Genome-Wide Identification of the SMXL Gene Family in Common Wheat and Expression Analysis of TaSMXLs Under Abiotic Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Identification and Chromosome Mapping of TaSMXL Family Members
2.2. Phylogenetic Analysis
2.3. Prediction of Gene Structure, Protein Conserved Motifs, and Promoter Cis-Acting Elements
2.4. Collinear Analysis of SMXL Gene
2.5. The Interaction Between MicroRNA and TaSMXL Target Genes
2.6. Transcriptome Expression Pattern Analysis
2.7. Materials and Treatments
2.8. Relative Expression of TaSMXL Under Different Abiotic Stresses
3. Results
3.1. Identification and Characterization of SMXLs in Common Wheat
3.2. Prediction of TaSMXL Protein Properties: Physical-Chemical Characteristics and Subcellular Localization
3.3. Phylogenetic Analysis of TaSMXL Proteins
3.4. Analysis of TaSMXL Family Structure, Conserved Motifs and Promoter Cis-Acting Elements
3.5. Collinearity Analysis of SMXL Gene Family
3.6. Analysis of Interaction Between Microrna and TaSMXL Target Genes
3.7. Analysis of Transcriptome Expression Pattern of TaSMXL
3.8. Detection of TaSMXL Expression Under Various Abiotic Stresses by qPCR Technique
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Seif El-Yazal, S.A.; Seif El-Yazal, M.A.; Dwidar, E.F.; Rady, M.M. Phytohormone crosstalk research: Cytokinin and its crosstalk with other phytohormones. Curr. Protein Pept. Sci. 2015, 16, 395–405. [Google Scholar] [CrossRef]
- Kohlen, W.; Charnikhova, T.; Liu, Q.; Bours, R.; Domagalska, M.A.; Beguerie, S.; Verstappen, F.; Leyser, O.; Bouwmeester, H.; Ruyter-Spira, C. Strigolactones are transported through the xylem and play a key role in shoot architectural response to phosphate deficiency in nonarbuscular mycorrhizal host Arabidopsis. Plant Physiol. 2011, 155, 974–987. [Google Scholar] [CrossRef] [PubMed]
- Waters, M.T.; Gutjahr, C.; Bennett, T.; Nelson, D.C. Strigolactone signaling and evolution. Annu. Rev. Plant Biol. 2017, 68, 291–322. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Wang, Y.; Li, J. Strigolactones. In Hormone Metabolism and Signaling in Plants; Academic Press: Cambridge, MA, USA, 2017; pp. 327–359. [Google Scholar]
- Seto, Y.; Kameoka, H.; Yamaguchi, S.; Kyozuka, J. Recent advances in strigolactone research: Chemical and biological aspects. Plant Cell Physiol. 2012, 53, 1843–1853. [Google Scholar] [CrossRef]
- Yoshimura, M.; Sato, A.; Kuwata, K.; Inukai, Y.; Kinoshita, T.; Itami, K.; Tsuchiya, Y.; Hagihara, S. Discovery of shoot branching regulator targeting strigolactone receptor DWARF14. ACS Cent. Sci. 2018, 4, 230–234. [Google Scholar] [CrossRef]
- Rasmussen, A.; Mason, M.G.; De Cuyper, C.; Brewer, P.B.; Herold, S.; Agusti, J.; Geelen, D.; Greb, T.; Goormachtig, S.; Beeckman, T. Strigolactones suppress adventitious rooting in Arabidopsis and pea. Plant Physiol. 2012, 158, 1976–1987. [Google Scholar] [CrossRef]
- López-Ráez, J.A.; Pozo, M.J. Chemical signalling in the arbuscular mycorrhizal symbiosis: Biotechnological applications. In Symbiotic Endophytes; Springer: Berlin/Heidelberg, Germany, 2013; pp. 215–232. [Google Scholar]
- Zwanenburg, B.; Blanco-Ania, D. Strigolactones: New plant hormones in the spotlight. J. Exp. Bot. 2018, 69, 2205–2218. [Google Scholar] [CrossRef]
- Umehara, M.; Hanada, A.; Yoshida, S.; Akiyama, K.; Arite, T.; Takeda-Kamiya, N.; Magome, H.; Kamiya, Y.; Shirasu, K.; Yoneyama, K. Inhibition of shoot branching by new terpenoid plant hormones. Nature 2008, 455, 195–200. [Google Scholar] [CrossRef]
- Domagalska, M.A.; Leyser, O. Signal integration in the control of shoot branching. Nat. Rev. Mol. Cell Biol. 2011, 12, 211–221. [Google Scholar] [CrossRef]
- Yao, R.; Ming, Z.; Yan, L.; Li, S.; Wang, F.; Ma, S.; Yu, C.; Yang, M.; Chen, L.; Chen, L. DWARF14 is a non-canonical hormone receptor for strigolactone. Nature 2016, 536, 469–473. [Google Scholar] [CrossRef]
- Liu, W.; Wu, C.; Fu, Y.; Hu, G.; Si, H.; Zhu, L.; Luan, W.; He, Z.; Sun, Z. Identification and characterization of HTD2: A novel gene negatively regulating tiller bud outgrowth in rice. Planta 2009, 230, 649–658. [Google Scholar] [CrossRef]
- Chevalier, F.; Nieminen, K.; Sánchez-Ferrero, J.C.; Rodríguez, M.L.; Chagoyen, M.; Hardtke, C.S.; Cubas, P. Strigolactone promotes degradation of DWARF14, an α/β hydrolase essential for strigolactone signaling in Arabidopsis. Plant Cell 2014, 26, 1134–1150. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Liu, X.; Xiong, G.; Liu, H.; Chen, F.; Wang, L.; Meng, X.; Liu, G.; Yu, H.; Yuan, Y. DWARF 53 acts as a repressor of strigolactone signalling in rice. Nature 2013, 504, 401–405. [Google Scholar] [CrossRef]
- Zhou, F.; Lin, Q.; Zhu, L.; Ren, Y.; Zhou, K.; Shabek, N.; Wu, F.; Mao, H.; Dong, W.; Gan, L. D14–SCFD3-dependent degradation of D53 regulates strigolactone signalling. Nature 2013, 504, 406–410, Corrected in: Nature 2016, 532, 402. [Google Scholar] [CrossRef] [PubMed]
- Agusti, J.; Herold, S.; Schwarz, M.; Sanchez, P.; Ljung, K.; Dun, E.A.; Brewer, P.B.; Beveridge, C.A.; Sieberer, T.; Sehr, E.M. Strigolactone signaling is required for auxin-dependent stimulation of secondary growth in plants. Proc. Natl. Acad. Sci. USA 2011, 108, 20242–20247. [Google Scholar] [CrossRef]
- Ruyter-Spira, C.; Kohlen, W.; Charnikhova, T.; van Zeijl, A.; van Bezouwen, L.; De Ruijter, N.; Cardoso, C.; Lopez-Raez, J.A.; Matusova, R.; Bours, R. Physiological effects of the synthetic strigolactone analog GR24 on root system architecture in Arabidopsis: Another belowground role for strigolactones? Plant Physiol. 2011, 155, 721–734. [Google Scholar] [CrossRef]
- Gomez-Roldan, V.; Fermas, S.; Brewer, P.B.; Puech-Pagès, V.; Dun, E.A.; Pillot, J.-P.; Letisse, F.; Matusova, R.; Danoun, S.; Portais, J.-C. Strigolactone inhibition of shoot branching. Nature 2008, 455, 189–194. [Google Scholar] [CrossRef]
- Wang, L.; Wang, B.; Jiang, L.; Liu, X.; Li, X.; Lu, Z.; Meng, X.; Wang, Y.; Smith, S.M.; Li, J. Strigolactone signaling in Arabidopsis regulates shoot development by targeting D53-like SMXL repressor proteins for ubiquitination and degradation. Plant Cell 2015, 27, 3128–3142. [Google Scholar] [CrossRef]
- Zhao, L.-H.; Zhou, X.E.; Yi, W.; Wu, Z.; Liu, Y.; Kang, Y.; Hou, L.; De Waal, P.W.; Li, S.; Jiang, Y. Destabilization of strigolactone receptor DWARF14 by binding of ligand and E3-ligase signaling effector DWARF3. Cell Res. 2015, 25, 1219–1236. [Google Scholar] [CrossRef]
- Soundappan, I.; Bennett, T.; Morffy, N.; Liang, Y.; Stanga, J.P.; Abbas, A.; Leyser, O.; Nelson, D.C. SMAX1-LIKE/D53 family members enable distinct MAX2-dependent responses to strigolactones and karrikins in Arabidopsis. Plant Cell 2015, 27, 3143–3159. [Google Scholar] [CrossRef]
- Stanga, J.P.; Morffy, N.; Nelson, D.C. Functional redundancy in the control of seedling growth by the karrikin signaling pathway. Planta 2016, 243, 1397–1406. [Google Scholar] [CrossRef]
- Stanga, J.P.; Smith, S.M.; Briggs, W.R.; Nelson, D.C. SUPPRESSOR OF MORE AXILLARY GROWTH2 1 controls seed germination and seedling development in Arabidopsis. Plant Physiol. 2013, 163, 318–330. [Google Scholar] [CrossRef]
- Wallner, E.-S.; Lopez-Salmeron, V.; Belevich, I.; Poschet, G.; Jung, I.; Grünwald, K.; Sevilem, I.; Jokitalo, E.; Hell, R.; Helariutta, Y. Strigolactone-and karrikin-independent SMXL proteins are central regulators of phloem formation. Curr. Biol. 2017, 27, 1241–1247. [Google Scholar] [CrossRef]
- Wu, Y.Y.; Hou, B.H.; Lee, W.C.; Lu, S.H.; Yang, C.J.; Vaucheret, H.; Chen, H.M. DCL2-and RDR6-dependent transitive silencing of SMXL4 and SMXL5 in Arabidopsis dcl4 mutants causes defective phloem transport and carbohydrate over-accumulation. Plant J. 2017, 90, 1064–1078. [Google Scholar] [CrossRef] [PubMed]
- Villaécija-Aguilar, J.A.; Hamon-Josse, M.; Carbonnel, S.; Kretschmar, A.; Schmidt, C.; Dawid, C.; Bennett, T.; Gutjahr, C. SMAX1/SMXL2 regulate root and root hair development downstream of KAI2-mediated signalling in Arabidopsis. PLoS Genet. 2019, 15, e1008327. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Wang, B.; Yu, H.; Guo, H.; Lin, T.; Kou, L.; Wang, A.; Shao, N.; Ma, H.; Xiong, G. Transcriptional regulation of strigolactone signalling in Arabidopsis. Nature 2020, 583, 277–281. [Google Scholar] [CrossRef] [PubMed]
- Moturu, T.R.; Thula, S.; Singh, R.K.; Nodzyński, T.; Vařeková, R.S.; Friml, J.; Simon, S. Molecular evolution and diversification of the SMXL gene family. J. Exp. Bot. 2018, 69, 2367–2378. [Google Scholar] [CrossRef]
- Bennett, T.; Liang, Y.; Seale, M.; Ward, S.; Müller, D.; Leyser, O. Strigolactone regulates shoot development through a core signalling pathway. Biol. Open 2016, 5, 1806–1820. [Google Scholar] [CrossRef]
- Lu, Y.F.; Yan, Y.X.; Qin, Y.H.; Chen, J.B.; Cheng, L.; Liu, F.; Tan, J. Genome-wide Identification and Potential Function Analysis of Maize Smxl Gene Family under Abiotic Stress. Mol. Plant Breed. 2025, 1–19. Available online: http://kns.cnki.net/kcms/detail/46.1068.S.20240929.1601.002.html (accessed on 3 March 2025).
- Kerr, S.C.; Patil, S.B.; de Saint Germain, A.; Pillot, J.P.; Saffar, J.; Ligerot, Y.; Aubert, G.; Citerne, S.; Bellec, Y.; Dun, E.A. Integration of the SMXL/D53 strigolactone signalling repressors in the model of shoot branching regulation in Pisum sativum. Plant J. 2021, 107, 1756–1770. [Google Scholar] [CrossRef]
- Li, R.; An, J.-P.; You, C.-X.; Wang, X.-F.; Hao, Y.-J. Genome-wide analysis and identification of the SMXL gene family in apple (Malus × domestica). Tree Genet. Genomes 2018, 14, 61. [Google Scholar] [CrossRef]
- Ma, H.; Duan, J.; Ke, J.; He, Y.; Gu, X.; Xu, T.-H.; Yu, H.; Wang, Y.; Brunzelle, J.S.; Jiang, Y. A D53 repression motif induces oligomerization of TOPLESS corepressors and promotes assembly of a corepressor-nucleosome complex. Sci. Adv. 2017, 3, e1601217. [Google Scholar] [CrossRef]
- Consortium, I.W.G.S.; Appels, R.; Eversole, K.; Stein, N.; Feuillet, C.; Keller, B.; Rogers, J.; Pozniak, C.J.; Choulet, F.; Distelfeld, A. Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 2018, 361, eaar7191. [Google Scholar] [CrossRef]
- Mohammadi, R. Efficiency of yield-based drought tolerance indices to identify tolerant genotypes in durum wheat. Euphytica 2016, 211, 71–89. [Google Scholar] [CrossRef]
- Bolser, D.M.; Staines, D.M.; Perry, E.; Kersey, P.J. Ensembl Plants: Integrating Tools for Visualizing, Mining, and Analyzing Plant Genomic Data. In Plant Genomics Databases: Methods and Protocols; Methods in Molecular Biology Series; van Dijk, A.D.J., Ed.; Humana: New York, NY, USA, 2017; pp. 1–31. [Google Scholar]
- Duvaud, S.; Gabella, C.; Lisacek, F.; Stockinger, H.; Ioannidis, V.; Durinx, C. Expasy, the Swiss Bioinformatics Resource Portal, as designed by its users. Nucleic Acids Res. 2021, 49, W216–W227. [Google Scholar] [CrossRef]
- Horton, P.; Park, K.J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S.; Battistuzzi, F.U. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Nei, M.; Kumar, S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. USA 2004, 101, 11030–11035. [Google Scholar] [CrossRef]
- Subramanian, B.; Gao, S.; Lercher, M.J.; Hu, S.; Chen, W.H. Evolview v3: A webserver for visualization, annotation, and management of phylogenetic trees. Nucleic Acids Res. 2019, 47, W270–W275. [Google Scholar] [CrossRef]
- Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef]
- Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Peer, Y.V.d.; Rouzé, P.R.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. Suppl. 2002, 30, 325–327. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Tang, H.; Debarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.H.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z. KaKs_Calculator 3.0: Calculating Selective Pressure on Coding and Non-coding Sequences. Genom. Proteom. Bioinform. 2022, 20, 536–540. [Google Scholar] [CrossRef] [PubMed]
- Yao, Y.; Guo, G.; Ni, Z.; Sunkar, R.; Du, J.; Zhu, J.-K.; Sun, Q. Cloning and characterization of microRNAs from wheat (Triticum aestivum L.). Genome Biol. 2007, 8, R96. [Google Scholar] [CrossRef]
- Ma, S.; Wang, M.; Wu, J.; Guo, W.; Chen, Y.; Li, G.; Wang, Y.; Shi, W.; Xia, G.; Fu, D.; et al. WheatOmics: A platform combining multiple omics data to accelerate functional genomics studies in wheat. Mol. Plant 2021, 14, 1965–1968. [Google Scholar] [CrossRef]
- Jiang, W.; Pan, R.; Buitrago, S.; Wu, C.; Abou-Elwafa, S.F.; Xu, Y.; Zhang, W. Conservation and divergence of the TaSOS1 gene family in salt stress response in wheat (Triticum aestivum L.). Physiol. Mol. Biol. Plants 2021, 27, 1245–1260. [Google Scholar] [CrossRef]
- Yu, X.; Han, J.; Wang, E.; Xiao, J.; Hu, R.; Yang, G.; He, G. Genome-Wide Identification and Homoeologous Expression Analysis of PP2C Genes in Wheat (Triticum aestivum L.). Front. Genet. 2019, 10, 561. [Google Scholar] [CrossRef]
- Zhang, H.; Wang, L.; Gao, Y.; Guo, Y.; Zheng, N.; Xu, X.; Xu, M.; Wang, W.; Liu, C.; Liu, W. Genome-wide identification of SMXL Gene family in soybean and expression analysis of GmSMXLs under Shade stress. Plants 2022, 11, 2410. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, C.; Rajaofera, M.J.N.; Zhu, L.; Liu, W.; Zheng, F.; Miao, W. WY7 is a newly identified promoter from the rubber powdery mildew pathogen that regulates exogenous gene expression in both monocots and dicots. PLoS ONE 2020, 15, e0233911. [Google Scholar] [CrossRef]
Gene Name | Forward Primer (5′→3′) | Reverse Primer (3′→5′) |
---|---|---|
TaSMXL1 | GCCTGGCGGAAAAGATGC | CTAGGCACTCAGAGCAGGC |
TaSMXL3 | GGAAGACAGTCTGGCGGA | CTAGGCACTCAGAGCAGGC |
TaSMXL9 | ATCGTTGATGTGGACCCG | CTAAACAGCGACCGCCG |
TaSMXL10 | TCCTTTTCGGCGAGTACAAG | TCAGAATGTCCGTGTTGAGTC |
TaSMXL12 | AGGAGGGCGACTCTGTC | CTATACAGCGACCGCCG |
TaSMXL13 | GCGAGGCGATTCTTTTCG | TCAGAATGTCCGTGTTGAGTC |
TaSMXL14 | GGTCAAAGAGGGCGACTC | CTATACAGCGACCGCCG |
TaSMXL15 | GCGAGGCGATTCTTTTCG | TCAGAATGTCCGTGTTGAGTC |
TaSMXL16 | CAGTGGTTTTGTGGCCGTT | GTTGTTTGGATCAGCGCCT |
TaSMXL18 | GCTTGCTCAAGAGGAAGCA | GGGGTGTGAAAGGAATCTCA |
TaSMXL20 | TGAAACCATACAAATTTTGAGAGGC | ATCCAGCTTCATCAATCAGGTCT |
TaSMXL21 | TTCCGGGATAGGGTTGTTGA | CTAGGCACTCAGAGCAGGC |
Actin | CAGCAATGTATGTCGCAATC | TAGCATGAGGAAGCGTGTAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Z.; Jiang, Z.; Wan, H.; Chen, X.; Wu, H. Genome-Wide Identification of the SMXL Gene Family in Common Wheat and Expression Analysis of TaSMXLs Under Abiotic Stress. Agronomy 2025, 15, 656. https://doi.org/10.3390/agronomy15030656
Wang Z, Jiang Z, Wan H, Chen X, Wu H. Genome-Wide Identification of the SMXL Gene Family in Common Wheat and Expression Analysis of TaSMXLs Under Abiotic Stress. Agronomy. 2025; 15(3):656. https://doi.org/10.3390/agronomy15030656
Chicago/Turabian StyleWang, Zunjie, Zhengning Jiang, Heping Wan, Xueyan Chen, and Hongya Wu. 2025. "Genome-Wide Identification of the SMXL Gene Family in Common Wheat and Expression Analysis of TaSMXLs Under Abiotic Stress" Agronomy 15, no. 3: 656. https://doi.org/10.3390/agronomy15030656
APA StyleWang, Z., Jiang, Z., Wan, H., Chen, X., & Wu, H. (2025). Genome-Wide Identification of the SMXL Gene Family in Common Wheat and Expression Analysis of TaSMXLs Under Abiotic Stress. Agronomy, 15(3), 656. https://doi.org/10.3390/agronomy15030656