Next Article in Journal
The Effect of Pesticide Solutions on the Deposition of Bubble-Containing Droplets
Previous Article in Journal
Inter- and Intra-Specific Differences in Seed Germination Responding to Varying Osmotic Potentials in 261 Echinochloa Populations Collected from Rice Fields in Eastern China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 15
Issue 5
10.3390/agronomy15051171
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Integrating Agricultural Waste Recycling with Sustainable Feed Production: Microbial and Enzymatic Dynamics During Pleurotus Cultivation on Maize Straw

by
Hang Yang
1,
Gang Lin
1,2,
Shitao Wang
1,
Tao Wu
1,
Zhiwangjia Dan
1,
Junjuan Yang
1,
Min Lv
1 and
Yajiao Zhao
1,*
1
College of Pratacultural Science, Gansu Agricultural University, Lanzhou 730070, China
2
Department of Gansu Natural Resources Planning and Research Institute, Gansu Agricultural University, Lanzhou 730030, China
*
Author to whom correspondence should be addressed.
Agronomy 2025, 15(5), 1171; https://doi.org/10.3390/agronomy15051171
Submission received: 3 April 2025 / Revised: 30 April 2025 / Accepted: 7 May 2025 / Published: 12 May 2025
(This article belongs to the Section Agricultural Biosystem and Biological Engineering)
Browse Figures
Versions Notes

Abstract

:
Improving the utilization of spent mushroom substrate and enhancing the digestibility of straw-based feed are critical for promoting environmental sustainability. However, the effects of replacing sawdust with straw in the cultivation of Pleurotus ostreatus—including changes in physicochemical properties, enzyme activities, and microbial community structure and function—remain unclear. In this study, corn straw was used as the substrate for P. ostreatus cultivation. Dynamic changes during the fermentation process were investigated through analyses of biological growth characteristics, physicochemical properties, enzyme activities, and amplicon sequencing. The results indicated a significant increase in mushroom yield, with the M80% treatment group achieving a yield of 156.09 ± 7.15 g. The nutritional value of the fermented feed was markedly improved; after 50 days of fermentation, crude protein (CP) and ether extract (EE) contents increased by 5.42% and 0.79%, respectively, while acid detergent fiber (ADF) and neutral detergent fiber (NDF) contents decreased by 18.5% and 22.3%, compared to day 0. Activities of cellulase, xylanase, and laccase were also elevated, contributing to more effective lignocellulose degradation. Furthermore, Illumina sequencing revealed shifts in bacterial and fungal metabolic pathways. The fungal community was dominated by Ascomycota and Basidiomycota, with Pleurotus as the prevailing genus, while the bacterial community was mainly composed of antagonistic genera such as Bacillus and Bacteroides. These findings provide a theoretical basis for understanding the role of microbial interactions during straw substrate fermentation in improving feed quality and increasing P. ostreatus yield.

1. Introduction

As a major agricultural producer, China generates a substantial amount of crop straw each year. Statistics from 2023 estimate that the total production of crop straw resources in China is approximately 890 million tons [1,2]. The primary types of agricultural straw resources include rice straw, wheat straw, maize straw, and rapeseed straw [3,4]. Traditionally, these straw materials are mainly used for direct field return and as roughage for livestock feeding [5,6]. However, when used as animal feed, straw often exhibits low nutritional value and poor digestibility by livestock, rendering it unsuitable for direct feeding [7]. Thus, fermentation emerges as an effective processing strategy to enhance the nutritional quality of straw for feed purposes. Currently, biological processing methods such as silage, micro-storage, and the addition of enzyme preparations are employed to improve feed quality and storage [8]. The fermentation process primarily relies on bacteria or fungi to secrete metabolic products or functional physiological enzymes, which enhance the nutritional profile of the feed [9]. Despite these advancements, current feed fermentation methods mainly focus on the intrinsic value of the feed, often resulting in limited added value. Therefore, it becomes crucial to explore innovative methods that not only improve the nutritional value of straw but also promote sustainable agricultural practices by optimizing the entire production and recycling system.
In this context, edible fungi have attracted attention as a widely cultivated fungus that can improve both substrate composition and mushroom yield. The substrates used for mushroom cultivation, such as sawdust, maize cobs, and cottonseed hulls, are often highly lignified and have low nutritional value, even after fermentation [10,11]. The inherent high lignin content in these substrates limits their digestibility and nutritional utilization, making them unsuitable for feeding livestock without further processing. Furthermore, these substrates, once used, are frequently discarded, contributing to resource wastage and environmental pollution. However, by replacing these conventional substrates with agricultural waste, such as maize straw, we can significantly enhance both the ecological sustainability of mushroom production and the nutritional value of the resulting feed. This innovation not only addresses the challenges of substrate waste but also opens up new pathways for optimizing mushroom cultivation, enhancing resource efficiency, and improving agricultural waste recycling [12]. Thus, by optimizing the growth substrate to integrate mushroom farming with waste straw fermentation, we can produce nutrient—rich feed and high—value edible fungi. This approach boosts resource efficiency while enhancing environmental sustainability. Enzymes such as cellulase, laccase, and xylanase, which are produced through microbial metabolism in edible mushroom cultivation substrates, can effectively decompose lignin, hemicellulose, and cellulose [13]. However, the chemical bonds formed between lignin and carbohydrates hinder the efficiency of single-enzyme degradation due to interactions between polymerization and monomeric properties [14].
Lignin degradation involves a complex interplay of multiple enzymes, including laccases, peroxidases, and auxiliary enzymes. Cellulases rely on glycoside hydrolases to interact with cellulose and hemicellulose for hydrolysis [15], yet lignin in straw can hinder this process. Laccase, a distinct multicopper oxidase secreted by edible fungi, efficiently catalyzes the oxidation of lignin and other aromatic compounds [16]. Steinmetz et al. [17] demonstrated that laccase produced by edible fungi can effectively decompose lignin under mild conditions, breaking the chemical bonds in polymers formed by cellulose, hemicellulose, and lignin, thereby enhancing cellulase hydrolysis efficiency. Consequently, the ability of edible fungi to decompose and improve the cultivation substrates depends on the composition and capability of fungi and bacteria to secrete enzymes that degrade substrates such as lignin, cellulose, and hemicellulose. Investigating changes in required enzyme activity and microbial community structure, along with optimizing substrate composition, plays a crucial role in enhancing enzyme activity and synergy, thereby accelerating the decomposition and transformation processes by fungi and bacteria [18].
Recent studies have explored the potential of spent mushroom substrate as livestock feed. Research indicates that using mushroom-fermented substrate as roughage does not adversely affect the growth performance or health of livestock [19]. However, the effects of substrate composition on key factors such as feed quality, mushroom yield characteristics, enzyme activities (including cellulase, xylanase, and laccase), and microbial community dynamics remain underexplored [20]. To address these knowledge gaps, this study investigates the integration of agricultural waste recycling with sustainable feed production by focusing on the microbial and enzymatic dynamics during Pleurotus cultivation on maize straw. Our research aims to explore the symbiotic relationship among fungi, bacteria, and enzymes during fermentation, with a specific focus on how these interactions influence the nutritional properties of the feed and the efficiency of mushroom production. By adjusting the proportion of maize straw in the cultivation medium, we seek to identify the optimal substrate composition that maximizes both the feed’s nutritional quality and the yield of Pleurotus mushrooms. Through this, we will uncover the complex microbial mechanisms and enzymatic processes that underpin the fermentation of agricultural waste, offering novel insights into the integration of sustainable feed production and waste recycling. The results of this study will not only provide a deeper understanding of the microbial–enzymatic interactions during fungal fermentation but will also pave the way for new strategies to optimize agricultural waste recycling and improve the overall sustainability of feed production.

2. Materials and Methods

2.1. Experimental Design

This experiment was conducted in Diebu County, Gannan Tibetan Autonomous Prefecture, Gansu Province, China (longitude 102°55′ E, latitude 33°39′ N, altitude 2400–4102 m). The mushroom species used was Pleurotus ostreatus “Nongke 12”, preserved by Diezhou Edible Fungus Co., Ltd., is located in Gannan Tibetan Autonomous Prefecture, Gansu Province, China. The primary substrate is maize straw from the Forage Station of Zhangye, Gansu Province, and it also includes wheat bran, rapeseed meal, lime, and gypsum. The maize straw and wheat bran originated from the Forage Station of Zhangye, Gansu Province, and the rapeseed meal, lime, and gypsum were supplied by Diezhou Edible Fungus Co., Ltd., Gansu. The substrate composition ratios are based on dry weight, with a total of 240–250 g used per treatment. See Table 1 for the composition ratios of the oyster mushroom cultivation materials.
The crushed maize straw was mixed with supplementary materials such as wheat bran, oil residue, lime, and gypsum, then soaked in water for 1–2 h. A moisture analyzer was used to adjust the moisture content to approximately 67%. The substrate was then packed into 25 × 15 cm cultivation bags and underwent pasteurization for 10 h. After pasteurization, the substrate was cooled in a refrigerator for 2 h. A laminar flow cabinet was used to maintain a sterile environment for 30 min. The oyster mushroom strain (Nongke 12), stored at 8 °C, was taken out and activated in the laminar flow cabinet for 2 h at room temperature (19 °C). The activated spawn (solid-state, 7 g per pack) was inoculated into the substrate. The inoculated substrate was transferred to a mycelium growth room, incubated at 18–20 °C and 65–70% humidity for 18 days, then moved to a mushroom cultivation shed. The substrate was watered three times daily, with the shed temperature maintained at 17–20 °C and humidity at approximately 85%.

2.2. Sample Collection

Mushroom cultivation and sample collection for this experiment were completed between June and August 2023. Sampling was carried out on days 0, 25, 34, 40, and 50 of the mushroom fruiting stage. The complete oyster mushroom fruiting bodies were collected on each sampling day, with three replicates per treatment. All remaining fruiting bodies were harvested on the final day. After collection, the substrate was sampled using a five-point method, with three replicates for each treatment. The collected substrate was divided into three parts:
  • One part was dried in an oven at 120 °C for 30 min, then at 65 °C for 48 h, and ground for nutritional and physicochemical analysis.
  • Another part was stored at 4 °C for physiological enzyme activity testing.
  • The third part was frozen at −80 °C for DNA extraction of the ITS1 amplicon.

2.3. Nutritional and Physicochemical Analysis of Cultivation Substrate

2.3.1. Nutritional Analysis

Crude protein content: Determined by the Kjeldahl method [21], using a UDK 149 automatic Kjeldahl distillation apparatus (VELP, Usmate Velate, Italy).
ADF and NDF contents: Determined by the acid and alkali detergent method [22]. For the determination of NDF and ADF, 25 μm nylon fiber bags (F57, ANKOM Technology, Macedon, NY, USA) were used.
Crude ash content: Determined by the dry ashing method using a muffle furnace (Carbolite Gero, Bad Hersfeld, Germany). Ether extract content: Determined by the Soxhlet extraction method using an FTA406 Soxhlet extractor (Shanghai Fuma Laboratory Instrument Co., Ltd., Shanghai, China) [23].
The feeding value of Pleurotus residues was evaluated using RFV and RFQ, TDN, DMI, and DDM:
DDM = 88.9 − 0.779 × ADF;
DMI = 120/NDF;
RFQ = (TDN × DMI)/1.23;
RFV = [87.8 − (0.7 × ADF)] × (120/NDF).
NDF and ADF levels were used in the predictive models for these metrics.

2.3.2. Measurement of Enzyme Activity

Homogenate tissue and extraction buffer at a ratio of 1 g tissue to 10 mL buffer under ice-cold conditions. Centrifuge the mixture at 10,000 rpm for 10 min at 4 °C. Place the collected supernatant on ice for further analysis.
Common Coarse Enzyme Extraction Buffer Compositions:
Phosphate-Buffered Saline (PBS): Mix 0.05 mol/L potassium dihydrogen phosphate (KH2PO4) and 0.05 mol/L dipotassium hydrogen phosphate (K2HPO4), pH 7.0–7.5.
Assay Methods:
Laccase Activity: Determined using the ABTS method [24]. The laccase (Lac) assay kit is from Suzhou Griss Biotechnology Co., Ltd. (Suzhou, China). Sample type: Plant tissue.
Cellulase Activity: Measured using the DNS method [25]. The cellulase (CL) assay kit is used.
Xylanase Activity: Measured using the DNS method [26]. Sample type: Plant tissue.

2.4. Sensory Quality and Yield Analysis of Pleurotus

Pleurotus samples were collected and weighed (in grams) on days 25, 34, and 40. Biological growth quality and yield were assessed by measuring cap diameter (cm), stipe length (cm), individual mushroom mass (g), and mushroom count using calipers.

2.5. DNA Extraction and Illumina MiSeq Sequencing of 16S rRNA and ITS1 Amplicons

DNA was extracted from 0.5 g of the sample using a kit from Omega (M0491L) Bio-Tek (Norcross, GA, USA), following the manufacturer’s instructions. Molecular size was assessed by 0.8% agarose gel electrophoresis, and DNA quantification was performed using a Nanodrop spectrophotometer.
Community changes in bacteria and fungi within the sample were analyzed using Illumina MiSeq sequencing. The 16S rRNA gene’s V3-V4 region, providing reliable bacterial taxonomic information, was amplified using primers F: (ACTCCTACGGGAGGCAGCA) and R: (GGACTACHVGGGTWTCTAAT). For fungi, ITS region primers ITS V1 F (GGAAGTAAAAGTCGTAACAAGG) and R (GCTGCGTTCTTCATCGATGC) were used to obtain accurate taxonomic information. The raw sequencing data were analyzed using the QIIME 2 (2019.4) software package.

2.6. Statistical Analysis

Statistical analyses were performed using EXCEL 2019 and SPSS 26.0 software (SPSS, Chicago, IL, USA), with one-way analysis of variance (ANOVA) employed to assess the significance of the data. Visualizations of the relationships between nutritional indices were created using Origin 2021. To explore the correlations between nutritional value and extracellular enzyme activity, principal component analysis (PCA) was conducted utilizing the “FactomineR 2.11” and “Factoextra 1.0.7” packages.
The Mantel test, implemented with the linkET package in R, was used to evaluate both direct and indirect relationships between microbial communities and factors such as feed nutritional indices and enzyme activities. Sankey diagrams in R were utilized to visually represent changes in species and variations in species count within bacterial and fungal communities. Metabolic predictions for bacteria and fungi were conducted using Paisenno (Shanghai, China).

3. Results

3.1. Yield and Sensory Quality Changes in Oyster Mushrooms After Fruiting

When corn straw was used as the cultivation material, the sensory qualities of oyster mushrooms were evaluated. In the first flush, the oyster mushrooms had the highest yield and cap number, exhibited a soft texture, and had a distinctive fresh aroma. In the second flush, although the number of caps decreased, their length and thickness significantly increased, resulting in a more resilient texture. By the third flush, both yield and cap number declined, and quality was inferior to that of the second flush (see Figure 1a).
Precise measurements were taken of the cap length, stipe length, number of caps, individual mushroom weight, and fresh mushroom yield of the oyster mushrooms (see Figure 1b–f). Under different cultivation conditions, the oyster mushrooms demonstrated high yield and superior quality. After 25 days of fermentation, the cap diameters in the M70%, M75%, and M85% treatment groups were significantly larger than those in the M80% group. However, after 34 days of fermentation, the M80% group had a significantly larger cap diameter than other groups, reaching 6.45 cm (p < 0.05). At 40 days of fermentation, the M80% group still showed the largest cap diameter, at 5.88 cm.
In terms of cap number, at 25 days of fermentation, the M70% and M85% groups had significantly more caps than the M80% group, with the M85% group having the highest counts—33 and 38, respectively (p < 0.05). At 34 days of fermentation, differences among the groups were not significant, with cap numbers at 20, 20, 21, and 17, respectively. For the same treatment group, fermentation duration significantly affected cap number. In the M70% group, the highest number of caps was obtained at 25 days, with increases of 13 caps compared to 34 and 40 days. The M75%, M80%, and M85% groups also had significantly more caps at 25 days than at other fermentation stages (p < 0.01).
For stipe length, at 34 days of fermentation, the M70% group had the longest stipes, reaching 6.60 cm, which was significantly longer than that of the M75% group (p < 0.05), and extremely significantly longer than the M80% and M85% groups—by 1.25 cm, 1.54 cm, and 1.72 cm (p < 0.01), respectively. At 40 days of fermentation, the M70% group continued to have the longest stipes at 6.36 cm (p < 0.05). Within the same treatment, the M70% group had the shortest stipes at 25 days, but these were 1.30 cm and 0.31 cm longer at 34 and 40 days, respectively.
Regarding individual mushroom weight, at 40 days of fermentation, the M85% group had the highest single mushroom mass at 6.54 g, followed by the M75%, M70%, and M80% groups at 6.11 g, 5.91 g, and 5.54 g, respectively. Within the same treatment, the M70% group reached its highest individual mushroom weight at 34 days (6.06 g), representing increases of 1.30 g and 0.31 g over 25 and 40 days, respectively. The highest for the M75% group occurred at 40 days (6.11 g), while the M80% group’s highest value was at 25 days (6.03 g).
In terms of fresh mushroom yield, at 25 days of fermentation, the M80% group had a significantly higher yield than the M85% group (p < 0.01), and was significantly higher than the M70% and M75% groups (p < 0.05), exceeding them by 10 g, 22 g, and 33 g, respectively. After 34 days, the M85% group had the highest yield at 112.33 g, followed by the M70%, M75%, and M80% groups at 114.47 g, 114.07 g, and 112.17 g, respectively. At 40 days, the M75% group had the highest yield at 97.72 g, followed by M70% (92.08 g), M85% (88.39 g), and M80% (84.75 g). Within the same treatment, for the M70% group, the highest yield was obtained at 25 days (146.34 g), showing a significant increase compared to other durations.

3.2. Sensory Evaluation, Nutritional Quality, and Feeding Value Assessment of Fermented Feed

3.2.1. Sensory Evaluation of Feed

When evaluating the sensory characteristics of the initial cultivation substrate and the fermented feed substrate, it was observed that the fermented feed substrates in the M70%, M75%, and M80% treatment groups all formed filamentous mycelial aggregates. Compared with the unfermented original substrate, the fermented substrate exhibited a softer texture and a yellowish-white hue. Among them, the M75% and M80% treatment groups showed the most pronounced mycelial network envelopment and softest texture. When gently pressed, corn straw powder easily detached from the material. All fermented feed substrates in each treatment group exhibited a strong mushroom aroma (see Figure 2a,b).

3.2.2. Evaluation of Nutritional Quality of Feed

A basic nutritional evaluation was conducted on the fermented cultivation substrates from different treatments and mushroom production days, focusing on crude protein, ADF, NDF, crude fat, RFV, RFQ, and crude ash contents (see Figure 2c–h). The crude protein content of the original substrate was 5.65 ± 0.7. After 25 days of fermentation, the crude protein content significantly increased to 9.35 ± 0.8, showing a highly significant difference compared to the original material (p < 0.01). After 25 days of fermentation, there was no significant difference in crude protein content among the M70%, M75%, M80%, and M85% groups; however, at 40 days of fermentation, the M80% group had the highest crude protein content, reaching 10.48 ± 0.76. Regarding ADF and NDF, the original feed substrates in all four groups had significantly higher ADF and NDF contents than the fermented substrates (p < 0.05), with the M80% and M85% groups exhibiting higher fiber degradation rates. With increasing fermentation duration, ADF and NDF contents gradually decreased.
Additionally, the crude fat content in all four treatment groups gradually increased with longer fermentation times. In the M70% and M75% groups, the crude fat contents at 40 and 50 days of fermentation were significantly higher than at 0 days (p < 0.01); in the M80% and M85% groups, crude fat content was lowest at the initial stage (0 days) and increased significantly as fermentation time progressed. After 40 days of fermentation, the crude fat content in the M80% and M85% groups was significantly higher than that in the M70% and M75% groups (p < 0.05); at 50 days, it was still significantly higher than in the M75% group (p < 0.05). In all treatment groups, crude ash content showed a continuous increase over the fermentation period. It was lowest at 0 days and peaked at days 40 and 50, both exceeding 20%.
Both RFQ and RFVs increased significantly throughout the fermentation process, with the highest values recorded at 50 days (p < 0.05). The improvement in the M80% group was significantly greater than that in the M70%, M75%, and M85% groups (p < 0.05).

3.3. Changes in Enzyme Activity and Correlation of Nutritional Indicators in Cultivation Material over Fermentation Days

3.3.1. Changes in Enzyme Activity and Principal Component Analysis

The fermentation quality of the feed substrate affects its nutritional value. The activities of cellulase, xylanase, and laccase are key factors in reducing the fiber content in the substrate (see Figure 3a–c).
Xylanase activity showed the greatest variation at 25 days of fermentation, with the highest activity of 47 U·g−1 observed in the M80% treatment. There were no significant differences in xylanase activity among the M70%, M75%, M80%, and M85% treatments. At 40 and 50 days of fermentation, xylanase activity ranged from 37 to 43 U·g−1, and the activity at 25 days was significantly higher than at 34 days (p < 0.05). Laccase activity was primarily influenced by the duration of fermentation, with significantly higher activity at 34 and 40 days than at 25 and 50 days (p < 0.05). Notably, at 40 days, the laccase activity in the M70%, M75%, M80%, and M85% treatments reached an average of 75 U·g−1. In the M80% treatment, laccase activity was highest at 34 and 40 days of fermentation, ranging from 135 to 140 U·g−1, following a trend of initial increase and subsequent decrease. The activity of cellulase averaged between 500 and 550 U·g−1 at 34 and 40 days of fermentation, with the M75% treatment showing significantly higher activity than the M70%, M80%, and M85% treatments (p < 0.05).
Principal component analysis (PCA) indicated that the PCoA1 and PCoA2 axes explained 70.3% and 11.7% of the variation, respectively, together accounting for 82% of the total variation in the samples. The NDF and ADF content in the feed were significantly and negatively correlated with other nutritional indicators across the M70%, M75%, M80%, and M85% treatments (p < 0.01). Moreover, after fermentation, a positive correlation was observed between feed nutrition and enzyme activity across treatments, with crude fat showing significant differences among the indicators (p < 0.05).

3.3.2. Correlation Between Nutritional Parameters and Enzyme Activity

According to Figure 4a, the stress value of the non-metric multidimensional scaling (NMDS) analysis was 0.136, indicating that the original structure of the data is acceptable. At the same fermentation stage, nutritional indicators and enzyme activity showed clear clustering relationships. However, there were significant differences in nutritional indicators and enzyme activity between different fermentation stages (p < 0.05).
As shown in Figure 4b, crude protein was highly significantly positively correlated with laccase, crude fat, crude ash, and relative feed quality (RFQ), while it was highly significantly negatively correlated with acid detergent fiber (ADF) and neutral detergent fiber (NDF) (p < 0.001). In addition, both RFQ and relative feed value (RFV) were highly significantly negatively correlated with ADF and NDF (p < 0.001), and were significantly positively correlated with crude protein, laccase, crude fat, and crude ash (p < 0.01).

3.4. Changes in Microbial Community Structure and Functional Metabolic Pathway Predictions

3.4.1. Relationships Among Fungi, Bacteria, Feed Nutrition, Enzyme Activity, and Changes in Microbial Community Structure

Laccase activity was significantly positively correlated with crude protein (CP) and neutral detergent fiber (NDF), while cellulase activity was significantly negatively correlated with NDF (Figure 5a). There were no significant differences between bacterial and fungal community species and various nutritional indicators. However, compared to bacterial community structure, fungal community abundance showed a closer relationship with feed nutritional indicators.
In the Sankey diagram (Figure 5b), the changes in the abundance of fungal and bacterial communities are depicted. The fungal abundance accounted for over 430, predominantly comprising the genus Ceriporia (369.47), mainly represented by the species Pleurotus nebrodensis. This was followed by the genus Fusarium (51.66), which remained largely unclassified. In the bacterial community structure, the primary genera included Bacillus (55.06) and Lysinibacillus (23.83). Key species included Lactobacillus acidophilus (13.97), Clostridium butyricum (6.48), unclassified Bacillus (25.33), and unclassified Lysinibacillus (23.83).

3.4.2. Prediction of Functional Metabolic Pathways in Bacteria and Fungi

Based on the predicted metabolic pathways (Figure 6), after fermentation, microbial function prediction indicated that the main metabolic pathways were carbohydrate degradation and amino acid degradation. Among these, the abundances of the electron transport chain and the tricarboxylic acid (TCA) cycle increased (Figure 5 and Figure 6). In the prediction of fungal functions, the pathways related to polysaccharide degradation, especially cellulose and pectin decomposition, showed higher abundance. Pathways involved in amino acid biosynthesis, aminoacyl-tRNA loading, fatty acid and lipid biosynthesis, and secondary metabolite biosynthesis were the most abundant, followed by precursor metabolite and energy generation pathways. The resulting amino acids and acetyl-CoA participate in the TCA cycle, providing energy for fungal and bacterial lignocellulose degradation.

4. Discussion

Maize stalks, being a primary source of roughage for livestock feed, are characterized by their high lignification, poor palatability, and low nutritional value. Through biological fermentation, the nutritional quality of maize stalk feed can be effectively improved, and value-added byproducts can be obtained. This study explores the use of maize stalks as a substitute for materials like sawdust and maize cobs in the cultivation of oyster mushrooms. In the study, the sensory quality of the cultivation substrate is significantly enhanced in terms of softness, color, and aroma post fermentation. This finding is consistent with the research of Huang Liang et al. [27]. Meanwhile, nutritional analysis of the substrate showed a substantial enhancement in the nutritional quality and feeding value of the fermented corn stalks. Studies confirm that feed fermentation effectively boosts nutritional quality. In contrast, Barros’ [28] study has shown that although the nutritional value of substrates used for cultivating various mushrooms has improved, the crude protein and fat contents of wood- and corncob-based substrates are 5.78%, 1.02%, and 7.45% and 0.98%, respectively, which are all lower than the results of this study. This may be attributed to the differences in physical structure, chemical composition, and bioconversion efficiency between corn stover and materials such as sawdust and corn cobs.. These findings imply that maize stalks are a more advantageous cultivation substrate for oyster mushrooms, offering better nutritional value and sensory qualities when transformed into animal feed. Notably, after oyster mushroom fermentation, the resulting feed exhibited a pronounced mushroom aroma, with flavor compounds primarily derived from amino acids, which may provide added benefits for livestock growth performance and palatability. However, this study also discovered a highly significant positive correlation between laccase activity and the activities of cellulase and xylanase, with the highest laccase activity observed at 40 days of fermentation. This could be because laccase breaks down lignin and other substances through oxidation [29], reducing the density of cell walls and making cellulose and xylan more accessible to enzymatic degradation [30]. Some studies have found that laccase can oxidatively degrade phenolic compounds (such as tannins and lignin) that inhibit enzyme activity [31,32], further enhancing the hydrolytic efficiency of cellulase and xylanase. In our study, the focus was primarily on the relationship between enzyme activity changes post-harvest and the nutritional quality of the feed. However, the enzyme activity measurements did not control for temperature, pH, or aeration, which resulted in large variations in enzyme activity. Future research will aim to address these issues and provide more controlled data.
After fermenting with oyster mushrooms, we harvested three rounds of crops, demonstrating that growing edible mushrooms on maize stalks not only improves feed nutritional quality but also boosts the economic value of the stalks. The sensory qualities of the cultivated mushrooms were notable, with thick, broad caps and numerous fruiting bodies. However, yield and quality varied significantly depending on when they were harvested. At 25 days, yields ranged from 130 to 156 g across treatments. At 34 days, yields were between 110 and 120 g, and by 40 days, yields dropped to 85 to 90 g. Interestingly, the mushrooms harvested at 34 days had superior sensory qualities compared to those harvested at 25 and 40 days, indicating significant variations in yield and quality depending on the harvest period. Similarly, Li Xiaoyu [33] found that using common reed substrates increased oyster mushroom yields and boosted total sugar content by 12.11%. The possibly higher yield at 25 days may be due to strong mycelium activity and ample nutrients. However, as the growth period extends to 34 and 40 days, yields are likely to decrease due to nutrient depletion. This depletion results in weaker mycelium growth and metabolic activity. Despite this, the quality was found to be optimal at 34 days. This may be due to the accumulation of metabolic byproducts and secondary metabolites, which can enhance the mushroom’s quality [34]. The primary factors affecting the nutritional quality of mushroom cultivation substrates, such as cellulase, xylanase, and laccase, are key enzymes responsible for enhancing nutritional quality by reducing fiber content [35,36]. The present study found that cellulase, xylanase, and laccase all showed high activities during the fermentation process. Among them, cellulase activity was the highest, reaching 534–550 U·g−1, while xylanase and laccase activities were 37–43 U·g−1 and 135–140 U·g−1, respectively. In addition, the contents of acid detergent fiber (ADF) and neutral detergent fiber (NDF) were highly significantly negatively correlated with the activities of these enzymes. This suggests that fermentation with white-rot fungi improved fiber degradation in the substrates, enhancing feed digestibility and enriching the nutritional quality of the feed with metabolic byproducts [37]. Research has demonstrated [38] that cellulase and xylanase work synergistically to increase their hydrolysis efficiency, effectively disrupting plant cell wall structures. This makes nutrients more accessible for digestion and absorption by livestock.
In this study, it was observed that fungal and bacterial abundance did not significantly affect various feed indicators. This could be attributed to the accumulation of metabolic products from fungi and bacteria, which enhanced the nutritional value of the feed through process-related changes [39]. In this study, the fungal abundance is primarily composed of the genera Pleurotus and Bacillus, with abundances of 369.47 and 51.66, respectively. This indicates that Pleurotus plays a major role in mushroom cultivation and in improving the nutritional value of the feed. However, due to the significantly higher richness of fungal species compared to bacteria in the microbiome, the contribution to changes in enzyme activities is primarily attributed to the fungus P. ostreatus. P. ostreatus fermentation is predominantly influenced by the Hymenochaetales order, particularly the Polyporaceae family. This group plays a crucial role in promoting enzymatic activity changes and exhibiting antimicrobial properties during feed fermentation [40]. In this study, it was found that the Bacillus species present was an undefined strain that effectively degrades lignocellulose. Previous studies suggest that cellulase, xylanase, and laccase can significantly enhance the biodegradation capacity of Bacillus, especially for materials such as waste straw [41]. This aligns with findings by Gonani [42], who demonstrated that spent mushroom substrate can serve as a plant growth medium, effectively stabilizing the microbial community structure around plant roots. Additionally, this study found bacterial abundances for Bacillus, Lysinibacillus, and Bacteroides at 55.06, 23.83, and 13.71, respectively. Research indicates that these genera can secrete enzymes like cellulases, xylanases, and proteases, efficiently decomposing polysaccharides and phenolic compounds and producing a large number of metabolic products [43]. These bacteria can also inhibit the growth of harmful microorganisms [44]. During the prolonged fermentation of substrate materials with varying compositions by Pleurotus (oyster mushrooms), distinct fungal and bacterial communities develop [45]. This microbial diversity enhances the nutritional value of the substrate, though it may also pose certain health and safety risks for animals [46]. Our study identified that the dominant fungal and bacterial genera are Trichoderma and Bacillus, both known for their significant inhibitory effects against harmful pathogens. To accurately interpret these metabolic products, researchers typically focus on key pathways and metabolites that exhibit significant changes, aiding in the understanding of microbial ecological functions and interactions during substrate fermentation [47]. This research has demonstrated the following: Bacillus spp. possess notable advantages in biosynthesis, degradation, and energy production, producing enzymes such as cellulases and xylanases, which are applied in industrial enzyme production [48], antibiotic production, and environmental remediation [49]. Lysobacter spp. excel in enzyme production and organic matter degradation, making them important industrial microorganisms [50]. Bacteroides spp. play a crucial role in polysaccharide degradation, protein degradation, and short-chain fatty acid production, being essential components of the gut microbiome [51]. Trichoderma spp. exhibit outstanding capabilities in biosynthesis, degradation, and energy generation, particularly in the synthesis of cellulases and laccases. The antimicrobial compounds and biocontrol potential of Trichoderma spp. offer extensive applications in agriculture and environmental remediation [52]. These insights underscore not only the ecological significance of microbial communities but also their substantial potential in industrial and environmental applications.

5. Conclusions

The present study demonstrates that corn straw, which typically has low nutritional value, can be effectively converted into high-quality livestock feed through fermentation with Pleurotus ostreatus. During the fermentation process, enzymes such as cellulase, xylanase, and laccase reduce fiber content and increase digestibility, significantly improving the nutritional composition of the substrate. In addition, the fungal microbial community was dominated by the genus Pleurotus, while Bacillus was predominant among bacteria. The interaction between fungi and bacteria promoted lignocellulose degradation and the accumulation of metabolic products. These findings highlight the potential of utilizing agricultural waste for sustainable feed production, contributing to resource recycling and environmental protection.

Author Contributions

H.Y.: data curation, formal analysis, methodology, writing—original draft; G.L.: conceptualization, methodology, visualization; S.W.: formal analysis, validation, writing—review and editing; T.W.: software, validation, writing—review and editing, formal analysis; Z.D.: investigation, resources, supervision, formal analysis; J.Y.: validation, visualization, supervision, formal analysis; M.L.: resources, investigation, supervision, visualization; Y.Z.: conceptualization, funding acquisition, project administration, supervision, writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Gansu Provincial University Young Doctor Support Project (2024QB-076), the Gansu Provincial Department of Education Major Incubation Project for University Research and Innovation Platforms (2024CXPT-07), and the Gansu Provincial Graduate Innovation Star Project (2023CXZX-666).

Data Availability Statement

The data from this study are currently not publicly available, but we will arrange for their release in due course to promote communication and progress in the relevant field of research.

Acknowledgments

We thank Xidong Zhu, Xinquan Han, and Zulin Yuan for their assistance with the data analysis approach and chemical analysis.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. National Bureau of Statistics. Announcement of Grain Production Data for 2023 [EB/OL]. 11 December 2023. Available online: https://www.gov.cn/lianbo/bumen/202312/content_6919545 (accessed on 5 October 2024).
  2. Qian, B.; Shao, C.; Yang, F. Spatial Suitability Evaluation of the Conversion and Utilization of Crop Straw Resources in China. Environ. Impact Assess. Rev. 2024, 105, 107438. [Google Scholar] [CrossRef]
  3. Mu, G.; Xu, L.; Zhang, J. Study of the Utilization of Main Crop Straw Resources in Southern China and Its Potential as a Replacement for Chemical Fertilizers. Front. Plant Sci. 2024, 14, 1172689. [Google Scholar] [CrossRef]
  4. Wang, Y.; Bi, Y.; Gao, C. The Assessment and Utilization of Straw Resources in China. Agric. Sci. China 2010, 9, 1807–1815. [Google Scholar] [CrossRef]
  5. Lin, B.-J.; Cheng, J.; Duan, H.-X.; Liu, W.-X.; Dang, Y.P.; Zhao, X.; Zhang, H.-L. Optimizing Straw and Nitrogen Fertilizer Resources for Low-Carbon Sustainable Agriculture. Resour. Conserv. Recycl. 2024, 209, 107743. [Google Scholar] [CrossRef]
  6. Sheikh, G.G.; Ganai, A.M.; Reshi, P.A.; Bilal, S.; Mir, S.; Masood, D. Improved Paddy Straw as Ruminant Feed: A Review. Agric. Rev. 2018, 39, 137–143. [Google Scholar] [CrossRef]
  7. Børsting, C.; Olijhoek, D.; Hellwing, A.; Moyes, K.; Østergaard, S.; Weisbjerg, M.; Lund, P.; Larsen, M.; Mogensen, L.; Raun, B.; et al. Replacing Silage with Large Amounts of Concentrate and Straw Affects Milk Production, Economics, and Climate Differently in Holstein and Jersey Cows. Livest. Sci. 2023, 275, 105293. [Google Scholar] [CrossRef]
  8. Sheng, P.; Bai, B.; Liu, M.; Ma, W.; Liu, J.; Song, C.; Du, S.; Ge, G.; Jia, Y.; Wang, Z. Effects of Different Additives and Ratios on Broom Sorghum Straw Silage Characteristics and Bacterial Communities. Microorganisms 2024, 12, 2062. [Google Scholar] [CrossRef]
  9. Zhang, Z.; Chen, X.; Gao, L. New Strategy for the Biosynthesis of Alternative Feed Protein: Single-Cell Protein Production from Straw-Based Biomass. GCB Bioenergy 2024, 16, e13120. [Google Scholar] [CrossRef]
  10. Murillo, W.; Suárez, H. Evaluation of Nutritional Values of Wild Mushrooms and Spent Substrate of Lentinus crinitus (L.) Fr. Heliyon 2020, 6, e03502. [Google Scholar] [CrossRef]
  11. Kalač, P. A Review of Chemical Composition and Nutritional Value of Wild-Growing and Cultivated Mushrooms. J. Sci. Food Agric. 2013, 93, 209–218. [Google Scholar] [CrossRef]
  12. Amara, A.A.; El-Baky, N.A. Fungi as a Source of Edible Proteins and Animal Feed. J. Fungi 2023, 9, 73. [Google Scholar] [CrossRef]
  13. Zhao, Y.; Shakeel, U.; Rehman, M.S.U.; Li, H.; Xu, X.; Xu, J. Lignin-Carbohydrate Complexes (LCCs) and Its Role in Biorefinery. J. Clean. Prod. 2020, 253, 120076. [Google Scholar] [CrossRef]
  14. Woiciechowski, A.L.; Neto, C.J.D.; de Souza Vandenberghe, L.P.; de Carvalho Neto, D.P.; Sydney, A.C.N.; Letti, L.A.J.; Karp, S.G.; Torres, L.A.Z.; Soccol, C.R. Lignocellulosic Biomass: Acid and Alkaline Pretreatments and Their Effects on Biomass Recalcitrance–Conventional Processing and Recent Advances. Bioresour. Technol. 2020, 304, 122848. [Google Scholar] [CrossRef]
  15. Sipponen, M.H.; Rahikainen, J.; Leskinen, T.; Pihlajaniemi, V.; Mattinen, M.-L.; Lange, H.; Crestini, C.; Österberg, M. Structural Changes of Lignin in Biorefinery Pretreatments and Consequences to Enzyme-Lignin Interactions. Nord. Pulp Pap. Res. J. 2017, 32, 550–571. [Google Scholar] [CrossRef]
  16. Nlandu, H.; Belkacemi, K.; Chorfa, N.; Elkoun, S.; Robert, M.; Hamoudi, S. Laccase-Mediated Grafting of Phenolic Compounds onto Lignocellulosic Flax Nanofibers. J. Nat. Fibers 2022, 19, 222–231. [Google Scholar] [CrossRef]
  17. Steinmetz, V.; Villain-Gambier, M.; Klem, A.; Ziegler, I.; Dumarcay, S.; Trebouet, D. In-Situ Extraction of Depolymerization Products by Membrane Filtration Against Lignin Condensation. Bioresour. Technol. 2020, 311, 123530. [Google Scholar] [CrossRef]
  18. Sharma, S.; Kumawat, K.C.; Kaur, S. Potential of Indigenous Ligno-Cellulolytic Microbial Consortium to Accelerate Degradation of Heterogeneous Crop Residues. Environ. Sci. Pollut. Res. 2022, 29, 88331–88346. [Google Scholar] [CrossRef]
  19. Kazige, O.K.; Chuma, G.B.; Lusambya, A.S.; Mondo, J.M.; Balezi, A.Z.; Mapatano, S.; Mushagalusa, G.N. Valorizing Staple Crop Residues through Mushroom Production to Improve Food Security in Eastern Democratic Republic of Congo. J. Agric. Food Res. 2022, 8, 100285. [Google Scholar] [CrossRef]
  20. Leadbeater, D.R.; Oates, N.C.; Bennett, J.P.; Li, Y.; Dowle, A.A.; Taylor, J.D.; Alponti, J.S.; Setchfield, A.T.; Alessi, A.M.; Helgason, T.; et al. Mechanistic Strategies of Microbial Communities Regulating Lignocellulose Deconstruction in a UK Salt Marsh. Microbiome 2021, 9, 1–16. [Google Scholar] [CrossRef]
  21. Thomas, A.T. An automated procedure for the determination of soluble carbohydrates in herbage. J. Sci. Food Agric. 1977, 28, 639–642. [Google Scholar] [CrossRef]
  22. Franco, M.; Stefański, T.; Jalava, T.; Lehto, M.; Kahala, M.; Järvenpää, E.; Mäntysaari, P.; Rinne, M. Effect of potato by-product on production responses of dairy cows and total mixed ration stability. Dairy 2021, 2, 218–230. [Google Scholar] [CrossRef]
  23. Jia, Z.; Zhou, J.; Yang, M.; Wang, M.; Li, L.; Fan, X. Preparation and evaluation of certified reference materials for crude protein, crude fat, and crude ash in feed. Microchem. J. 2023, 191, 108854. [Google Scholar] [CrossRef]
  24. Prinz, A.; Hönig, J.; Schüttmann, I.; Zorn, H.; Zeiner, T. Separation and Purification of Laccases from Two Different Fungi Using Aqueous Two-Phase Extraction. Process Biochem. 2014, 49, 335–346. [Google Scholar] [CrossRef]
  25. Miller, G.L. Use of Dinitrosalicylic Acid Reagent for Determination of Reducing Sugar. Anal. Chem. 1959, 31, 426–428. [Google Scholar] [CrossRef]
  26. Bajaj, P.; Mahajan, R. Cellulase and Xylanase Synergism in Industrial Biotechnology. Appl. Microbiol. Biotechnol. 2019, 103, 8711–8724. [Google Scholar] [CrossRef]
  27. Huang, L.; Sun, N.; Ban, L.; Wang, Y.; Yang, H. Ability of Different Edible Fungi to Degrade Crop Straw. AMB Express 2019, 9, 4. [Google Scholar] [CrossRef]
  28. Reis, F.S.; Barros, L.; Martins, A.; Ferreira, I.C.F.R. Chemical Composition and Nutritional Value of the Most Widely Appreciated Cultivated Mushrooms: An Inter-Species Comparative Study. Food Chem. Toxicol. 2012, 50, 191–197. [Google Scholar] [CrossRef]
  29. Buswell, J.A.; Cai, Y.J.; Chang, S.T.; Peberdy, J.F.; Fu, S.Y.; Yu, H.-S. Lignocellulolytic Enzyme Profiles of Edible Mushroom Fungi. World J. Microbiol. Biotechnol. 1996, 12, 537–542. [Google Scholar] [CrossRef]
  30. Mears, L.; Stocks, S.M.; Sin, G.; Gernaey, K.V. A Review of Control Strategies for Manipulating the Feed Rate in Fed-Batch Fermentation Processes. J. Biotechnol. 2017, 245, 34–46. [Google Scholar] [CrossRef]
  31. Zhang, G.; Yan, P.; Leng, D.; Shang, L.; Zhang, C.; Wu, Z.; Wang, Z. Functional Roles of LaeA-Like Genes in Fungal Growth, Cellulase Activity, and Secondary Metabolism in Pleurotus ostreatus. J. Fungi 2022, 8, 902. [Google Scholar] [CrossRef]
  32. Hazelgrove, L.; Moody, S.C. Successful Cultivation of Edible Fungi on Textile Waste Offers a New Avenue for Bioremediation and Potential Food Production. Sci. Rep. 2024, 14, 11510. [Google Scholar] [CrossRef] [PubMed]
  33. Li, X.; Chen, G.; Ezemaduka, A.N.; Luo, N.; Yu, H.; Wang, M. The Yields and Quality of Golden Oyster Mushroom Cultivated on Common Reed Substrates. J. Food Compos. Anal. 2023, 121, 105331. [Google Scholar] [CrossRef]
  34. Lin, H.; Li, P.; Ma, L.; Lai, S.; Sun, S.; Hu, K.; Zhang, L. Analysis and Modification of Central Carbon Metabolism in Hypsizygus marmoreus for Improving Mycelial Growth Performance and Fruiting Body Yield. Front. Microbiol. 2023, 14, 1233512. [Google Scholar] [CrossRef]
  35. Chen, S.; Ma, D.; Ge, W.; Buswell, J.A. Induction of Laccase Activity in the Edible Straw Mushroom, Volvariella volvacea. FEMS Microbiol. Lett. 2003, 218, 143–148. [Google Scholar] [CrossRef]
  36. Bao, X.; Feng, H.; Guo, G.; Huo, W.; Li, Q.; Xu, Q.; Liu, Q.; Wang, C.; Chen, L. Effects of Laccase and Lactic Acid Bacteria on the Fermentation Quality, Nutrient Composition, Enzymatic Hydrolysis, and Bacterial Community of Alfalfa Silage. Front. Microbiol. 2022, 13, 1035942. [Google Scholar] [CrossRef] [PubMed]
  37. Kumla, J.; Suwannarach, N.; Sujarit, K.; Penkhrue, W.; Kakumyan, P.; Jatuwong, K.; Vadthanarat, S.; Lumyong, S. Cultivation of Mushrooms and Their Lignocellulolytic Enzyme Production through the Utilization of Agro-Industrial Waste. Molecules 2020, 25, 2811. [Google Scholar] [CrossRef] [PubMed]
  38. Xing, Z.; Cheng, J.; Tan, Q.; Pan, Y. Effect of Nutritional Parameters on Laccase Production by the Culinary and Medicinal Mushroom, Grifola frondosa. World J. Microbiol. Biotechnol. 2006, 22, 799–806. [Google Scholar] [CrossRef]
  39. Qin, P.; Li, T.; Liu, C.; Liang, Y.; Sun, H.; Chai, Y.; Yang, T.; Gong, X.; Wu, Z. Extraction and Utilization of Active Substances from Edible Fungi Substrate and Residue: A Review. Food Chem. 2023, 398, 133872. [Google Scholar] [CrossRef]
  40. Strong, P.J.; Self, R.; Allikian, K.; Szewczyk, E.; Speight, R.; O’hara, I.; Harrison, M.D. Filamentous Fungi for Future Functional Food and Feed. Curr. Opin. Biotechnol. 2022, 76, 102729. [Google Scholar] [CrossRef]
  41. Corrêa, R.C.G.; da Silva, B.P.; Castoldi, R.; Kato, C.G.; de Sá-Nakanishi, A.B.; Peralta, R.A.; de Souza, C.G.M.; Bracht, A. Spent Mushroom Substrate of Pleurotus pulmonarius: A Source of Easily Hydrolyzable Lignocellulose. Folia Microbiol. 2016, 61, 439–448. [Google Scholar] [CrossRef]
  42. Gonani, Z.; Riahi, H.; Sharifi, K. Impact of Using Leached Spent Mushroom Compost as a Partial Growing Media for Horticultural Plants. J. Plant Nutr. 2011, 34, 337–344. [Google Scholar] [CrossRef]
  43. Wood, P.L. Metabolic and Lipid Biomarkers for Pathogenic Algae, Fungi, Cyanobacteria, Mycobacteria, Gram-Positive Bacteria, and Gram-Negative Bacteria. Metabolites 2024, 14, 378. [Google Scholar] [CrossRef]
  44. Patil, A.; Sharma, Y.; Khandelwal, V.; Rajamohan, N.; Arya, M. Biochemical, Molecular Characteristics, and Bioremediation Properties of Mn2+-Resistant Thermophilic Bacillus Strains. Waste Biomass Valorization 2024, 16, 175–190. [Google Scholar] [CrossRef]
  45. Lu, M.L.; Yuan, G.H.; Rehemujiang, H.; Li, C.-C.; Hu, L.-H.; Duan, P.-P.; Zhang, L.-D.; Diao, Q.-Y.; Deng, K.-D.; Xu, G.-S. Effects of Spent Substrate of Oyster Mushroom (Pleurotus ostreatus) on Ruminal Fermentation, Microbial Community and Growth Performance in Hu Sheep. Front. Microbiol. 2024, 15, 1425218. [Google Scholar] [CrossRef]
  46. Celi, P.; Cowieson, A.; Fru-Nji, F.; Steinert, R.; Kluenter, A.-M.; Verlhac, V. Gastrointestinal Functionality in Animal Nutrition and Health: New Opportunities for Sustainable Animal Production. Anim. Feed Sci. Technol. 2017, 234, 88–100. [Google Scholar] [CrossRef]
  47. Chu, Z.; Hu, Z.; Luo, Y.; Zhou, Y.; Yang, F.; Luo, F. Targeting Gut-Liver Axis by Dietary Lignans Ameliorate Obesity: Evidences and Mechanisms. Crit. Rev. Food Sci. Nutr. 2023, 65, 243–264. [Google Scholar] [CrossRef]
  48. Jiménez, M.; González, A.; Martínez, M.; Martínez, A.; Dale, B. Screening of Yeasts Isolated from Decayed Wood for Lignocellulose-Degrading Enzyme Activities. Mycol. Res. 1991, 95, 1299–1302. [Google Scholar] [CrossRef]
  49. Makusheva, Y.; Goncharova, E.; Bets, V.; Korel, A.; Arzhanova, E.; Litvinova, E. Restoration of Lactobacillus johnsonii and Enterococcus faecalis Caused the Elimination of Tritrichomonas sp. in a Model of Antibiotic-Induced Dysbiosis. Int. J. Mol. Sci. 2024, 25, 5090. [Google Scholar] [CrossRef]
  50. Dubos, R.J. Studies on a Bactericidal Agent Extracted from a Soil Bacillus: I. Preparation of the Agent. Its Activity In Vitro. J. Exp. Med. 1939, 70, 1. [Google Scholar] [CrossRef]
  51. Cheng, J.; Hu, J.; Geng, F.; Nie, S. Bacteroides Utilization for Dietary Polysaccharides and Their Beneficial Effects on Gut Health. Food Sci. Hum. Wellness 2022, 11, 1101–1110. [Google Scholar] [CrossRef]
  52. Bailén, M.; Díaz-Castellanos, I.; Azami-Conesa, I.; Fernández, S.A.; Martínez-Díaz, R.A.; Navarro-Rocha, J.; Gómez-Muñoz, M.T.; González-Coloma, A. Anti-Trichomonas gallinae Activity of Essential Oils and Main Compounds from Lamiaceae and Asteraceae Plants. Front. Vet. Sci. 2022, 9, 981763. [Google Scholar] [CrossRef] [PubMed]
Agronomy 15 01171 g001
Figure 1. Changes in the biological growth characteristics of Pleurotus ostreatus under different corn straw treatments and the effects of various fermentation durations. (a) shows the changes in mushroom fruiting bodies with different fermentation days under various corn straw treatment feeds; (b) shows the variation in fresh mushroom yield of Pleurotus ostreatus under different fermentation days and treatments; (c) shows the changes in stipe length under different fermentation days and treatments; (d) shows the variation in the number of mushroom caps under different fermentation days and treatments; (e) shows the changes in average fruiting body mass under different fermentation days and treatments; (f) shows the changes in cap diameter under different fermentation days and treatments. Significant differences (p < 0.05) between different fermentation days at the same substrate ratio are indicated by uppercase letters; significant differences (p < 0.05) between different substrate ratios at the same fermentation day are indicated by lowercase letters. M70%, M75%, M80%, and M85% represent treatments with corn straw ratios of 70%, 75%, 80%, and 85%, respectively. The numbers 25, 34, and 40 correspond to fermentation durations of 25, 34, and 40 days, respectively.
Figure 1. Changes in the biological growth characteristics of Pleurotus ostreatus under different corn straw treatments and the effects of various fermentation durations. (a) shows the changes in mushroom fruiting bodies with different fermentation days under various corn straw treatment feeds; (b) shows the variation in fresh mushroom yield of Pleurotus ostreatus under different fermentation days and treatments; (c) shows the changes in stipe length under different fermentation days and treatments; (d) shows the variation in the number of mushroom caps under different fermentation days and treatments; (e) shows the changes in average fruiting body mass under different fermentation days and treatments; (f) shows the changes in cap diameter under different fermentation days and treatments. Significant differences (p < 0.05) between different fermentation days at the same substrate ratio are indicated by uppercase letters; significant differences (p < 0.05) between different substrate ratios at the same fermentation day are indicated by lowercase letters. M70%, M75%, M80%, and M85% represent treatments with corn straw ratios of 70%, 75%, 80%, and 85%, respectively. The numbers 25, 34, and 40 correspond to fermentation durations of 25, 34, and 40 days, respectively.
Agronomy 15 01171 g001
Agronomy 15 01171 g002
Figure 2. Changes in sensory characteristics of Pleurotus ostreatus and sensory indices under different maize stover treatments across various fermentation days. (a,b) shows the changes in feed raw materials and feed quality of Pleurotus ostreatus after 40 days of fermentation under different corn straw treatments. (c) presents changes in crude protein content of the feed at different fermentation days under various corn straw treatments; (d) shows the changes in acid detergent fiber content of the feed at different fermentation days and treatments; (e) shows the changes in neutral detergent fiber content of the feed at different fermentation days and treatments; (f) shows the variation in crude fat content of the feed at different fermentation days and treatments; (g) presents changes in relative feeding quality of the feed at different fermentation days and treatments; (h) shows the changes in relative feeding value of the feed at different fermentation days and treatments; (i) presents the changes in crude ash content of the feed at different fermentation days and treatments. Significant differences (p < 0.05) between different fermentation days with the same substrate proportion are indicated by uppercase letters; significant differences (p < 0.05) between different substrate proportions on the same fermentation day are indicated by lowercase letters. M70%, M75%, M80%, and M85% represent treatments with corn straw proportions of 70%, 75%, 80%, and 85%, respectively. The numbers 25, 34, and 40 correspond to fermentation durations of 25, 34, and 40 days, respectively.
Figure 2. Changes in sensory characteristics of Pleurotus ostreatus and sensory indices under different maize stover treatments across various fermentation days. (a,b) shows the changes in feed raw materials and feed quality of Pleurotus ostreatus after 40 days of fermentation under different corn straw treatments. (c) presents changes in crude protein content of the feed at different fermentation days under various corn straw treatments; (d) shows the changes in acid detergent fiber content of the feed at different fermentation days and treatments; (e) shows the changes in neutral detergent fiber content of the feed at different fermentation days and treatments; (f) shows the variation in crude fat content of the feed at different fermentation days and treatments; (g) presents changes in relative feeding quality of the feed at different fermentation days and treatments; (h) shows the changes in relative feeding value of the feed at different fermentation days and treatments; (i) presents the changes in crude ash content of the feed at different fermentation days and treatments. Significant differences (p < 0.05) between different fermentation days with the same substrate proportion are indicated by uppercase letters; significant differences (p < 0.05) between different substrate proportions on the same fermentation day are indicated by lowercase letters. M70%, M75%, M80%, and M85% represent treatments with corn straw proportions of 70%, 75%, 80%, and 85%, respectively. The numbers 25, 34, and 40 correspond to fermentation durations of 25, 34, and 40 days, respectively.
Agronomy 15 01171 g002
Agronomy 15 01171 g003
Figure 3. This figure is a “raincloud plot,” which integrates a kernel density plot, a box plot, and a jittered scatter plot. The upper cloud-shaped area represents the kernel density plot. This is generated by placing a kernel function (typically a Gaussian kernel function) around each data point and then overlaying all the kernel functions to create a smooth curve. This curve represents the probability density distribution of the data, not the values themselves. Kernel density plots are a non-parametric statistical method used to estimate the probability density function of the data. By placing a kernel function around each data point and summing all the kernel functions, an estimated probability density curve is obtained. In addition, the central box plot shows the data’s median, upper and lower quartiles, and outliers, providing insight into the central tendency, dispersion, and presence of outliers. (a) shows the variation in xylanase activity in feed under different corn stover treatments and fermentation days; (b) shows the variation in laccase activity in feed under different corn stover treatments and fermentation days; (c) shows the variation in cellulase activity in feed under different corn stover treatments and fermentation days; (d) presents principal component analysis (PCA) of feed nutritional value and enzyme activities under different treatments. Significance levels are indicated as follows: * p < 0.05; ** p < 0.01; and ns indicates non-significant differences. Abbreviations: M70%, M75%, M80%, and M85% represent treatments with corn stover proportions of 70%, 75%, 80%, and 85%, respectively. The numbers 25, 34, and 40 correspond to fermentation days 25, 34, and 40, respectively.
Figure 3. This figure is a “raincloud plot,” which integrates a kernel density plot, a box plot, and a jittered scatter plot. The upper cloud-shaped area represents the kernel density plot. This is generated by placing a kernel function (typically a Gaussian kernel function) around each data point and then overlaying all the kernel functions to create a smooth curve. This curve represents the probability density distribution of the data, not the values themselves. Kernel density plots are a non-parametric statistical method used to estimate the probability density function of the data. By placing a kernel function around each data point and summing all the kernel functions, an estimated probability density curve is obtained. In addition, the central box plot shows the data’s median, upper and lower quartiles, and outliers, providing insight into the central tendency, dispersion, and presence of outliers. (a) shows the variation in xylanase activity in feed under different corn stover treatments and fermentation days; (b) shows the variation in laccase activity in feed under different corn stover treatments and fermentation days; (c) shows the variation in cellulase activity in feed under different corn stover treatments and fermentation days; (d) presents principal component analysis (PCA) of feed nutritional value and enzyme activities under different treatments. Significance levels are indicated as follows: * p < 0.05; ** p < 0.01; and ns indicates non-significant differences. Abbreviations: M70%, M75%, M80%, and M85% represent treatments with corn stover proportions of 70%, 75%, 80%, and 85%, respectively. The numbers 25, 34, and 40 correspond to fermentation days 25, 34, and 40, respectively.
Agronomy 15 01171 g003
Agronomy 15 01171 g004
Figure 4. (a) presents the NMDS analysis of the relationship between feed nutritional quality and enzyme activity in feeds treated with 80% fermented feed at 0, 25, 34, 40, and 50 days. (b) shows the correlation changes between enzyme activity and nutritional quality in feeds treated with M80%. Significance levels are indicated as follows: * for p < 0.05, ** for p < 0.01, *** for p < 0.001, **** for p < 0.0001. Abbreviations: CP for crude protein content; EE for crude fat content; Ash for crude ash content; RFQ for relative feed quality; RFV for relative feed value; ADF for acid detergent fiber content; NDF for neutral detergent fiber content.
Figure 4. (a) presents the NMDS analysis of the relationship between feed nutritional quality and enzyme activity in feeds treated with 80% fermented feed at 0, 25, 34, 40, and 50 days. (b) shows the correlation changes between enzyme activity and nutritional quality in feeds treated with M80%. Significance levels are indicated as follows: * for p < 0.05, ** for p < 0.01, *** for p < 0.001, **** for p < 0.0001. Abbreviations: CP for crude protein content; EE for crude fat content; Ash for crude ash content; RFQ for relative feed quality; RFV for relative feed value; ADF for acid detergent fiber content; NDF for neutral detergent fiber content.
Agronomy 15 01171 g004
Agronomy 15 01171 g005
Figure 5. (a) uses Mantel analysis to show the correlations among feed nutritional quality, enzyme activities, and fungal and bacterial species diversity after 40 days of fermentation with the M80% treatment. (b) visualizes the composition and changes in bacterial and fungal species and their richness after 40 days of fermentation with M80% treatment using a Sankey diagram. On the left side, the diagram shows the genus-level composition and richness of bacteria and fungi, while the right side displays species-level composition and richness differences in bacteria and fungi. In (a), * indicates a significant difference (p < 0.05); ** indicates a highly significant difference (p < 0.01); *** indicates an extremely significant difference (p < 0.001); ns indicates no significant difference. Abbreviations: CP, crude protein content; EE, ether extract (crude fat) content; Ash, crude ash content; RFQ, relative feed quality; RFV, relative feed value; ADF, acid detergent fiber content; NDF, neutral detergent fiber content.
Figure 5. (a) uses Mantel analysis to show the correlations among feed nutritional quality, enzyme activities, and fungal and bacterial species diversity after 40 days of fermentation with the M80% treatment. (b) visualizes the composition and changes in bacterial and fungal species and their richness after 40 days of fermentation with M80% treatment using a Sankey diagram. On the left side, the diagram shows the genus-level composition and richness of bacteria and fungi, while the right side displays species-level composition and richness differences in bacteria and fungi. In (a), * indicates a significant difference (p < 0.05); ** indicates a highly significant difference (p < 0.01); *** indicates an extremely significant difference (p < 0.001); ns indicates no significant difference. Abbreviations: CP, crude protein content; EE, ether extract (crude fat) content; Ash, crude ash content; RFQ, relative feed quality; RFV, relative feed value; ADF, acid detergent fiber content; NDF, neutral detergent fiber content.
Agronomy 15 01171 g005
Agronomy 15 01171 g006
Figure 6. The predicted pathway abundance of metabolic pathways in microbial functional prediction. The analysis was conducted based on the core of the KEGG database, the KEGG Pathway Database (http://www.genome.jp/kegg/pathway.html) Accessed on 15 October 2024. Pathway/group abundance was normalized and analyzed using R4.4.1 software to obtain the average abundance. (a) represents the predicted pathway abundance of fungal metabolic pathways as well as changes in protein function; (b) represents the predicted pathway abundance of bacterial metabolic pathways as well as changes in protein function.
Figure 6. The predicted pathway abundance of metabolic pathways in microbial functional prediction. The analysis was conducted based on the core of the KEGG database, the KEGG Pathway Database (http://www.genome.jp/kegg/pathway.html) Accessed on 15 October 2024. Pathway/group abundance was normalized and analyzed using R4.4.1 software to obtain the average abundance. (a) represents the predicted pathway abundance of fungal metabolic pathways as well as changes in protein function; (b) represents the predicted pathway abundance of bacterial metabolic pathways as well as changes in protein function.
Agronomy 15 01171 g006
Table 1. The ingredient proportions for oyster mushroom fermentation substrate.
Table 1. The ingredient proportions for oyster mushroom fermentation substrate.
Charge Mixture%Maize Straw Wheat Bran SeedcakeLimeGyp
M70%7022521
M75%7517521
M80%8012521
M85%857521
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, H.; Lin, G.; Wang, S.; Wu, T.; Dan, Z.; Yang, J.; Lv, M.; Zhao, Y. Integrating Agricultural Waste Recycling with Sustainable Feed Production: Microbial and Enzymatic Dynamics During Pleurotus Cultivation on Maize Straw. Agronomy 2025, 15, 1171. https://doi.org/10.3390/agronomy15051171

AMA Style

Yang H, Lin G, Wang S, Wu T, Dan Z, Yang J, Lv M, Zhao Y. Integrating Agricultural Waste Recycling with Sustainable Feed Production: Microbial and Enzymatic Dynamics During Pleurotus Cultivation on Maize Straw. Agronomy. 2025; 15(5):1171. https://doi.org/10.3390/agronomy15051171

Chicago/Turabian Style

Yang, Hang, Gang Lin, Shitao Wang, Tao Wu, Zhiwangjia Dan, Junjuan Yang, Min Lv, and Yajiao Zhao. 2025. "Integrating Agricultural Waste Recycling with Sustainable Feed Production: Microbial and Enzymatic Dynamics During Pleurotus Cultivation on Maize Straw" Agronomy 15, no. 5: 1171. https://doi.org/10.3390/agronomy15051171

APA Style

Yang, H., Lin, G., Wang, S., Wu, T., Dan, Z., Yang, J., Lv, M., & Zhao, Y. (2025). Integrating Agricultural Waste Recycling with Sustainable Feed Production: Microbial and Enzymatic Dynamics During Pleurotus Cultivation on Maize Straw. Agronomy, 15(5), 1171. https://doi.org/10.3390/agronomy15051171

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop