Evaluation of Strawberry Colletotrichum spp. Genetic Diversity in Lithuania
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Samples
2.2. Preparation of Samples
2.3. Identification of Samples
2.4. Microsatellite Analysis
3. Results
3.1. The Morphological Characteristics
3.2. Molecular Identification of Colletotrichum spp. and Distribution on Strawberry Parts
3.3. Colletotrichum spp. Microsatellite Analysis
3.4. Genetic Diversity of Colletotrichum spp. Isolates
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
| SSR | simple sequence repeat |
| PIC | polymorphism information content |
| PCR | polymerase chain reaction |
| DNA | deoxyribonucleic acid |
| RAPD | random amplified polymorphic DNA |
| RFLP | restricted-fragment-length polymorphism |
| AFLP | amplified-fragment-length polymorphism |
| LD | linear dichroism |
Appendix A
| Origin | Year | Host Plant | Isolate Number |
|---|---|---|---|
| Kaunas district, Babtai | 2018 | Strawberry | 13 |
| 2019 | 10 | ||
| 2020 | 3 | ||
| Panevezys district, Sodeliskiai village | 2018 | 4 | |
| 2019 | 3 | ||
| Panevezys district, Krekenava, | 2018 | 2 | |
| 2019 | 2 | ||
| Kaunas district, Labunava, | 2018 | 1 | |
| 2019 | 4 | ||
| Siauliai district, Bridai | 2018 | 1 | |
| 2019 | 4 | ||
| Siauliai district, Maniusiai village | 2018 | 3 | |
| 2019 | 2 | ||
| Radviliskis district, Velziai village | 2018 | 1 | |
| Prienai district, Klebiskis village | 2018 | 1 | |
| 2019 | 3 | ||
| Klaipeda district, Priekule | 2018 | 1 | |
| Kaunas district, Laumenai | 2020 | Sour Cherry | 2 |
| Kaunas district, Babtai | 2020 | Sour Cherry | 3 |
| Kaunas district, Vaisvydava | 2018 | Apple | 2 |
| Kaunas | 2020 | Apricots | 1 |
| 2020 | Peaches | 1 | |
| Kaunas district, Babtai | 2019 | Common barnyard | 1 |
| 2019 | Wild viola | 1 | |
| Total | 69 |
| Isolate | Primer Pair | Colletotrichum spp. | ||||||
|---|---|---|---|---|---|---|---|---|
| Ca13 | Ca16 | Ca26 | CG20 | CG22 | CG27 | CG30 | ||
| 18-Kau-Fur25 | 114:117 | 111:114 | 224:230 | 239:241 | 167:173 | 143:147 | C. fragariae | |
| 18-Kau-Mal48 | 114:117 | 223:229 | 143:147 | 153:154 | ||||
| 18-Pan-Mal36 | 114:117 | 223:229 | 179:184 | 143:147 | ||||
| 18-Pan-Sal40 | 114:117 | 224:230 | 187:189 | 150:156 | ||||
| 18-siau-Son50 | 114:117 | 223:229 | 187:189 | |||||
| 19-Kau-Mal17 | 114:117 | 224:230 | 143:147 | 154:156 | ||||
| 19-siau-Fla34 | 114:117 | 223:229 | 187:189 | 153:154 | ||||
| 20-Kau-60 | 114:117 | 98:100 | 223:230 | 161:163 | 154:156 | |||
| 20-Kau-61 | 114:117 | 223:229 | 161:163 | 154:156 | ||||
| 18-Rad-Rum2 | 114:117 | 224:230 | 187:189 | 154:156 | ||||
| 18-Kau_Fur4 | 114:117 | 111:1114 | 227:232 | 241:243 | 167:173 | 144:148 | 158:159 | C. acutatum |
| 18-Kau-15 | 114:117 | 111:1114 | 224:230 | 241:243 | 167:173 | 143:147 | 158:159 | |
| 18-Kau-22 | 114:117 | 98:100 | 224:230 | 241:243 | 161:163 | 143:147 | 149:150 | |
| 18-Kau-29 | 114:117 | 111:1114 | 224:230 | 237:239 | 167:173 | 143:147 | 158:159 | |
| 18-Kau-Fur18 | 114:117 | 111:1114 | 224:230 | 241:243 | 167:173 | 143:147 | 158:159 | |
| 18-Kau-Fur19 | 114:117 | 111:1114 | 224:230 | 238:240 | 167:173 | 158:159 | ||
| 18-Kau-Fur20 | 114:117 | 111:116 | 224:230 | 239:241 | 167:173 | 143:147 | 158:159 | |
| 18-Kau-Fur-8 | 98:100 | 227:232 | 241:243 | 161:163 | 144:148 | 149:150 | ||
| 18-Kau-Fur9 | 115:118 | 111:1114 | 224:230 | 241:243 | 167:173 | 144:148 | 158:159 | |
| 19-Kau-Dar55 | 114:117 | 111:1114 | 223:229 | 238:240 | 167:173 | 143:147 | 158:159 | |
| 19-Kau-Dar58 | 114:117 | 111:1114 | 224:231 | 238:240 | 167:173 | 142:146 | 158:159 | |
| 20-Kau-Del59 | 114:117 | 111:1114 | 224:230 | 238:240 | 167:173 | 142:146 | 158:159 | |
| 18-Kau-Fur23 | 114:117 | 111:1114 | 224:230 | 239:241 | 167:173 | 143:147 | 158:159 | C. gloeosporioides |
| 18-Kau-Obu30 | 114:117 | 98:100 | 224:230 | 239:241 | 191:193 | 143:147 | 149:150 | |
| 18-Kla-Dar47 | 114:117 | 223:229 | 239:241 | 179:184 | 143:147 | |||
| 18-Pan-Sal38 | 114:117 | 224:230 | 153:154 | |||||
| 18-siau-Flo44 | 114:117 | 236:237 | 187:189 | 159:159 | ||||
| 18-siau-Son43 | 114:117 | 223:229 | 237:239 | |||||
| 19-Kau-Nas | 114:117 | 224:230 | 156:158 | |||||
| 19-Kau-Riet | 114:117 | 223:229 | 241:243 | 142:146 | 153:154 | |||
| 19-siau-Son32 | 114:117 | 239:241 | 153:154 | |||||
| 20-Kau-Vys63 | 114:117 | 229:231 | ||||||
| 20-Kau-Vys64 | 114:117 | 229:231 | 154:156 | |||||
References
- Cannon, P.F.; Damm, U.; Johnston, P.R.; Weir, B.S. Colletotrichum—Current status and future directions. Stud. Mycol. 2012, 73, 181–213. [Google Scholar] [CrossRef] [PubMed]
- Udayanga, D.; Manamgoda, D.S.; Liu, X.; Chukeatirote, E.; Hyde, K.D. What are the common anthracnose pathogens of tropical fruits? Fungal Divers. 2013, 61, 165–179. [Google Scholar] [CrossRef]
- Morkeliūnė, A.; Rasiukevičiūtė, N.; Valiuškaitė, A. Pathogenicity of Colletotrichum acutatum to different strawberry cultivars and anthracnose control with essential oils. Zemdirb.-Agric. 2021, 108, 173–180. [Google Scholar] [CrossRef]
- Dean, R.; van Kan, J.A.L.; Pretorius, Z.A.; Hammond-Kosack, K.E.; di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef]
- Lin, T.; Xu, X.F.; Dai, D.J.; Shi, H.J.; Wang, H.D.; Zhang, C.Q. Differentiation in development of benzimidazole resistance in Colletotrichum gloeosporioides complex populations from strawberry and grape hosts. Australas. Plant Pathol. 2016, 45, 241–249. [Google Scholar] [CrossRef]
- Jayawardena, R.S.; Huang, J.K.; Jin, B.C.; Yan, J.Y.; Li, X.H.; Hyde, K.D.; Bahkali, A.H.; Yin, S.L.; Zhang, G.Z. An account of Colletotrichum species associated with strawberry anthracnose in China based on morphology and molecular data. Mycosphere 2016, 7, 1147–1163. [Google Scholar] [CrossRef]
- Garrett, K.A.; Nita, M.; Wolf, E.D.; Esker, P.D.; Gomez-Montano, L.; Sparks, A.H. Chapter 21—Plant pathogens as indicators of climate change. In Climate Change: Observed Impacts on Planet Earth, 2nd ed.; Elsevier: Amsterdam, The Netherlands, 2016; pp. 325–338. [Google Scholar]
- Freeman, S.; Horowitz, S.; Sharon, A. Pathogenic and nonpathogenic lifestyle in Colletotrichum acutatum from strawberry and other plants. Phytopathology 2001, 91, 986–992. [Google Scholar] [CrossRef]
- Avila-Quezada, G.D.; Esquivel, J.F.; Silva-Rojas, H.V.; Leyva-Mir, S.G.; de Garcia-Avila, C.J.; Noriega-Orozco, L.; Rivas-Valencia, P.; Ojeda-Barrios, D.; Melgoza-Castillo, A. Emerging plant diseases under a changing climate scenario: Threats to our global food supply. EJFA 2018, 30, 443–450. [Google Scholar]
- Ciampi, M.B.; Baldauf, C.; Vigna, B.B.Z.; Souza, A.P.; Spósito, M.B.; Amorim, L. Isolation and characterization of microsatellite loci in Colletotrichum acutatum, the causal agent of postbloom fruit drop on citrus. Conserv. Genet. Resour. 2011, 3, 651–654. [Google Scholar] [CrossRef]
- Dowling, M.; Peres, N.; Villani, S.; Schnabel, G. Managing Colletotrichum on Fruit Crops: A “Complex” Challenge. Plant Dis. 2020, 104, 2301–2316. [Google Scholar] [CrossRef]
- Vieira, W.A.S.; Bezerra, P.A.; da Silva, A.C.; Silva Veloso, J.; Paz Saraiva Câmara, M.; Doyle, P.V. Optimal markers for the identification of Colletotrichum species. Mol. Phylogenet Evol. 2020, 143, 106694. [Google Scholar] [CrossRef] [PubMed]
- Xie, L.; Zhang, J.; Wan, Y.; Hu, D. Identification of Colletotrichum spp. isolated from strawberry in Zhejiang Province and Shanghai City, China. J. Zhejiang Univ. Sci. B 2010, 11, 61–70. [Google Scholar] [CrossRef] [PubMed]
- Maciel, D.B.; de Medeiros, L.V.; de Medeiros, V.V.; Leão, M.P.C.; Camargo, L.E.A.; de Oliveira, N.T. Amplification of the cap20 pathogenicity gene and genetic characterization using different markers molecular in Colletotrichum gloeosporioides isolates. Braz. Arch. Biol. Technol. 2010, 53, 1255–1265. [Google Scholar] [CrossRef]
- Cao, Z.; Cao, C.; Hu, J.; Shu, Q.; Finkeldey, R. Aflp analysis of resistance to Colletotrichum gloeosporioides in Camellia oleifera (Theaceae). Pak. J. Bot. 2019, 51, 2269–2273. [Google Scholar] [CrossRef] [PubMed]
- Moges, A.D.; Admassu, B.; Belew, D.; Yesuf, M.; Njuguna, J.; Kyalo, M.; Ghimire, S.R. Development of Microsatellite Markers and Analysis of Genetic Diversity and Population Structure of Colletotrichum gloeosporioides from Ethiopia. PLoS ONE 2016, 11, e0151257. [Google Scholar] [CrossRef]
- Sliesaravičius, A.; Stanys, V. Žemės augalų biotechnologija, Enciklopedija; Agriculture Academy: Vilnius, Lithuania, 2005; p. 234. [Google Scholar]
- Sasnauskas, K. Genų Inžinerijos Pagrindai; Biotechnologijos Institutas: Vilnius, Lithuania, 2006; 238p. [Google Scholar]
- Powell, W.; Machray, G.; Provan, J. Polymorphism revealed by simple sequence repeats. Trends Plant Sci. 1996, 1, 222. [Google Scholar] [CrossRef]
- Bhat, N.N.; Mahiya-Farooq; Padder, B.A.; Shah, M.D.; Dar, M.S.; Nabi, A.; Bano, A.; Rasool, R.S.; Surma, S. Microsatellite mining in the genus Colletotrichum. Gene Rep. 2018, 13, 84–93. [Google Scholar] [CrossRef]
- Chung, P.C.; Hu, H.P.; Hung, T.H.; Ariyawansa, H.A.; Wu, H.Y.; Tzean, S.S.; Chung, C.L.; Wang, Y.W. Diversity and pathogenicity of Colletotrichum species causing strawberry anthracnose in Taiwan and description of a new species, Colletotrichum miaoliense sp. nov. Sci. Rep. 2020, 10, 14664. [Google Scholar] [CrossRef]
- Baroncelli, R.; Zapparata, A.; Thon, M.R.; Vannacci, G.; Sarrocco, S.; Holub, E.; Sukno, S.A.; Lane, C.R.; Sreenivasaprasad, S. Molecular Diversity of Anthracnose Pathogen Populations Associated with UK Strawberry Production Suggests Multiple Introductions of Three Different Colletotrichum Species. PLoS ONE 2015, 10, e0129140. [Google Scholar] [CrossRef]
- Wang, N.-Y.; Forcelini, B.B.; Peres, N.A. Anthracnose Fruit and Root Necrosis of Strawberry Are Caused by a Dominant Species Within the Colletotrichum acutatum Species Complex in the United States. Phytopathology® 2019, 109, 1293–1301. [Google Scholar] [CrossRef]
- Zhang, L.; Gao, Q.; Duan, K.; Song, L.; Zou, X.; Xu, X. Characterization and Fungicide Sensitivity of Colletotrichum Species Causing Strawberry Anthracnose in Eastern China. Plant Dis. 2020, 104, 1960–1968. [Google Scholar] [CrossRef] [PubMed]
- Velázquez-Silva, A.; García-Díaz, S.E.; Robles-Yerena, L.; Nava-Díaz, C.; Nieto-Ángel, D. First Report of Colletotrichum spp. in fruits of allspice (Pimenta dioica) in Veracruz, Mexico. Mex. J. Phytopathol. 2018, 36, 342–355. [Google Scholar] [CrossRef]
- Bosshard, E.; van der Scheer, H.A.T.; Lieten, F.; Dijkstra, J. Why is Colletotrichum acutatum a quarantine organism, and C. gloeosporioides and C. fragariae are not? Acta Hortic. 1997, 439, 799–802. [Google Scholar] [CrossRef]
- Alaniz, S.; Hernández, L.; Damasco, D.; Mondino, P. First report of Colletotrichum acutatum and C. fragariae causing bitter rot of apple in Uruguay. Plant Dis. 2012, 96, 458. [Google Scholar] [CrossRef]
- Dias, M.S.C.; Canuto, R.d.S.; Santos, L.O.; Martins, R.N. Diseases of strawberry. (Doenças do morango.). Inf. Agropecu. 2005, 26, 40–43. [Google Scholar]
- Bahri, B.A.; Saadani, M.; Mechichi, G.; Rouissi, W. Genetic diversity of Colletotrichum gloeosporioides species complex associated with Citrus wither-tip of twigs in Tunisia using microsatellite markers. J. Phytopathol. 2019, 167, 351–362. [Google Scholar] [CrossRef]
- Gunnell, P.S.; Gubler, W.D. Taxonomy and morphology of Colletotrichum species pathogenic to strawberry. Mycologia 1992, 84, 157–165. [Google Scholar] [CrossRef]
- Hyde, K.D.; Cai, L.; McKenzie, E.H.C.; Yang, Y.L.; Zhang, J.Z.; Prihastuti, H. Colletotrichum: A catalogue of confusion. Fungal Divers. 2009, 39, 1–17. [Google Scholar]
- Liu, K.; Muse, S.V. Power Marker: Integrated Analysis Environment for Genetic Marker Data. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef]
- Van de Peer, Y.; De Wachter, R. TREECON for Windows: A software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput. Applic. Biosci. 1994, 9, 569–570. [Google Scholar] [CrossRef]
- Nei, M.; Li, W.H. Mathematical model for studying genetic variations in terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA 1979, 76, 5269–5273. [Google Scholar] [CrossRef]
- Debode, J.; Van Hemelrijck, W.; Xu, X.M.; Maes, M.; Creemers, P.; Heungens, K. Latent entry and spread of Colletotrichum acutatum (species complex) in strawberry fields. Plant Pathol. 2015, 64, 385–395. [Google Scholar] [CrossRef]
- Wagner, A.; Hetman, B. Susceptibility of strawberry cultivars to Colletotrichum acutatum J. H. Simmonds. Acta Sci. Pol.-Hortoru 2016, 15, 209–219. [Google Scholar]
- Peres, N.A.; Timmer, L.W.; Adaskaveg, J.E.; Correll, J.C. Lifestyles of Colletotrichum acutatum. Plant Dis. 2005, 89, 784–796. [Google Scholar] [CrossRef]
- Martínez-Culebras, P.V.; Barrio, E.; García, M.; Querol, A. Identification of Colletotrichum species responsible for anthracnose of strawberry based on the internal transcribed spacers of the ribosomal region. FEMS Microbiol. Lett. 2000, 189, 97–101. [Google Scholar] [CrossRef]
- Buddie, A.G.; Martínez-Culebras, P.; Bridge, P.D.; García, M.D.; Querol, A.; Cannon, P.F.; Monte, E. Molecular characterization of Colletotrichum strains derived from strawberry. Mycol. Res. 1999, 103, 385–394. [Google Scholar] [CrossRef]
- Abera, A.; Lemessa, F.; Adunga, G. Morphological characteristics of Colletotrichum species associated with mango (Mangifera indica L.) in Southwest Ethiopia. Food Sci. Qual. Manag. 2016, 46, 106–115. [Google Scholar]
- Dembele, D.D.; Kamara, A.; Grechi, I.; Silué, N.; N’Goran, N.S.; Yéo, Y.S.; Rey, J.-Y.; Koné, D. Morphological characteristics and distribution of Colletotrichum isolates morphotypes infecting mango (Mangifera indica L.) in the north of Côte d’Ivoire. AJFAND 2020, 20, 15837–15856. [Google Scholar] [CrossRef]
- Van Hemelrijck, W.; Debode, J.; Heungens, K.; Maes, M.; Creemers, P. Phenotypic and genetic characterization of Colletotrichum isolates from Belgian strawberry fields. Plant Pathol. 2010, 59, 853–861. [Google Scholar] [CrossRef]
- Marulanda, M.; Lopez, A.; Isaza, L.; Lopez, P. Microsatellite isolation and characterization for Colletotrichum spp, causal agent of anthracnose in Andean blackberry. GMR 2014, 13, 7673–7685. [Google Scholar] [CrossRef]
- Penet, L.; Briand, S.; Petro, D.; Bussière, F.; Guyader, S. Data on microsatellite markers in Colletotrichum gloeosporioides s.l., polymorphism levels and diversity range. Data Br. 2017, 12, 644–648. [Google Scholar] [CrossRef] [PubMed]
- Feres, J.M.; Martinez, M.L.; Martinez, C.A.; Mestriner, M.A.; Alzate-Marin, A.L. Transferability and characterization of nine microsatellite markers for the tropical tree species Tabebuia roseo alba. Mol. Ecol. Resour. 2009, 9, 434–437. [Google Scholar] [CrossRef] [PubMed]




| Species-Specific | Primer | Sequence * | Temperature ** |
|---|---|---|---|
| C. gloeosporioides [16] | CG30-F | FAM *-CGTCATTTTCTGGATTCACT- | 47.9 ** |
| CG30-R | ATCCATTGGGCTGTCCAT | ||
| CG27-F | CY3-CCTGTTGATCCATGATGTAA- | 50 | |
| CG27-R | GAAAGGCTGACTTGTGAACT | ||
| CG20-F | FAM-GTCTCACTCAGTCTCAAGCC- | 45 ** | |
| CG20-R | AACACAGTCTGAGAGGCAAT | ||
| CG22-F | HEX-CTTCGAGTCACCTCTTCAAC- | 51 | |
| CG22-R | CAGAGTGGTAAAGGTGGTGT | ||
| C. acutatum [10] | CA13-F | HEX-GTAAACGAAAAGGCGGTCTG- | 62 |
| CA13-R | CGGAGTATATGCAGCTACCAAC | ||
| CA26-F | CY3-GTGCCAATAACGAGCCATC- | 60 | |
| CA26-R | CGTAAAGGAGGTTTGCCTTC | ||
| CA16-F | HEX-GGGAAGACACTCGGAGAGG- | 57 | |
| CA16-R | CTCCACCTCCTCCAACTCC |
| Primer Pair | Allele Number | Allele Size Range, bp | Ho * | He * | PIC * |
|---|---|---|---|---|---|
| Ca13 | 4 | 114–118 | 1.00 | 0.53 | 0.41 |
| Ca16 | 6 | 98–116 | 1.00 | 0.75 | 0.71 |
| Ca26 | 9 | 222–232 | 1.00 | 0.80 | 0.77 |
| CG20 | 9 | 229–243 | 1.00 | 0.82 | 0.80 |
| CG22 | 11 | 161–193 | 1.00 | 0.85 | 0.83 |
| CG27 | 6 | 142–148 | 1.00 | 0.73 | 0.69 |
| CG30 | 7 | 149–159 | 0.97 | 0.84 | 0.82 |
| Mean | 7.43 | 1.00 | 0.76 | 0.72 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Morkeliūnė, A.; Rasiukevičiūtė, N.; Frercks, B.; Bendokas, V.; Antanynienė, R.; Mažeikienė, I.; Vaštakaitė-Kairienė, V.; Karklelienė, R.; Valiuškaitė, A. Evaluation of Strawberry Colletotrichum spp. Genetic Diversity in Lithuania. Agronomy 2025, 15, 720. https://doi.org/10.3390/agronomy15030720
Morkeliūnė A, Rasiukevičiūtė N, Frercks B, Bendokas V, Antanynienė R, Mažeikienė I, Vaštakaitė-Kairienė V, Karklelienė R, Valiuškaitė A. Evaluation of Strawberry Colletotrichum spp. Genetic Diversity in Lithuania. Agronomy. 2025; 15(3):720. https://doi.org/10.3390/agronomy15030720
Chicago/Turabian StyleMorkeliūnė, Armina, Neringa Rasiukevičiūtė, Birutė Frercks, Vidmantas Bendokas, Raminta Antanynienė, Ingrida Mažeikienė, Viktorija Vaštakaitė-Kairienė, Rasa Karklelienė, and Alma Valiuškaitė. 2025. "Evaluation of Strawberry Colletotrichum spp. Genetic Diversity in Lithuania" Agronomy 15, no. 3: 720. https://doi.org/10.3390/agronomy15030720
APA StyleMorkeliūnė, A., Rasiukevičiūtė, N., Frercks, B., Bendokas, V., Antanynienė, R., Mažeikienė, I., Vaštakaitė-Kairienė, V., Karklelienė, R., & Valiuškaitė, A. (2025). Evaluation of Strawberry Colletotrichum spp. Genetic Diversity in Lithuania. Agronomy, 15(3), 720. https://doi.org/10.3390/agronomy15030720

