | 250.0 | 100S100 | 50.0 | 100S100 | 250.0 | - |
| Shengmai 186 | 100S100 | 850.0 | 100S100 | 925.0 | 70S70 | 160.0 | 100S100 | 400.0 | - |
| Shi 17T5248 | 0 | 0 | 5R5 | 12.5 | 0 | 0 | 5R5 | 12.5 | 31 |
| Jimai 6266 | 30MR60 | 75.0 | 20MR70 | 75.0 | 0 | 0 | 0 | 0 | 31 |
| Heng H175087 | 100S100 | 350.0 | 100S100 | 900.0 | 100S100 | 62.5 | 100S100 | 250.0 | - |
| Jimai U87 | 60S50 | 150.0 | 100S100 | 500.0 | 70S60 | 35.0 | 100S100 | 250.0 | - |
| Shi 1750903 | 10R30 | 25.0 | 20R60 | 50.0 | 20R60 | 10.0 | 20R20 | 50.0 | 38 |
| Huacheng 138 | 100S100 | 300.0 | 100S100 | 250.0 | 80S80 | 40.0 | 70S40 | 175.0 | - |
| Huaifeng 36 | 10R10 | 200.0 | 10R10 | 25.0 | 5R5 | 5.0 | 5R5 | 12.5 | 31 |
| Shijingmai 138 | 70S70 | 175.0 | 70S70 | 175.0 | 60MS70 | 30.0 | 50MR70 | 125.0 | - |
| Jinong 17287 | 100S100 | 300.0 | 100S100 | 650.0 | 80S80 | 40.0 | 100S100 | 300.0 | - |
| Yannong 199 | 100S100 | 275.0 | 100S100 | 450.0 | 80S80 | 42.5 | 100S100 | 275.0 | - |
| Shannong 534421 | 20MR60 | 50.0 | 30MR50 | 75.0 | 10R10 | 10.0 | 5R5 | 12.5 | - |
| Jimai 5189 | 100S100 | 300.0 | 100S100 | 450.0 | 100S100 | 52.5 | 100S100 | 250.0 | - |
| Jimai 5209 | 30MS40 | 75.0 | 100S100 | 250.0 | 70S80 | 35.0 | 50S50 | 125.0 | - |
| Zhongyuanguoke 9 | 70MR70 | 175.0 | 30MR30 | 75.0 | 10R30 | 7.5 | 0 | 0 | - |
| Liangxing 87 | 5R5 | 12.5 | 10R10 | 25.0 | 5R5 | 2.5 | 0 | 0 | 31 |
| Yannong 31 | 100S100 | 275.0 | 100S100 | 525.0 | 100S100 | 52.5 | 70MS60 | 175.0 | - |
a Infection responses include severity/infection response type/incidence, e.g., ‘100S100’ the first ‘100’ represents disease severity, ‘S’ denotes susceptibility, and the second ‘100’ corresponds to the disease incidence rate; severity and incidence rates in the table are percentages; R: resistant, MR: moderately resistant, MS: moderately susceptible, S: susceptible, 0: immune.
Table 5.
Assessment of the resistance of tested wheat accessions to two races of Puccinia graminis f. sp. tritici at the adult plant stage.
Table 5.
Assessment of the resistance of tested wheat accessions to two races of Puccinia graminis f. sp. tritici at the adult plant stage.
| Races | Immune | Resistant–Moderately Resistant | Moderately Susceptible–Susceptible | |||
|---|---|---|---|---|---|---|
| 2023 | 2024 | 2023 | 2024 | 2023 | 2024 | |
| 21C3CTHQM | 3 (4.8) a | 1 (1.6) | 20 (32.3) | 22 (35.5) | 39 (62.9) | 39 (62.9) |
| 34MKGQM | 3 (4.8) | 4 (6.5) | 23 (37.1) | 23 (37.1) | 36 (58.1) | 35 (56.5) |
| All races | 1 (1.6) | 0 (0) | 20 (32.3) | 21 (33.9) | 41 (66.1) | 41 (66.1) |
a 3 (4.8): The number outside the parentheses represents the number of cultivars, and the number inside the parentheses represents the percentage of that number.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Wei, Y.; Zhao, D.; Cao, T.; Sun, H.; Zou, L.; Yang, J.; Zhang, G.; Li, T.; Zhang, C.; Chen, Q.; et al. Stem Rust Resistance in 62 Cultivars and Elite Lines from Northern Huanghuai Region of China. Agronomy 2025, 15, 1174. https://doi.org/10.3390/agronomy15051174
AMA Style
Wei Y, Zhao D, Cao T, Sun H, Zou L, Yang J, Zhang G, Li T, Zhang C, Chen Q, et al. Stem Rust Resistance in 62 Cultivars and Elite Lines from Northern Huanghuai Region of China. Agronomy. 2025; 15(5):1174. https://doi.org/10.3390/agronomy15051174
Chicago/Turabian StyleWei, Yifan, Di Zhao, Tingjie Cao, Huiyan Sun, Longmei Zou, Jinjing Yang, Gongjun Zhang, Tong Li, Conghao Zhang, Qiutong Chen, and et al. 2025. "Stem Rust Resistance in 62 Cultivars and Elite Lines from Northern Huanghuai Region of China" Agronomy 15, no. 5: 1174. https://doi.org/10.3390/agronomy15051174
APA StyleWei, Y., Zhao, D., Cao, T., Sun, H., Zou, L., Yang, J., Zhang, G., Li, T., Zhang, C., Chen, Q., & Li, T. (2025). Stem Rust Resistance in 62 Cultivars and Elite Lines from Northern Huanghuai Region of China. Agronomy, 15(5), 1174. https://doi.org/10.3390/agronomy15051174
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
