Next Article in Journal
A Sustainable Approach for Assessing Wheat Production in Pakistan Using Machine Learning Algorithms
Previous Article in Journal
Soil Bacterial Communities in a Tobacco Field Plantation and Under Different N Fertilizations in Central Yunnan, China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification of the SMXL Gene Family in Common Wheat and Expression Analysis of TaSMXLs Under Abiotic Stress

1
Key Laboratory of Wheat Biology and Genetic Improvement for Low & Middle Yangtze Valley, Ministry of Agriculture and Rural Affairs, Lixiahe Institute of Agricultural Sciences, Yangzhou 225007, China
2
College of Life Science, Jianghan University, Wuhan 430056, China
3
Institute of Crop Germplasm Resources, Shandong Academy of Agricultural Sciences, Jinan 250100, China
*
Authors to whom correspondence should be addressed.
Agronomy 2025, 15(3), 656; https://doi.org/10.3390/agronomy15030656
Submission received: 2 February 2025 / Revised: 28 February 2025 / Accepted: 4 March 2025 / Published: 6 March 2025
(This article belongs to the Section Crop Breeding and Genetics)

Abstract

:
Strigolactones (SLs), a novel class of plant hormones, play a crucial role in plant growth and development. SMXL (SUPPRESSOR OF MAX2 1-like) is a key gene in the SL signaling pathway, regulating its function by inhibiting the reception of SL signals. Therefore, investigating how SMXL regulates SL to influence wheat growth, development, and stress resistance is of significant importance. In this study, 22 SMXL genes were identified in the Chinese Spring wheat reference genome. Bioinformatics analysis revealed that these genes belong to the Group II subfamily, exhibiting similar physicochemical properties and conserved motifs. Ka/Ks analysis indicated that these genes have undergone purifying selection during evolution. Cis-acting element analysis showed that the promoter regions of TaSMXL genes are enriched with light-responsive elements and regulatory elements related to growth, development, and stress responses. Expression pattern analysis demonstrated that TaSMXL genes exhibit significant differential expression under drought, salt, and cold stress conditions, revealing the potential molecular mechanisms of wheat’s response to multiple abiotic stresses. This study provides a theoretical foundation for understanding the functional roles of SMXL genes in wheat and offers valuable candidate gene resources for breeding stress-resistant wheat varieties.

1. Introduction

Plant growth regulators are a class of endogenous organic substances that regulate plant growth and development. They not only play a role in modulating plant growth and development but also have significant importance in plant immune responses [1].
Strigolactones (SLs) are a group of carotenoid-derived plant hormones that regulate various aspects of plant growth and development [2]. As a novel class of plant hormones, SLs play a crucial negative regulatory role in controlling plant branching [3]. SLs have been identified as plant growth regulators [4] and are primarily synthesized in plastids of root cells and transported upward [5]. In the stem, SLs regulate branching, stem elongation, leaf senescence, secondary thickening, and photomorphogenesis, while also being involved in modulating plant branching and promoting the growth of symbiotic fungi [3,6]. In roots, SLs increase the number of cells in the primary root meristem, inhibit the formation of lateral and adventitious roots, and promote root hair elongation [7]. As rhizosphere signaling molecules, SLs are secreted into the soil by roots, facilitating the establishment of symbiosis between arbuscular mycorrhizal fungi and plants [8]. Additionally, parasitic weeds utilize SLs to stimulate seed germination, enabling their parasitism on host plant roots [9].
With the advancement of molecular biology, research on SL signaling has proliferated, and the mechanisms by which SL regulates plant branching growth and development have become increasingly clear, allowing us to more readily comprehend its complex functions. Studies have shown that SL is primarily synthesized in plant roots and transported upward to inhibit the growth and development of plant branches [10,11]. Three protein types are proposed to participate in SL signal transduction: DWARF14 (D14) protein [12], F-box proteins, and SMXL/D53 proteins. Notably, D14, belonging to the α/β-hydrolase fold protein family, has been recognized as a receptor for SLs. Rice d14 mutants showed increased tillering and impaired plant growth [13]. D14 acts as an SL receptor that binds and hydrolyzes SLs [14]. In rice, the D53 gene encodes a Clp ATPase protein that is rapidly degraded upon treatment with 4-rac-GR24, a synthetic SL analog. Recent studies have revealed that D53 protein can form a complex with the F-box protein D3 and D14, thereby inhibiting the SL signaling pathway [15,16]. One of the most representative roles of SLs in plant development is mediated through the classical D14-MAX2-D53 signaling mechanism [3,7,10,15,17,18,19]. SLs rely on the α/β-hydrolase superfamily protein D14, the F-box protein MAX2, and the substrate protein D53/SMXL, which are ubiquitinated and subsequently degraded by the 26S proteasome. This process acts as a repressive mechanism in SL signal transduction [16,20,21]. SLs exert their functions by promoting the increase in cell number within the primary root meristem, inhibiting the formation of lateral roots and adventitious roots, and facilitating root hair elongation [7,17,18]. As the ultimate target proteins in the SL signaling pathway, SMXL/D53 proteins play a negative regulatory role in the reception and response of SL signals and are crucial in the regulation of plant branching [20,21,22].
Previous studies have shown that different SMXL orthologs possess distinct physiological functions [20,22,23,24]. In Arabidopsis thaliana, Arabidopsis MAX2-1 SUPPRESSOR OF MAX2-1 (AtSMAX1) is an ortholog of OsD5 [20,25]. AtSMXL1 and AtSMXL2 primarily regulate root and root hair development in Arabidopsis [23,24,26,27]. Moreover, AtSMXL6, AtSMXL7, and AtSMXL8, members of the SMAX1-LIKE (SMXL) family, are involved in the regulation of shoot branching, leaf morphology, and lateral root development [20,23,25]. Additionally, AtSMXL3, AtSMXL4, and AtSMXL5 are key regulators of phloem cell formation in Arabidopsis [25,27]. Furthermore, recent studies have revealed that AtSMXL6, AtSMXL7, and AtSMXL8 not only act as repressors but also function as transcription factors. They maintain the dynamic balance of AtSMXL6, AtSMXL7, and AtSMXL8 proteins and SL signaling response by negatively regulating their own transcriptional expression [28].
The SMAX1-like (SMXL) genes are homologous to the ClpB heat chaperone protein HSP101, containing dual Clp-N and P-loop motifs, which are characteristic features of the nucleoside triphosphate hydrolase superfamily [15,24]. SMXL genes have been found to perform critical functions in various plants. In Arabidopsis, eight SMXL gene family members have been identified [29], among which AtSMAX1 and AtSMXL2 primarily regulate root and root hair development [27]. AtSMXL3, AtSMXL4, and AtSMXL5 are key regulators of phloem cell formation [16,26], while AtSMXL6, AtSMXL7, and AtSMXL8 are homologous to DWARF53 (OsD53) in rice [15,22], and they regulate shoot branching, leaf morphology, and lateral root development [25,30]. In Zea mays, 11 ZmSMXL members have been identified. It has been shown that ZmSMXL genes exhibit differential regulation under abiotic stress conditions, with the SMXL-I subfamily genes consistently displaying high expression levels across various stress treatments [31]. Additionally, in peas, PsSMXL7 is degraded by SLs and induces feedback upregulation of its own transcription [32], and in apples, 10 SMXL gene family members have been identified, among which MdSMXL8.1 and MdSMXL8.2 respond to drought and cold stress [33]. Additionally, research indicates that SMXL6, SMXL7, and SMXL8 proteins possess both the ethylene-responsive element binding factor-associated amphiphilic repression (EAR) motif and the RGKT motif, which are both critical for SL signal transduction [32,34].
Common wheat (Triticum aestivum L.) is one of the most widely cultivated crops in the world [35]. Due to its longer growth period, wheat is more susceptible to adverse environmental conditions. With the intensification of climate change and the worsening of environmental pollution, environmental stress has become a significant barrier to wheat growth, development, and yield [36]. Previous studies have indicated that the SMXL gene family may play an important role in response to abiotic stress, making the study of the SMXL gene family’s role in wheat stress resistance and growth development highly significant [31]. Although the SMXL gene family has been identified in various crops, there have been limited reports on its systematic identification in wheat, especially regarding its expression in wheat roots under different abiotic stresses. This research identified and characterized 22 TaSMXL genes from the wheat genome, comprehensively analyzing their sequence characteristics, phylogenetic relationships, gene structures, conserved motifs, chromosome locations, and synteny. Transcriptomic analysis was conducted to investigate the expression profiles of TaSMXL genes in various tissues and under different abiotic stress conditions. Furthermore, the expression patterns of TaSMXL genes were examined following exposure to 1.0% (w/v) NaCl, 0.2% (w/v) Na2CO3, and 5% (w/v) mannitol. These efforts aim to lay the groundwork for a deeper understanding of the function of the SMXL gene family in wheat growth and development, particularly in response to abiotic stress.

2. Materials and Methods

2.1. Identification and Chromosome Mapping of TaSMXL Family Members

To identify the SMXL gene family members in wheat, the known SMXL gene sequences of Arabidopsis thaliana were first obtained from the Arabidopsis Information Resource website (https://www.arabidopsis.org/ accessed on 1 December 2024) and used to search the wheat genome. The genome data for wheat were sourced from the Ensembl Plants website [37] (https://plants.ensembl.org/index.html accessed on 1 December 2024). Additionally, the conserved domains of the SMXL family, Clp-N and P-Loop NTPase [29], were used to further search the wheat genome. The BLASTp program in the BLAST software v2.16.0 suite, downloaded from (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 1 December 2024), was used with Arabidopsis thaliana SMXL protein sequences as query sequences to search for SMXL proteins in the wheat genome. The e-value threshold was set to 1.0 × 10−5. Redundant transcripts were manually removed to identify homologous SMXL genes in wheat. The molecular weight and isoelectric point of the TaSMXL proteins were calculated using the Expasy website [38] (https://web.expasy.org/compute_pi/ accessed on 2 December 2024), and subcellular localization predictions were performed using the Plant-mPLoc website [39] (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/ accessed on 2 December 2024). The chromosomal location data of the TaSMXL genes were retrieved from the GFF3 files of T. aestivum and visualized using TBTools software v2.154 [40].

2.2. Phylogenetic Analysis

Phylogenetic tree analysis was first performed using ClustalW 2.1 software to conduct multiple sequence alignment of SMXL protein sequences from five species, including Arabidopsis thaliana. Subsequently, the aligned protein sequences were used to construct an unrooted phylogenetic tree with MEGA 11 software [41]. The Neighbor-Joining (NJ) method was employed, with 1000 bootstrap replicates [42]. The phylogenetic trees were visualized and refined using the online platform Evolview 3.0 (https://www.evolgenius.info/evolview/ accessed on 4 December 2024) [43,44].

2.3. Prediction of Gene Structure, Protein Conserved Motifs, and Promoter Cis-Acting Elements

The full-length sequences of the initially identified TaSMXL proteins were analyzed using the online tool MEME [45] (https://meme-suite.org/meme/tools/meme accessed on 5 December 2024) to detect conserved sequences, key functional sites, and motifs, with the parameters set to identify 10 motifs. The promoter regions (2000 bp upstream) of the TaSMXL genes were extracted using TBtools, and their cis-acting elements were predicted using PlantCare (https://bioinformatics.psb.ugent.be/webtools/plantcare/html/ accessed on 10 December 2024) [46]. Finally, the phylogenetic tree, motif composition, and gene structure of the TaSMXL genes were visualized using TBtools.

2.4. Collinear Analysis of SMXL Gene

The collinearity among SMXL genes across wheat, Arabidopsis, and rice genomes, as well as intra-genomic collinearity within wheat, was examined using MCScanX software v1.0.0 [47]. The collinear relationships were visualized with TBTools. Ka/Ks values were calculated using the KaKs_calculator 3.0 software [48].

2.5. The Interaction Between MicroRNA and TaSMXL Target Genes

The CDS sequences of TaSMXLs were analyzed on the psRNATarget website (https://www.zhaolab.org/psRNATarget/analysis?function=2/, accessed on 5 January 2025) in conjunction with wheat miRNA sequences provided on the same platform [49], enabling the exploration of the targeting interactions between miRNAs and TaSMXLs. Data visualization was conducted using the alluvial plot tool available on the Bioinformatics website (https://www.bioinformatics.com.cn/plot_basic_alluvial_plot_017, accessed on 29 December 2024).

2.6. Transcriptome Expression Pattern Analysis

To investigate the response of TaSMXL genes in wheat under different tissues and abiotic stress conditions, transcriptome data were downloaded from the WheatOmics database (http://wheatomics.sdau.edu.cn/ accessed on 15 December 2024) [50]. The study investigated the effects of salt stress (150 mM NaCl) and drought stress (20% PEG6000) on gene expression in Triticum aestivum (Chinese Spring) by analyzing TPM data. The experiments included control and stress treatment groups, each with three biological replicates. For the drought stress experiment, seeds were sterilized and germinated in Hoagland solution for 9 days (22 ± 2 °C). For the salt stress experiment, seeds were surface-sterilized with 1% NaClO and hydroponically grown in a greenhouse until 3 weeks old before treatment. All experiments were conducted in a growth chamber (22 °C/18 °C, 16 h light/8 h dark). Root samples were collected at 6 h, 12 h, 24 h, and 48 h after salt stress application, while seedlings were collected at 0 h, 2 h, and 12 h after drought stress treatment. The data were log10(TPM + 1)-transformed and visualized using TBTools software v2.154.

2.7. Materials and Treatments

The experimental material used was the wheat cultivar Yangmai 44, bred by the Lixiahe Institute of Agricultural Sciences (Yangzhou, China; https://lxh.jaas.ac.cn/ accessed on 15 December 2024). The seeds were placed in germination boxes, with a layer of clean gauze at the bottom, ensuring the gauze was fully soaked with water. The Yangmai 44 seeds were cultured under a photoperiod of 16 h light and 8 h dark for 7 days. After one week, for the stress treatment experiment, the seedlings were transferred to a hydroponic system containing full Hoagland nutrient solution and cultured for an additional 7 days. Two-week-old hydroponically cultured Yangmai 44 plants were subjected to stresses of 1.0% (w/v) NaCl, 0.2% (w/v) Na2CO3, and 5% (w/v) mannitol. Roots were collected 6 h after treatment, immediately frozen in liquid nitrogen, and used for subsequent qRT-PCR analysis.

2.8. Relative Expression of TaSMXL Under Different Abiotic Stresses

RNA was extracted from Yangmai 44. The Tiangen RNAsimple Total RNA Kit (Tiangen Biotech, Beijing, China) was used for RNA extraction. The extracted RNA was reverse transcribed into cDNA using the FastKing RT Kit (Tiangen, Beijing, China). Real-time quantitative PCR was performed using the ArtCanCEOSYBR qPCR Mix (Tsingke, Beijing, China) kit [51]. Specific primers were designed using NCBI Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome accessed on 17 December 2024) (Table 1). Based on previous studies, TaActin was used as the internal control [49]. Gene expression levels were determined through the 2−ΔΔCT calculation method, with data analysis and visualization conducted using GraphPad Prism 8.0.

3. Results

3.1. Identification and Characterization of SMXLs in Common Wheat

To identify the SMXL gene family in wheat (Triticum aestivum), we performed a BlastP homology search against the IWGSC reference genome of Chinese Spring wheat [35], based on eight AtSMXL protein sequences previously identified in Arabidopsis thaliana. The IWGSC genome sequence files (https://ftp.ensemblgenomes.ebi.ac.uk/pub/plants/release-60/fasta/triticum_aestivum/dna/ accessed on 1 December 2024) were obtained from the Ensembl Plants database [37]. Following the application of the NCBI-CDD tool, sequences lacking complete structural domains were excluded. Through this process, 22 TaSMXL proteins were successfully identified and assigned the names TaSMXL1 through TaSMXL22. Utilizing chromosomal location data from the wheat SMXL gene family, as derived from the genome annotation file, the distribution of SMXL family members across chromosomes was visualized, culminating in the creation of a chromosomal localization map (Figure 1). These 22 genes are distributed across 12 chromosomes. Specifically, Chr5A contains three TaSMXL genes, while each of chromosomes Chr2A, Chr2B, Chr2D, Chr4B, Chr5B, Chr5D, Chr6A, and Chr6D contain two TaSMXL genes. Chromosomes Chr4A, Chr4D, and Chr6B each contain one TaSMXL gene. In contrast, no TaSMXL genes were found on chromosomes Chr1A, Chr1B, Chr1D, Chr3A, Chr3B, Chr3D, Chr7A, Chr7B, or Chr7D.

3.2. Prediction of TaSMXL Protein Properties: Physical-Chemical Characteristics and Subcellular Localization

The TaSMXL proteins exhibited amino acid lengths spanning from 903 to 991 residues (Table S1). Their molecular weights (MW) fell within the range of 99.79 kDa to 110.02 kDa. Additionally, the predicted theoretical isoelectric points (pI) of these proteins ranged from 5.86 to 8.67. According to subcellular localization predictions, most TaSMXL proteins (TaSMXL1 to TaSMXL5, TaSMXL8 to TaSMXL10, TaSMXL12 to TaSMXL18, and TaSMXL20 to TaSMXL21) were localized in the chloroplast, while a smaller fraction (TaSMXL6, TaSMXL11, TaSMXL19, and TaSMXL22) were localized in the mitochondria. Additionally, TaSMXL7 was the only SMXL protein localized in the cytoplasm.

3.3. Phylogenetic Analysis of TaSMXL Proteins

Based on the genetic relationships with 22 SMXL proteins from Triticum aestivum, 8 SMXL proteins from Arabidopsis thaliana, 2 SMXL proteins from Oryza sativa, 11 SMXL proteins from Zea mays, and 10 SMXL proteins from Malus domestica (File S1), as well as the positioning of AtSMXL proteins within the tree, the SMXL proteins were classified into four groups: Group I, Group II, Group III, and Group IV (Figure 2). Notably, all TaSMXL proteins were clustered in Group II, along with AtSMXL6, AtSMXL7, AtSMXL8, OsD53, and OsD53-like.

3.4. Analysis of TaSMXL Family Structure, Conserved Motifs and Promoter Cis-Acting Elements

The conserved motif analysis revealed that each TaSMXL protein contains 10 predicted motifs, with similar distribution patterns across all TaSMXL proteins (Figure 3A). Structural analysis showed that all TaSMXL proteins possess two Clp-N domains and one P-loop domain at the N-terminus, which are characteristic features of this protein family (Figure 3B). Promoter cis-acting element analysis indicated that TaSMXL proteins may be involved in responses to environmental stresses such as drought, low temperature, auxin signaling, and defense and stress responses (Figure 3C). Among these, light-responsive elements were the most abundant, with a total number of 271, which far exceeds the number of other types of cis-acting elements. Notably, TaSMXL1 contained the highest number of cis-acting elements, reaching 49, suggesting its potential significance in the growth and development of T. aestivum. Based on the appropriate genomic DNA sequences and annotation data, we analyzed the exon-intron architecture of TaSMXL genes. As illustrated in Figure 3D, the arrangement of exons and introns within TaSMXL genes exhibited a high degree of uniformity. All TaSMXL genes contained exons located at both ends of the gene and introns situated between the exons. Each TaSMXL gene was found to contain two exons. Notably, the mRNA structures of genes such as TaSMXL7, TaSMXL9, TaSMXL12, TaSMXL14, TaSMXL16, TaSMXL18, and TaSMXL20 exhibited discernible differences. These variations may be attributed to potential mutation or recombination events within the wheat genome. Consequently, distinct structural variations in the UTR and CDS regions of specific TaSMXL genes were observed.
An examination of the promoter regions of TaSMXL gene family members conducted via the PlantCARE online tool revealed a total of 221 cis-acting elements. These elements were categorized and statistically analyzed based on their functional roles in growth and development, stress response, plant hormones, and light response (Figure 4). Specifically, two elements were linked to growth and development, namely the O2-site, which facilitates metabolic regulation, and the CCAAT-box, which governs seed-specific regulation. Additionally, three elements were associated with stress responses, including the MBS (MYB-binding site) responsible for drought induction, the TC-rich repeats tied to defense and stress responsiveness, and the ARE element involved in anaerobic induction. Seven plant hormone-related cis-acting elements were identified, including ABRE, which regulates ABA signaling, and TGACG-motif and CGTCA-motif, both involved in jasmonic acid response. The most abundant cis-acting elements are associated with light response, comprising 13 types, including MRE, which regulates target gene expression, the G-box, a common regulatory element responsive to external environmental stimuli, and conserved DNA modules such as Box4 and I-box related to light response.

3.5. Collinearity Analysis of SMXL Gene Family

The results indicated that SMXL genes in Triticum aestivum exhibited six pairs of homologous genes with SMXL genes in Oryza sativa (Figure 5 and Table S2). Notably, none of the TaSMXL genes showed collinearity with SMXL genes in Oryza sativa. Further analysis of collinearity within the T. aestivum genome identified 11 collinear gene pairs among TaSMXL genes (Figure 6 and Table S3). To better understand the genetic relationships between these collinear gene pairs, Ka/Ks ratios were calculated to evaluate selection pressure (Figure 7 and Table S4). The analysis revealed that all 11 homologous gene pairs exhibited Ka/Ks ratios below 1, suggesting they are subject to purifying selection.

3.6. Analysis of Interaction Between Microrna and TaSMXL Target Genes

To investigate the interaction between miRNA and TaSMXL, we constructed an alluvial diagram (Figure 8) to illustrate the regulatory relationships among miRNAs, their corresponding TaSMXL gene targets, and the post-transcriptional inhibition mechanisms. Each miRNA and its corresponding target transcription factor are represented by distinct colors, and ultimately, this interaction plays a role in the inhibition of translation and transcription. A total of 24 miRNAs were predicted to target 18 TaSMXL genes. Cleavage is identified as the predominant inhibition mechanism, as evidenced by the flows leading to the “Cleavage” category, indicating its significant role in post-transcriptional regulation. Notably, TaSMXL2, TaSMXL4, TaSMXL19, and TaSMXL22 are involved in translation repression mechanisms.

3.7. Analysis of Transcriptome Expression Pattern of TaSMXL

After data processing, expression heatmaps (log10(TPM + 1)) were generated, as shown in Figure 8. In Figure 9A, the expression patterns of TaSMXL genes under different abiotic stress treatments are presented, including the expression changes of the control group (CK) and polyethylene glycol (PEG) treatment at different time points (0 h, 2 h, 12 h), as well as the expression changes of the control group (CK) and salt (NaCl) treatment at different time points (6 h, 12 h, 24 h, 48 h). Figure 9A shows that under salt stress, TaSMXL3, TaSMXL9, TaSMXL12, TaSMXL14, TaSMXL21, and TaSMXL1 exhibited downregulated expression compared to the control group, whereas TaSMXL10 and TaSMXL15 showed upregulated expression. Under drought stress, TaSMXL6 and TaSMXL11 exhibited upregulated expression at different time points compared to the control group. In Figure 9B, the tissue-specific expression profiles of TaSMXL genes in roots, stems, leaves, spikes, and seeds are presented. The results indicate that most SMXL genes have higher expression levels in roots, and genes such as TaSMXL3, TaSMXL21, and TaSMXL1 are highly expressed in roots, stems, and leaves. In contrast, genes like TaSMXL6, TaSMXL11, TaSMXL17, and TaSMXL19 show lower expression levels in most tissues.

3.8. Detection of TaSMXL Expression Under Various Abiotic Stresses by qPCR Technique

The results showed that under NaCl treatment, TaSMXL1, TaSMXL3, TaSMXL10, TaSMXL12, TaSMXL13, TaSMXL14, and TaSMXL15 exhibited no significant changes in expression levels, while TaSMXL14 and TaSMXL15 showed significantly reduced expression (Figure 10). Under PEG treatment, TaSMXL1, TaSMXL12, TaSMXL20, and TaSMXL21 showed no significant changes in expression levels, whereas TaSMXL9, TaSMXL16, and TaSMXL18 displayed significantly reduced expression levels. In contrast, TaSMXL3, TaSMXL10, TaSMXL13, TaSMXL14, and TaSMXL15 were significantly upregulated compared to the control. Under mannitol treatment, TaSMXL1, TaSMXL3, TaSMXL10, TaSMXL12, TaSMXL14, TaSMXL15, and TaSMXL21 exhibited no significant changes in expression levels, while TaSMXL9, TaSMXL13, TaSMXL16, TaSMXL18, and TaSMXL20 showed significantly reduced expression.

4. Discussion

SMXL plays a vital role in various aspects of plant growth, development, and physiological metabolism, with different SMXL orthologs exhibiting distinct physiological functions [20,22,27]. In recent years, advancements in sequencing technologies have enabled studies on SMXL genes in A. thaliana [29], O. sativa [16], Z. mays [31], M. domestica [33], and Glycine max [52]. However, the functional characterization and family analysis of SMXL genes in T. aestivum have not yet been reported. Therefore, a comprehensive investigation of the SMXL gene family in T. aestivum is still required.
Using the eight Arabidopsis thaliana SMXL proteins as seed sequences, 22 SMXL genes were identified in the T. aestivum (Chinese Spring IWGSC) genome through BLAST and NCBI-CD search methods. A comprehensive analysis was conducted on the TaSMXL genes, including their sequence structure features, evolutionary relationships, interactions between miRNAs and TaSMXL target genes, tissue-specific expression profiles, and expression patterns under abiotic stress conditions. The transcriptional profiles of TaSMXL genes under different abiotic stress conditions were further confirmed. This research marks the inaugural comprehensive genome-wide exploration and functional characterization of the TaSMXL gene family in wheat. The results revealed that the number of wheat SMXL family members is greater than those in A. thaliana (8 members), Z. mays (11 members), and M. domestica (10 members).
Wheat is a whole-genome duplication species with a hexaploid genome containing three subgenomes [35], indicating multiple gene duplication events during its evolutionary history. These duplication events likely contribute to the high similarity among family members, which may lead to their clustering within a single subclade in the phylogenetic tree. As shown in Figure 2, all TaSMXL family members are grouped within Group II, alongside AtSMXL6, AtSMXL7, AtSMXL8, OSD53, and OSD53-like. In Figure 3A, all TaSMXL family members are predicted to contain 10 conserved motifs, which are similarly distributed within their genes. In Figure 3B, TaSMXL proteins feature a Clp-N motif, a characteristic of the nucleoside triphosphate hydrolase superfamily, which may be involved in perceiving SL signaling components [15,23]. All identified TaSMXL proteins contain a P-loop NTPase-specific domain. As illustrated in Figure 3D, all TaSMXL genes have two exons, located at opposite ends of the SMXL gene. These findings indicate that wheat, as a unique species, reflects distinct evolutionary history and adaptability. Moreover, this study found that most TaSMXL family members are predominantly localized in chloroplasts, suggesting their potential involvement in specific biological functions within chloroplasts.
The analysis of the structure and conserved domains of TaSMXL genes reveals that these genes are highly conserved across different species during the course of evolution. To cope with biotic and abiotic stresses, plants have evolved a variety of adaptive mechanisms, primarily through the expression of genes that respond to such stresses. In plants, transcription factors regulate the activity of genes associated with responses to biotic and abiotic stresses, underscoring the importance of analyzing promoter cis-acting elements [53]. Researchers observed that the promoter regions of TaSMXL genes, spanning 2000 base pairs upstream, exhibited a predominant abundance of light-responsive regulatory motifs, with 271 identified instances, substantially exceeding the frequency of other cis-acting elements. This finding implies that members of the TaSMXL gene family might play a regulatory role in photoperception and could potentially modulate processes related to wheat’s developmental progression.
The SMXL (SMAX1-Like) gene family represents a crucial element in plants for perceiving and responding to strigolactone (SL) signals. Functioning as terminal effectors in SL signaling, SMXL/D53 proteins act as inhibitors in SL perception and responses, regulating key processes such as plant branching [20,22]. Evidence indicates that SMXL genes are involved in diverse abiotic stress responses, though their expression profiles differ across plant species. Research has revealed that SMXL genes are associated with a variety of abiotic stress responses, although their expression patterns display notable differences across species. For instance, in cotton, GhSMXL8-1-D and GhSMXL3-1-A show high expression under low-temperature, salt, and drought stresses, while the expression levels of some SMXL genes decline under similar stress conditions. This suggests that the expression of SMXL genes is a complex process, potentially influenced by factors such as plant species, specific SMXL gene family members, and the duration of stress. To explore the expression characteristics of SMXL genes under various stress conditions, this study analyzed the expression of 12 randomly selected SMXL genes using qRT-PCR technology (Figure 10). Under NaCl treatment, the expression levels of most SMXL genes decreased, with TaSMXL9 and TaSMXL16 showing significant reductions. In contrast, under Na2CO3 treatment, the expression levels of most SMXL genes increased significantly, particularly TaSMXL3, TaSMXL10, TaSMXL13, TaSMXL14, and TaSMXL15. Comparatively, under mannitol treatment, the expression levels of most SMXL genes decreased, with TaSMXL9, TaSMXL13, and TaSMXL16 exhibiting significant reductions. These findings suggest that under salt stress, the downregulation of most SMXL genes may be associated with enhanced SL signaling in wheat, which likely restricts branching and tillering to reduce energy and resource consumption, thereby aiding in salt stress adaptation. Under alkaline stress, the upregulation of most SMXL genes may negatively regulate the SL signaling pathway, reducing branching or excessive growth and prioritizing resource allocation to root development or other critical organs. Under mannitol treatment, the downregulation of most SMXL genes might enhance SL signal regulation, potentially alleviating branching growth inhibition to promote greater root system expansion and improve water absorption capacity.

5. Conclusions

A total of 22 SMXL genes were identified in the wheat genome, distributed across 12 chromosomes. Comprehensive analyses were conducted, including phylogenetic relationships, physicochemical properties of proteins, subcellular localization, gene structures, promoter cis-acting elements, and associated miRNAs. Additionally, transcriptional expression patterns of these genes were analyzed in various wheat tissues and under abiotic stress treatments. The results indicated significant variations in the expression patterns of TaSMXL genes under different abiotic stresses, suggesting that wheat exhibits stress-specific responses depending on the type of stress. This study provides valuable theoretical insights into the TaSMXL gene family and its potential applications in enhancing stress resistance through wheat breeding.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy15030656/s1, File S1: The SMXL protein sequences corresponding to bread Triticum aestivum, Arabidopsis thaliana, Malus domestica, Zea mays, and Oryza sativa; Table S1: Prediction of physicochemical properties and subcellular localization of TaSMXL proteins; Table S2: Collinearity of SMXL genes in T. aestivum, A. thaliana, and O. sativa; Table S3: Collinearity of SMXL genes in T. aestivum; Table S4: Ka/Ks calculation of SMXLs.

Author Contributions

X.C. and H.W. (Hongya Wu) designed the experiment. Z.W. and H.W. (Heping Wan) did most of the experiments. Z.W. and H.W. (Heping Wan) drafted the manuscript. Z.J., X.C. and H.W. (Hongya Wu) revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Biological Breeding—National Science and Technology Major Project, grant number 2023ZD0402303, and the Jiangsu Province Key Research and Development Program (Modern Agriculture) Project, grant number BE2021335.

Data Availability Statement

All data analyzed during this study are included in this article and Supplementary Materials.

Acknowledgments

This research was funded by the Biological Breeding—National Science and Technology Major Project, grant number 2023ZD0402303, and the Jiangsu Province Key Research and Development Program (Modern Agriculture) Project, grant number BE2021335. The authors are grateful for the financial support provided.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

References

  1. Seif El-Yazal, S.A.; Seif El-Yazal, M.A.; Dwidar, E.F.; Rady, M.M. Phytohormone crosstalk research: Cytokinin and its crosstalk with other phytohormones. Curr. Protein Pept. Sci. 2015, 16, 395–405. [Google Scholar] [CrossRef]
  2. Kohlen, W.; Charnikhova, T.; Liu, Q.; Bours, R.; Domagalska, M.A.; Beguerie, S.; Verstappen, F.; Leyser, O.; Bouwmeester, H.; Ruyter-Spira, C. Strigolactones are transported through the xylem and play a key role in shoot architectural response to phosphate deficiency in nonarbuscular mycorrhizal host Arabidopsis. Plant Physiol. 2011, 155, 974–987. [Google Scholar] [CrossRef] [PubMed]
  3. Waters, M.T.; Gutjahr, C.; Bennett, T.; Nelson, D.C. Strigolactone signaling and evolution. Annu. Rev. Plant Biol. 2017, 68, 291–322. [Google Scholar] [CrossRef] [PubMed]
  4. Wang, B.; Wang, Y.; Li, J. Strigolactones. In Hormone Metabolism and Signaling in Plants; Academic Press: Cambridge, MA, USA, 2017; pp. 327–359. [Google Scholar]
  5. Seto, Y.; Kameoka, H.; Yamaguchi, S.; Kyozuka, J. Recent advances in strigolactone research: Chemical and biological aspects. Plant Cell Physiol. 2012, 53, 1843–1853. [Google Scholar] [CrossRef]
  6. Yoshimura, M.; Sato, A.; Kuwata, K.; Inukai, Y.; Kinoshita, T.; Itami, K.; Tsuchiya, Y.; Hagihara, S. Discovery of shoot branching regulator targeting strigolactone receptor DWARF14. ACS Cent. Sci. 2018, 4, 230–234. [Google Scholar] [CrossRef]
  7. Rasmussen, A.; Mason, M.G.; De Cuyper, C.; Brewer, P.B.; Herold, S.; Agusti, J.; Geelen, D.; Greb, T.; Goormachtig, S.; Beeckman, T. Strigolactones suppress adventitious rooting in Arabidopsis and pea. Plant Physiol. 2012, 158, 1976–1987. [Google Scholar] [CrossRef]
  8. López-Ráez, J.A.; Pozo, M.J. Chemical signalling in the arbuscular mycorrhizal symbiosis: Biotechnological applications. In Symbiotic Endophytes; Springer: Berlin/Heidelberg, Germany, 2013; pp. 215–232. [Google Scholar]
  9. Zwanenburg, B.; Blanco-Ania, D. Strigolactones: New plant hormones in the spotlight. J. Exp. Bot. 2018, 69, 2205–2218. [Google Scholar] [CrossRef]
  10. Umehara, M.; Hanada, A.; Yoshida, S.; Akiyama, K.; Arite, T.; Takeda-Kamiya, N.; Magome, H.; Kamiya, Y.; Shirasu, K.; Yoneyama, K. Inhibition of shoot branching by new terpenoid plant hormones. Nature 2008, 455, 195–200. [Google Scholar] [CrossRef]
  11. Domagalska, M.A.; Leyser, O. Signal integration in the control of shoot branching. Nat. Rev. Mol. Cell Biol. 2011, 12, 211–221. [Google Scholar] [CrossRef]
  12. Yao, R.; Ming, Z.; Yan, L.; Li, S.; Wang, F.; Ma, S.; Yu, C.; Yang, M.; Chen, L.; Chen, L. DWARF14 is a non-canonical hormone receptor for strigolactone. Nature 2016, 536, 469–473. [Google Scholar] [CrossRef]
  13. Liu, W.; Wu, C.; Fu, Y.; Hu, G.; Si, H.; Zhu, L.; Luan, W.; He, Z.; Sun, Z. Identification and characterization of HTD2: A novel gene negatively regulating tiller bud outgrowth in rice. Planta 2009, 230, 649–658. [Google Scholar] [CrossRef]
  14. Chevalier, F.; Nieminen, K.; Sánchez-Ferrero, J.C.; Rodríguez, M.L.; Chagoyen, M.; Hardtke, C.S.; Cubas, P. Strigolactone promotes degradation of DWARF14, an α/β hydrolase essential for strigolactone signaling in Arabidopsis. Plant Cell 2014, 26, 1134–1150. [Google Scholar] [CrossRef] [PubMed]
  15. Jiang, L.; Liu, X.; Xiong, G.; Liu, H.; Chen, F.; Wang, L.; Meng, X.; Liu, G.; Yu, H.; Yuan, Y. DWARF 53 acts as a repressor of strigolactone signalling in rice. Nature 2013, 504, 401–405. [Google Scholar] [CrossRef]
  16. Zhou, F.; Lin, Q.; Zhu, L.; Ren, Y.; Zhou, K.; Shabek, N.; Wu, F.; Mao, H.; Dong, W.; Gan, L. D14–SCFD3-dependent degradation of D53 regulates strigolactone signalling. Nature 2013, 504, 406–410, Corrected in: Nature 2016, 532, 402. [Google Scholar] [CrossRef] [PubMed]
  17. Agusti, J.; Herold, S.; Schwarz, M.; Sanchez, P.; Ljung, K.; Dun, E.A.; Brewer, P.B.; Beveridge, C.A.; Sieberer, T.; Sehr, E.M. Strigolactone signaling is required for auxin-dependent stimulation of secondary growth in plants. Proc. Natl. Acad. Sci. USA 2011, 108, 20242–20247. [Google Scholar] [CrossRef]
  18. Ruyter-Spira, C.; Kohlen, W.; Charnikhova, T.; van Zeijl, A.; van Bezouwen, L.; De Ruijter, N.; Cardoso, C.; Lopez-Raez, J.A.; Matusova, R.; Bours, R. Physiological effects of the synthetic strigolactone analog GR24 on root system architecture in Arabidopsis: Another belowground role for strigolactones? Plant Physiol. 2011, 155, 721–734. [Google Scholar] [CrossRef]
  19. Gomez-Roldan, V.; Fermas, S.; Brewer, P.B.; Puech-Pagès, V.; Dun, E.A.; Pillot, J.-P.; Letisse, F.; Matusova, R.; Danoun, S.; Portais, J.-C. Strigolactone inhibition of shoot branching. Nature 2008, 455, 189–194. [Google Scholar] [CrossRef]
  20. Wang, L.; Wang, B.; Jiang, L.; Liu, X.; Li, X.; Lu, Z.; Meng, X.; Wang, Y.; Smith, S.M.; Li, J. Strigolactone signaling in Arabidopsis regulates shoot development by targeting D53-like SMXL repressor proteins for ubiquitination and degradation. Plant Cell 2015, 27, 3128–3142. [Google Scholar] [CrossRef]
  21. Zhao, L.-H.; Zhou, X.E.; Yi, W.; Wu, Z.; Liu, Y.; Kang, Y.; Hou, L.; De Waal, P.W.; Li, S.; Jiang, Y. Destabilization of strigolactone receptor DWARF14 by binding of ligand and E3-ligase signaling effector DWARF3. Cell Res. 2015, 25, 1219–1236. [Google Scholar] [CrossRef]
  22. Soundappan, I.; Bennett, T.; Morffy, N.; Liang, Y.; Stanga, J.P.; Abbas, A.; Leyser, O.; Nelson, D.C. SMAX1-LIKE/D53 family members enable distinct MAX2-dependent responses to strigolactones and karrikins in Arabidopsis. Plant Cell 2015, 27, 3143–3159. [Google Scholar] [CrossRef]
  23. Stanga, J.P.; Morffy, N.; Nelson, D.C. Functional redundancy in the control of seedling growth by the karrikin signaling pathway. Planta 2016, 243, 1397–1406. [Google Scholar] [CrossRef]
  24. Stanga, J.P.; Smith, S.M.; Briggs, W.R.; Nelson, D.C. SUPPRESSOR OF MORE AXILLARY GROWTH2 1 controls seed germination and seedling development in Arabidopsis. Plant Physiol. 2013, 163, 318–330. [Google Scholar] [CrossRef]
  25. Wallner, E.-S.; Lopez-Salmeron, V.; Belevich, I.; Poschet, G.; Jung, I.; Grünwald, K.; Sevilem, I.; Jokitalo, E.; Hell, R.; Helariutta, Y. Strigolactone-and karrikin-independent SMXL proteins are central regulators of phloem formation. Curr. Biol. 2017, 27, 1241–1247. [Google Scholar] [CrossRef]
  26. Wu, Y.Y.; Hou, B.H.; Lee, W.C.; Lu, S.H.; Yang, C.J.; Vaucheret, H.; Chen, H.M. DCL2-and RDR6-dependent transitive silencing of SMXL4 and SMXL5 in Arabidopsis dcl4 mutants causes defective phloem transport and carbohydrate over-accumulation. Plant J. 2017, 90, 1064–1078. [Google Scholar] [CrossRef] [PubMed]
  27. Villaécija-Aguilar, J.A.; Hamon-Josse, M.; Carbonnel, S.; Kretschmar, A.; Schmidt, C.; Dawid, C.; Bennett, T.; Gutjahr, C. SMAX1/SMXL2 regulate root and root hair development downstream of KAI2-mediated signalling in Arabidopsis. PLoS Genet. 2019, 15, e1008327. [Google Scholar] [CrossRef] [PubMed]
  28. Wang, L.; Wang, B.; Yu, H.; Guo, H.; Lin, T.; Kou, L.; Wang, A.; Shao, N.; Ma, H.; Xiong, G. Transcriptional regulation of strigolactone signalling in Arabidopsis. Nature 2020, 583, 277–281. [Google Scholar] [CrossRef] [PubMed]
  29. Moturu, T.R.; Thula, S.; Singh, R.K.; Nodzyński, T.; Vařeková, R.S.; Friml, J.; Simon, S. Molecular evolution and diversification of the SMXL gene family. J. Exp. Bot. 2018, 69, 2367–2378. [Google Scholar] [CrossRef]
  30. Bennett, T.; Liang, Y.; Seale, M.; Ward, S.; Müller, D.; Leyser, O. Strigolactone regulates shoot development through a core signalling pathway. Biol. Open 2016, 5, 1806–1820. [Google Scholar] [CrossRef]
  31. Lu, Y.F.; Yan, Y.X.; Qin, Y.H.; Chen, J.B.; Cheng, L.; Liu, F.; Tan, J. Genome-wide Identification and Potential Function Analysis of Maize Smxl Gene Family under Abiotic Stress. Mol. Plant Breed. 2025, 1–19. Available online: http://kns.cnki.net/kcms/detail/46.1068.S.20240929.1601.002.html (accessed on 3 March 2025).
  32. Kerr, S.C.; Patil, S.B.; de Saint Germain, A.; Pillot, J.P.; Saffar, J.; Ligerot, Y.; Aubert, G.; Citerne, S.; Bellec, Y.; Dun, E.A. Integration of the SMXL/D53 strigolactone signalling repressors in the model of shoot branching regulation in Pisum sativum. Plant J. 2021, 107, 1756–1770. [Google Scholar] [CrossRef]
  33. Li, R.; An, J.-P.; You, C.-X.; Wang, X.-F.; Hao, Y.-J. Genome-wide analysis and identification of the SMXL gene family in apple (Malus × domestica). Tree Genet. Genomes 2018, 14, 61. [Google Scholar] [CrossRef]
  34. Ma, H.; Duan, J.; Ke, J.; He, Y.; Gu, X.; Xu, T.-H.; Yu, H.; Wang, Y.; Brunzelle, J.S.; Jiang, Y. A D53 repression motif induces oligomerization of TOPLESS corepressors and promotes assembly of a corepressor-nucleosome complex. Sci. Adv. 2017, 3, e1601217. [Google Scholar] [CrossRef]
  35. Consortium, I.W.G.S.; Appels, R.; Eversole, K.; Stein, N.; Feuillet, C.; Keller, B.; Rogers, J.; Pozniak, C.J.; Choulet, F.; Distelfeld, A. Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 2018, 361, eaar7191. [Google Scholar] [CrossRef]
  36. Mohammadi, R. Efficiency of yield-based drought tolerance indices to identify tolerant genotypes in durum wheat. Euphytica 2016, 211, 71–89. [Google Scholar] [CrossRef]
  37. Bolser, D.M.; Staines, D.M.; Perry, E.; Kersey, P.J. Ensembl Plants: Integrating Tools for Visualizing, Mining, and Analyzing Plant Genomic Data. In Plant Genomics Databases: Methods and Protocols; Methods in Molecular Biology Series; van Dijk, A.D.J., Ed.; Humana: New York, NY, USA, 2017; pp. 1–31. [Google Scholar]
  38. Duvaud, S.; Gabella, C.; Lisacek, F.; Stockinger, H.; Ioannidis, V.; Durinx, C. Expasy, the Swiss Bioinformatics Resource Portal, as designed by its users. Nucleic Acids Res. 2021, 49, W216–W227. [Google Scholar] [CrossRef]
  39. Horton, P.; Park, K.J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef]
  40. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
  41. Tamura, K.; Stecher, G.; Kumar, S.; Battistuzzi, F.U. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
  42. Tamura, K.; Nei, M.; Kumar, S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. USA 2004, 101, 11030–11035. [Google Scholar] [CrossRef]
  43. Subramanian, B.; Gao, S.; Lercher, M.J.; Hu, S.; Chen, W.H. Evolview v3: A webserver for visualization, annotation, and management of phylogenetic trees. Nucleic Acids Res. 2019, 47, W270–W275. [Google Scholar] [CrossRef]
  44. Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef]
  45. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Peer, Y.V.d.; Rouzé, P.R.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. Suppl. 2002, 30, 325–327. [Google Scholar] [CrossRef] [PubMed]
  46. Wang, Y.; Tang, H.; Debarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.H.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef] [PubMed]
  47. Zhang, Z. KaKs_Calculator 3.0: Calculating Selective Pressure on Coding and Non-coding Sequences. Genom. Proteom. Bioinform. 2022, 20, 536–540. [Google Scholar] [CrossRef] [PubMed]
  48. Yao, Y.; Guo, G.; Ni, Z.; Sunkar, R.; Du, J.; Zhu, J.-K.; Sun, Q. Cloning and characterization of microRNAs from wheat (Triticum aestivum L.). Genome Biol. 2007, 8, R96. [Google Scholar] [CrossRef]
  49. Ma, S.; Wang, M.; Wu, J.; Guo, W.; Chen, Y.; Li, G.; Wang, Y.; Shi, W.; Xia, G.; Fu, D.; et al. WheatOmics: A platform combining multiple omics data to accelerate functional genomics studies in wheat. Mol. Plant 2021, 14, 1965–1968. [Google Scholar] [CrossRef]
  50. Jiang, W.; Pan, R.; Buitrago, S.; Wu, C.; Abou-Elwafa, S.F.; Xu, Y.; Zhang, W. Conservation and divergence of the TaSOS1 gene family in salt stress response in wheat (Triticum aestivum L.). Physiol. Mol. Biol. Plants 2021, 27, 1245–1260. [Google Scholar] [CrossRef]
  51. Yu, X.; Han, J.; Wang, E.; Xiao, J.; Hu, R.; Yang, G.; He, G. Genome-Wide Identification and Homoeologous Expression Analysis of PP2C Genes in Wheat (Triticum aestivum L.). Front. Genet. 2019, 10, 561. [Google Scholar] [CrossRef]
  52. Zhang, H.; Wang, L.; Gao, Y.; Guo, Y.; Zheng, N.; Xu, X.; Xu, M.; Wang, W.; Liu, C.; Liu, W. Genome-wide identification of SMXL Gene family in soybean and expression analysis of GmSMXLs under Shade stress. Plants 2022, 11, 2410. [Google Scholar] [CrossRef]
  53. Wang, Y.; Wang, C.; Rajaofera, M.J.N.; Zhu, L.; Liu, W.; Zheng, F.; Miao, W. WY7 is a newly identified promoter from the rubber powdery mildew pathogen that regulates exogenous gene expression in both monocots and dicots. PLoS ONE 2020, 15, e0233911. [Google Scholar] [CrossRef]
Figure 1. Chromosomal location of the TaSMXL in the common wheat genome.
Figure 1. Chromosomal location of the TaSMXL in the common wheat genome.
Agronomy 15 00656 g001
Figure 2. Phylogenetic tree of TaSMXL proteins. Phylogenetic tree of TaSMXL proteins in Triticum aestivum, Arabidopsis thaliana, Malus domestica, Zea mays, and Oryza sativa.
Figure 2. Phylogenetic tree of TaSMXL proteins. Phylogenetic tree of TaSMXL proteins in Triticum aestivum, Arabidopsis thaliana, Malus domestica, Zea mays, and Oryza sativa.
Agronomy 15 00656 g002
Figure 3. Gene structure analysis of SMXL family in T. aestivum. (A) Conserved motifs of TaSMXL family proteins. (B) Pfam structure of TaSMXL family proteins. (C) Promoter cis-acting element of TaSMXLs. (D) The mRNA structure encoded by the TaSMXLs.
Figure 3. Gene structure analysis of SMXL family in T. aestivum. (A) Conserved motifs of TaSMXL family proteins. (B) Pfam structure of TaSMXL family proteins. (C) Promoter cis-acting element of TaSMXLs. (D) The mRNA structure encoded by the TaSMXLs.
Agronomy 15 00656 g003
Figure 4. Classification of cis-acting elements in the members of the TaSMXL gene family.
Figure 4. Classification of cis-acting elements in the members of the TaSMXL gene family.
Agronomy 15 00656 g004
Figure 5. Collinearity of SMXL genes in T. aestivum, A. thaliana, and O. sativa.
Figure 5. Collinearity of SMXL genes in T. aestivum, A. thaliana, and O. sativa.
Agronomy 15 00656 g005
Figure 6. Collinearity of TaSMXLs. The circles in the figure from inside to outside represent the unknown base (a) N ratio, (b) gene density, (c) GC ratio, (d) GC skew, and (e) chromosome length of the T. aestivum genome.
Figure 6. Collinearity of TaSMXLs. The circles in the figure from inside to outside represent the unknown base (a) N ratio, (b) gene density, (c) GC ratio, (d) GC skew, and (e) chromosome length of the T. aestivum genome.
Agronomy 15 00656 g006
Figure 7. The selective evolutionary pressure on TaSMXLs. Blue dots represent the Ka/Ks values within TaSMXL genes, and red dots represent the corresponding Ka and Ks values of TaSMXL genes within species.
Figure 7. The selective evolutionary pressure on TaSMXLs. Blue dots represent the Ka/Ks values within TaSMXL genes, and red dots represent the corresponding Ka and Ks values of TaSMXL genes within species.
Agronomy 15 00656 g007
Figure 8. Analysis of interaction between microrna and TaSMXL.
Figure 8. Analysis of interaction between microrna and TaSMXL.
Agronomy 15 00656 g008
Figure 9. Expression patterns of TaSMXL under abiotic stress treatments and in different tissues. (A) Expression levels of TaSMXL in leaves and roots under CK, NaCl (root), and PEG6000 treatments (leaves). (B) Expression levels of TaSMXL in leaves, stems, roots, spikes, and grains.
Figure 9. Expression patterns of TaSMXL under abiotic stress treatments and in different tissues. (A) Expression levels of TaSMXL in leaves and roots under CK, NaCl (root), and PEG6000 treatments (leaves). (B) Expression levels of TaSMXL in leaves, stems, roots, spikes, and grains.
Agronomy 15 00656 g009
Figure 10. Relative expression of TaSMXL1, TaSMXL3, TaSMXL9, TaSMXL10, TaSMXL12, TaSMXL13, TaSMXL14, TaSMXL15, TaSMXL16, TaSMXL18, TaSMXL20, and TaSMXL21 in wheat leaves after 6 h of treatment with 1.0% (w/v) NaCl, 0.2% (w/v) Na2CO3, and 5% (w/v) mannitol. Data represent the mean  ±  standard error from three biological replicates. The t-test was used to determine significant differences. ns: no significant differences between treatments; *: significant differences between treatments at p  ≤  0.05; **: significant differences between treatments at p  ≤  0.01.
Figure 10. Relative expression of TaSMXL1, TaSMXL3, TaSMXL9, TaSMXL10, TaSMXL12, TaSMXL13, TaSMXL14, TaSMXL15, TaSMXL16, TaSMXL18, TaSMXL20, and TaSMXL21 in wheat leaves after 6 h of treatment with 1.0% (w/v) NaCl, 0.2% (w/v) Na2CO3, and 5% (w/v) mannitol. Data represent the mean  ±  standard error from three biological replicates. The t-test was used to determine significant differences. ns: no significant differences between treatments; *: significant differences between treatments at p  ≤  0.05; **: significant differences between treatments at p  ≤  0.01.
Agronomy 15 00656 g010
Table 1. qPCR primer sequence of TaSMXL genes.
Table 1. qPCR primer sequence of TaSMXL genes.
Gene NameForward Primer (5′→3′)Reverse Primer (3′→5′)
TaSMXL1GCCTGGCGGAAAAGATGCCTAGGCACTCAGAGCAGGC
TaSMXL3GGAAGACAGTCTGGCGGACTAGGCACTCAGAGCAGGC
TaSMXL9ATCGTTGATGTGGACCCGCTAAACAGCGACCGCCG
TaSMXL10TCCTTTTCGGCGAGTACAAGTCAGAATGTCCGTGTTGAGTC
TaSMXL12AGGAGGGCGACTCTGTCCTATACAGCGACCGCCG
TaSMXL13GCGAGGCGATTCTTTTCGTCAGAATGTCCGTGTTGAGTC
TaSMXL14GGTCAAAGAGGGCGACTCCTATACAGCGACCGCCG
TaSMXL15GCGAGGCGATTCTTTTCGTCAGAATGTCCGTGTTGAGTC
TaSMXL16CAGTGGTTTTGTGGCCGTTGTTGTTTGGATCAGCGCCT
TaSMXL18GCTTGCTCAAGAGGAAGCAGGGGTGTGAAAGGAATCTCA
TaSMXL20TGAAACCATACAAATTTTGAGAGGCATCCAGCTTCATCAATCAGGTCT
TaSMXL21TTCCGGGATAGGGTTGTTGACTAGGCACTCAGAGCAGGC
ActinCAGCAATGTATGTCGCAATCTAGCATGAGGAAGCGTGTAT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Z.; Jiang, Z.; Wan, H.; Chen, X.; Wu, H. Genome-Wide Identification of the SMXL Gene Family in Common Wheat and Expression Analysis of TaSMXLs Under Abiotic Stress. Agronomy 2025, 15, 656. https://doi.org/10.3390/agronomy15030656

AMA Style

Wang Z, Jiang Z, Wan H, Chen X, Wu H. Genome-Wide Identification of the SMXL Gene Family in Common Wheat and Expression Analysis of TaSMXLs Under Abiotic Stress. Agronomy. 2025; 15(3):656. https://doi.org/10.3390/agronomy15030656

Chicago/Turabian Style

Wang, Zunjie, Zhengning Jiang, Heping Wan, Xueyan Chen, and Hongya Wu. 2025. "Genome-Wide Identification of the SMXL Gene Family in Common Wheat and Expression Analysis of TaSMXLs Under Abiotic Stress" Agronomy 15, no. 3: 656. https://doi.org/10.3390/agronomy15030656

APA Style

Wang, Z., Jiang, Z., Wan, H., Chen, X., & Wu, H. (2025). Genome-Wide Identification of the SMXL Gene Family in Common Wheat and Expression Analysis of TaSMXLs Under Abiotic Stress. Agronomy, 15(3), 656. https://doi.org/10.3390/agronomy15030656

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop