Next Article in Journal
Differential Sensitivity of Maize Hybrids to Nicosulfuron
Next Article in Special Issue
Hidden Stigmas Enhance Heat Resilience: A Novel Breeding Trait for Sustaining Rice Spikelet Fertility Under Nocturnal Heat Stress
Previous Article in Journal
Characterization of APETALA2/Ethylene Responsive Factor Gene Family and Their Responses to Abiotic Stress in Pineapple (Ananas comosus)
Previous Article in Special Issue
The Effect of Silicon–Melatonin Nanoparticles on Improving Germination Parameters and Reducing Salinity Toxicity by Maintaining Ion Homeostasis in Cyamopsis tetragonoloba L. Seedlings
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 15
Issue 3
10.3390/agronomy15030556
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Changes of Catalase and Peroxidase Activity and Expression Under Cold Stress in Prunus persica Cultivars with Different Cold Tolerances

by
Ekaterina Vodiasova
1,2,*,
Elina Chelebieva
1,2,
Ekaterina Kladchenko
2,
Oksana Grebennikova
1,
Victoria Uppe
1,2,
Valentina Tsiupka
1,
Sergey Dolgov
1,3 and
Anatoly Smykov
1
1
Federal State Funded Institution of Science “The Labor Red Banner Order Nikita Botanical Gardens—National Scientific Center of the RAS”, Nikita, 298648 Yalta, Russia
2
A.O. Kovalevsky Institute of Biology of the Southern Seas of RAS, RAS, 299011 Moscow, Russia
3
Branch of Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, 142290 Puschino, Russia
*
Author to whom correspondence should be addressed.
Agronomy 2025, 15(3), 556; https://doi.org/10.3390/agronomy15030556
Submission received: 20 January 2025 / Revised: 19 February 2025 / Accepted: 21 February 2025 / Published: 25 February 2025
(This article belongs to the Special Issue Plant Ecophysiology Under Anthropogenic and Natural Stresses)
Browse Figures
Versions Notes

Abstract

:
Peach is one of the most common stone fruit crops, but it is also the most thermophilic. One of the main problems in peach cultivation is frost up to −8 °C in spring during pollen development, budding, and flowering. The adaptation of the plant to low temperatures could be related to the activation of the antioxidant system under cold stress. The aim of this work was to test the hypothesis of distinct adaptation mechanisms to cold stress in Prunus persica L. cultivars with various cold tolerances. The difference between this study and the previous ones is that previously, only contrasting varieties (resistant and sensitive) were studied. For the first time, we studied the effect of cold stress on cold-resistant varieties but with different degrees of resistance, such as “Loadel” and “Springold” (medium resistant) and “Podarok Like” and “Temisovskij” (highly resistant). The experiment was designed to simulate the effects of short-term cold snaps, which are a common occurrence during February and March in the south of Crimea. A series of tests were conducted on annual shoots that were frozen at −12 °C. The activity and gene expression of two major antioxidant enzymes, catalase and peroxidase, were studied by spectrophotometry and RT-qPCR, respectively. The experiment showed that these enzymes responded differently to cold stress in varieties with different cold tolerances. Catalase responded similarly in all four varieties. After frost, there was an increase in activity (7-fold in “Temisovskij” and 3-fold in “Podarok Like”) and a decrease in expression. In contrast to catalase, peroxidase showed an opposite response to cold stress in medium-tolerant and highly tolerant cultivars. Peroxidase activity after exposure to low temperatures increased in highly tolerant cultivars (1.5-fold in “Temisovskij”), while it decreased in medium-tolerant cultivars (1.5–2 fold in “Springold” and “Loadel”, respectively). The change in peroxidase expression was the opposite. It decreased in highly resistant varieties and increased in medium-resistant varieties. Thus, our results revealed the opposite response of one of the major antioxidant enzymes (peroxidase) in moderately resistant and highly resistant cultivars. The data obtained show that varieties with a high degree of resistance could have other adaptation mechanisms involved, which may be useful for selecting resistant varieties.

1. Introduction

Prunus persica L. (peach) is one of the widespread stone fruit crops in the world and is characterized by high yield, early maturity, and dessert fruits containing microelements and biologically active substances. According to the FAO, in 2023, the production of peach fruits was about 27.1 million tons around the world (https://www.fao.org/faostat, accessed on 31 January 2025), and it is grown in more than 70 countries [1,2,3]. Among stone fruit crops, peach is the most thermophilic, with a long growing season and a short, deep dormancy period [3,4,5]. The minimum temperatures are the limit of its cultivation from −17 °C to −28 °C [3,6,7,8]. One of the main problems in peach growing is the spring cold snap, which can be accompanied by a brief drop in temperature from −6 °C to −8 °C during the pollen development phase [9,10], budding, and flowering [7,11,12]. One of the main causes of yield loss in peaches is the death of the flower buds [5,13], which could be related to the decrease in the temperature resistance of the buds during the formation of male gametophytes and the intensification of growth processes [3,14]. Therefore, many works have been devoted to the morphogenetic characteristics of the flower buds of peaches and their degree of frost resistance [14,15,16,17,18]. The degree of cold tolerance is determined by a complex of biochemical processes, some of which are hormone dependent, and others are related to enzyme activity [3].
Exposure to low temperatures can have several negative effects on plants, including a decrease in photosynthetic rate, a deterioration in cell membrane permeability, the dissociation of protein complexes, and the development of oxidative stress. This stress is caused by the overproduction of reactive oxygen species (ROS) [19,20,21]. Among the many ROS, hydrogen peroxide (H2O2) has attracted the most attention from researchers [22,23,24]. At low levels, ROS act as signaling molecules that play a role in metabolic responses to adapt to stressful environmental conditions, including cold stress [25,26]. However, when ROS accumulate in excess, they can cause damage to membrane lipids, proteins, and nucleic acids, leading to cell death [22,27].
To compensate for the production of ROS, plants activate key antioxidant defense enzymes [28,29]. These enzymes, such as peroxidase (POD) and catalase (CAT), are the main active systems for preventing oxidative damage in plants caused by excessive H2O2 production [3]. They convert H2O2 into H2O and O2, preventing the harmful effects of the molecule. The activity levels of these enzymes are also used as an indicator to assess the cold tolerance of fruit trees [12]. The increased activity of antioxidant enzymes (catalase, superoxide dismutase (SOD), peroxidase) could provide high tolerance to cold stress in plants [30].
Many previous studies have been carried out on peach cultivars with different cold tolerances. Some of the studies have focused on the effects of the postharvest temperature on peach fruits [31,32,33,34], while others have studied seasonal changes in the activity and expression of antioxidant enzymes [35,36]. Most of the work has been devoted to comparing the effects of cold stress on cold-sensitive cultivars (chilling requirements CR < 450) and medium-tolerant cultivars (CR to 850), revealing a difference in response to this stress between cultivars [37,38,39]. Therefore, although previous studies have analyzed cold responses in sensitive and resistant cultivars, no research has been conducted on how differences in cold tolerance within resistant cultivars influence antioxidant mechanisms.
Plant adaptation to low temperatures involves complex molecular and biochemical changes that activate various genetic mechanisms. Studying the peculiarities of the antioxidant complex enzyme’s functioning in frost-resistant varieties can help us understand the mechanisms that provide frost tolerance in order to develop strategies for improving crop tolerance to climate change. At the same time, it was hypothesized that varieties with different degrees of resistance would respond differently to cold stress. The identification of such differences may help us understand the process of formation of high tolerance in plants to cold stress. The aim of this study was to investigate the effect of cold stress on key antioxidant enzyme activity (CAT and POD) in peaches with different levels of cold tolerance. Changes in their activity were analyzed to determine common mechanisms of responses to cold stress among varieties with similar levels of tolerance.

2. Materials and Methods

2.1. Sample Collection

The following flower buds of the following cultivars of P. persica were selected as the study subjects: “Loadel” and “Spring Gold” (medium tolerant, MT), “Podarok Like” and “Temisovskij” (HT). All of these cultivars are grown in the collections of the Nikita Botanical Garden [40]. The location of the study site is 44°51′35″ N, 34°23′16″ E. The site is located at an elevation of 208 m above sea level.

2.2. The Main Characteristics of the Cultivars

The selection of cultivars for the experiment was based on the analysis of the degree of cold tolerance. The level of frost resistance was determined by the direct freezing of peach flower buds in the dynamics of the winter–spring period. The material for the experiment was collected in January, February, and March. Experiments were conducted in a Memmert TTS 256 climatic test chamber (Memmert, Büchenbach, Germany). The annual shoots were quenched at 0 °C for 6 h. Exposure to the investigated temperature (Table 1) was 12 h. The gradient of temperature change in the chamber was 2 °C per hour, and humidity was about 50% without the control of the length of day and night and the photon flux. Since buds of the Podarok Like and Temisovskij varieties are significantly less damaged by frost during different periods of the cold season, we assigned these varieties to the group of resistant genotypes (Table 1). Loadel and Spring Gold varieties showed low and medium levels of damage, which was the basis for grouping them into the group of medium-tolerant varieties (MTs).

2.2.1. “Loadel”

The cultivar was originated in 1950 by Howard H. Harter in Yuba City, California, USA from free pollination of the cultivar Lovell. It was introduced to the Nikita Botanical Gardens in 1975. It is a bell-shaped flower. Fruits are round and medium sized (115 g) with carmine blush (25–50% of the fruit surface) on the yellow background. The flesh has a bright yellow color, is juicy, and has an aromatic flavor. The fruit ripens in the third week of June to the first week of July [42]. It is a medium cold-tolerant cultivar (CR = 850) (https://fps.ucdavis.edu, accessed on 8 December 2024).

2.2.2. “Springold”

The cultivar originated in Fort Valley, Ga., by U.S. Hort. Lab. It was introduced in 1966 as a result of crossing the cultivars [(Fireglow × Hiley) × Fireglow] × Springtime. The fruits are medium sized (120–170 g or more) with a bright red skin and slightly elongated shape. The flesh is bright yellow, juicy, and aromatic. The fruit ripens in the third week of June to the first week of July [43]. It is a medium cold-tolerant cultivar (CR = 850) (https://www.clemsonpeach.org, accessed on 8 December 2024).

2.2.3. “Podarok Like”

The cultivar originated in the Nikita Botanical Gardens by V.K. Smykov, T. A. Lacko, Z. N. Perfilieva, A. V. Smykov, and O. S. Fedorova. The flowers are bell shaped. The fruits are medium sized, averaging 135 g and reaching up to 180 g in some years, with a broad-oval shape. The flesh is yellow with a pink cavity, exhibiting a fibrous consistency and a pleasant harmonious taste, rated at 4.6 points. The seed is medium sized and closely adheres to the pulp. The fruit ripens in the second–third week of July. It is a highly cold-tolerant cultivar [41].

2.2.4. “Temisovskij”

The cultivar originated in the Nikita Botanical Garden by Z.N. Perfilieva, A.V. Smykov, V.K. Smykov, and T.A. Lacko as a result of crossing the cultivars Perekopsky Large and Cardinal. It was listed in the Register of Breeding Achievements of the Russian Federation and accepted for use. The flowers are bell shaped. The fruits are round and medium sized (125 g). The main color is yellow and the covering color is red to burgundy, occupying 75–100% of the fruit surface. The flesh is yellow, fibrous, and dense. Fruits ripen in the 1st week of August. It is a highly cold-tolerant cultivar [41].

2.3. Experimental Design

According to data from the Food and Agriculture Organization, Crimea is one of the coldest regions for peach cultivation (https://www.fao.org/faostat/en/#home, accessed on 31 January 2025). In this regard, modeling the experiment was based on the climatic features of Crimea. The temperature regime selected for this study (−12.0 °C) is conditioned by both the temperature of the absolute minimum of the southern coast of Crimea, which is −12.3 °C in February and −11.1 °C in March, and there is a probability of similar frosts in Crimea [44].
A series of experiments on artificial freezing of annual shoots for 12 h at a temperature close to the most severe decrease in the period of spring frosts on the southern coast of Crimea at −12 °C were performed. The experiments were conducted in a Vötsch VT 4004 climatic chamber (Vötsch Industrietechnik GmbH, Reiskirchen, Germany) during the period of maximum probability of return frosts (the first week of March).
All shoots were cut simultaneously and immediately placed in a climatic chamber for acclimatization at 4 °C for 12 h with a humidity of about 50%. Immediately after acclimatization, a part of the samples was taken as a control group (unstressed plants). Then, cold stress was started according to the following scheme: pre-hardening at 0 °C for 4 h, temperature reduction to −12 °C (the gradient of temperature change in the chamber was 2 °C per hour), and exposure at −12 °C for 12 h. After stressing, sampling was carried out as an experimental group. Freezing was carried out in a climatic chamber without lighting (shoots have no leaves, kidney scales of flower buds are closed). Exposed shoots were not immersed in the solution. The work was performed according to the methods generally accepted for fruit crops [45].
For inner structure analysis and evaluating the tissue condition, flower buds were cut from shoots with a scalpel handle, bisected, and investigated under a stereomicroscope, SMT745T (Nikon, Tokyo, Japan), equipped with an Industrial Digital Camera (5.1MP 1/2.5″ Color, Aptina CMOS Sensor, Micron Technology Inc, Boise, ID, USA) and ImageView v2.91 software.
For analysis of the activity of antioxidant enzymes under cold stress, we measured the activity and expression of the peroxidase and catalase in the flower buds. Three trees of each cultivar were selected for the experiment. Six shoots were selected from each tree. Thus, there were 9 biological repetitions each in control and under cold stress groups. Flower buds were taken from each shoot for analysis.

2.4. Antioxidant Enzyme Activity Assay

Enzyme activities were determined using standard spectrophotometric and biochemical methods [46,47]. The extraction for biochemical analysis was carried out on the ice (0–+4 °C). All reactions were performed with three technical replicates.
The catalase activity (EC 1.11.1.6) was determined using the permanganate method. A sample of flower buds (0.2 g) was homogenized in distilled water, filtered, and incubated with a 0.3% solution of hydrogen peroxide for 10 min. Incubation was ceased by adding 10% sulfuric acid. Undecomposed hydrogen peroxide was titrated with 0.05 N of the solution of KMnO4 until the appearance of a weakly pink color. The activity of catalase was expressed in the amount of O2, which was formed due to the activity of the enzyme for 1 min per 1 g of raw material (mL O2 · g−1 · min−1).
Peroxidase activity (EC 1.11.1.6) was determined spectrophotometrically by the benzidine oxidation reaction rate, and polyphenol oxidase was determined colorimetrically in the presence of pyrocatechin and p-phenylenediamine. A sample of flower buds (0.5 g) was homogenized in acetate buffer (pH = 4.7) and transferred to a measuring flask with distilled water (25 mL) and filtered. The reaction mixture of the experimental cuvette contained 2 mL of extract, 2 mL of benzidine solution on acetate buffer (100 mL water, 2.3 mL glacial acetic acid, 184 mg benzidine, and 5.45 g sodium acetic acid with 200 mL of water), and 2 mL of water. For the control, 2 mL of water was added, while the experimental sample received an additional 2 mL of a 3% hydrogen peroxide solution. The dynamics of optical density were measured using a KFK-2 photoelectrocolorimeter at a wavelength of 590 nm. The activity of peroxidase was expressed in units of optic density per 1 g of crude mass per 1 s (D670 · g−1 · s−1).

2.5. Total RNA Isolation and cDNA Synthesis

Total RNA was extracted from plant samples using an innuPREP RNA Mini Kit (Analytik Jena, Jena, Germany). There were 9 biological repetitions for each group (control and experimental). One sample contained 5 flower buds. A total of 90 flower buds for each cultivar were selected for analysis. RNA purity and integrity were assessed using the A260/A280 absorbance ratio and stained with ethidium bromide in a 1.5% agarose gel. cDNA was synthesized from 500 ng of purified total RNA using MMLV Reverse Transcriptase (Evrogen, Moscow, Russia) following the manufacturer’s protocol. The cDNA synthesized was used as a template.

2.6. Expression of Some Peroxidases and Catalases Based on RT-PCR

Both peroxidase and catalase have duplications in the peach genome. Two catalase genes, CAT1 (AJ496418) and CAT2 (AJ496419), have been identified in P. persica. Since it is unknown whether these genes have specific functions, primers complementary to the conserved region in the two genes were designed to estimate the total expression of both genes, CAT1 and CAT2 (Table 2). Sixty genes encoding peroxidases have been identified in the peach genome, and it has been shown that POD genes can be divided into two groups: highly and weakly expressed [48]. In our study, we analyzed the gene expression of POD15 (low-expression group) and POD31, PODA2, and POD4 (high-expression group). These genes were chosen because some of them have previously been shown to increase under cold stress in varieties with medium resistance (CR from 700 to 850) [36,37,38,39].
Quantitative real-time PCR analysis (RT-qPCR) was performed on a LightCycler® 96 Instrument (Roche, Basel, Switzerland) using a qPCRmix-HS kit with SYBR GreenI (Evrogen, Moscow, Russia). The reaction mixture (total volume 15 μL) contained 1 μL of cDNA and 0.4 μM of each primer. The reaction conditions consisted of an initial denaturation at 95 °C for 3 min, followed by 50 cycles of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 15 s. Melting curve data were collected at 65–95 °C (0.5 °C/s). All reactions were performed with three technical replicates. For each run, a negative control without a template was included.
ACT and GAPDH were used as reference genes for real-time PCR analyses. The primers utilized in this study were developed based on genomic data. All gene-specific primer sequences are provided in Table 2.
The data analysis was carried out using Roche software v.1.1. Efficiencies of amplifications were determined by running a standard curve with serial dilutions of cDNA. For each measurement, a threshold cycle value (Cq) was determined as the fractional cycle number at which the fluorescence passes the fixed threshold. The descriptive statistics of the expression levels were computed for each candidate reference gene using the software package BestKeeper v.1 [51]. The relative expression levels of each target gene were normalized by calculating the geometric mean of the ACT and GAPDH genes using the ΔΔCt comparative method [52].

2.7. Statistics

Nine biological replicates were used for these investigations. Statistical data analysis was performed using R Studio version 4.4.1. The normality of the data was tested using the Shapiro–Wilk Test. The data were presented as mean ± standard error. Data were analyzed by two-way ANOVA followed by a Bonferroni post hoc multiple comparison test. Differences were considered significant if p-value ≤ 0.05. The ggstatsplot R package was used for Pearson correlation analysis between antioxidant enzyme activity and antioxidant gene expression. The results were produced using the ggplot2 R package v.4.4.1.

3. Results

A statistical evaluation was conducted to assess the impact of cold stress on peach varieties and their antioxidant capacity. The results of the two-way ANOVA are presented in Table 3.

3.1. Phenotypical Analyse

Closed flower buds of the four P. persica cultivars were investigated (Figure 1).
All investigated flower bud structures in the control were typical for the genus Prunus and included sepals, receptacles with corollas, pistils, and stamens (double perianth). The petal color was pink, the pistil and filament were green, and the anthers were yellow. Under the influence of low temperatures, the morphology of some flower bud structural parts was changed. In cv. “Loadel”, petals, anthers, and pistils could acquire a brown color, which was evidence of tissue damage.

3.2. Biochemical Analyse

In the control, the catalase activity of peach flower buds’ petals ranged from 0.95 mL O2/g · min to 6.8 mL (Figure 2, Table S1). After exposure to low temperatures for 12 h, catalase activity significantly increased in cv. “Temisovskij”, “Loadel”, and “Podarok Like”. This enzyme activity tended to be upregulated in cv. “Springold”.
In the control, the peroxidase activity in the peach flower buds varied from 0.049 to 0.103 a.u./g · s (Figure 3, Table S1). After exposure to low temperatures, enzyme activity increased in cultivars “Podarok Like” and “Temisovskij” and decreased in cultivars “Loadel” and “Springold”.

3.3. Gene Expression

Cold stress had a significant impact on the gene expression levels of CAT across all of the studied peach cultivars (Figure 4, Table S1). In the “Temisovskij”, “Podarok Like”, and “Springold” cultivars, cold stress was associated with decreased CAT expression. However, the changes were not significant in the “Loadel” cultivars.
Cold stress had no significant effect on the level of gene expression of POD in “Podarok Like” (Figure 5, Table S1). However, a decrease in gene expression levels was observed in cultivars resistant to cold, such as “Temisovskij”, which showed a statistically significant reduction in the expression of the POD4 gene. In contrast, MT cultivars, such as “Springold” and “Loadel”, showed an increase in the PODA2 gene.

3.4. Correlation Analysis

The correlation was further investigated by calculating Pearson’s product–moment correlation coefficient (p < 0.05), and a correlogram (Figure 6) was created to verify the strength of associations between the activity of antioxidant enzymes and the expression of antioxidant genes in Prunus persica. It has been demonstrated that CAT activity has a negative correlation with POD activity in “Springold” and “Loadel”, while CAT activity continues to have a positive correlation with POD in “Temisovskij”. Additionally, PODA2 has a positive correlation with PODA4.

4. Discussion

The phenomenon of cold stress, often observed in winter and spring [8,9,10], can cause oxidative damage to the developing flower buds. The aim of our study is to investigate the activities of the enzymes CAT and POD, as well as their gene expression, in order to understand their role in the antioxidant defense mechanism of peaches. CAT and POD are important antioxidant enzymes that prevent lipid peroxidation [3]. In this study, we first carried out a comparative study of the effect of cold on the activity level and gene expression of these enzymes in cold-tolerant cultivars with different levels of resistance, such as the medium-tolerant “Loadel” and “Springold” (MT) and the highly tolerant “Podarok Like” and “Temisovskij” (HT).
Analysis of phenotypic changes did not reveal severe bud damage, which is expected for varieties with medium to high cold tolerance. However, our results showed that the antioxidant system responded differently to cold stress in HT and MT varieties (Figure 7).
In our study, catalase activity was found to be significantly increased in both MT and HT peach cultivars after short-term exposure to cold stress. A similar result was obtained previously showing that increased activity of antioxidant enzymes is responsible for high tolerance to cold stress [30]. It is likely that the increased activity of catalase in our study plays a key role in protecting plant cells from the damaging effects of ROS. On the other hand, the evaluation of the catalase expression level showed an opposite trend compared to the biochemical analysis. The catalase expression significantly decreased 7-fold in the highly cold tolerant cultivar “Temisovskij” and 3-fold in “Podarok Like”, whereas the decrease was less pronounced in the MT cultivars (Figure 4). In other studies on the effect of cold on medium-tolerant peach cultivars similar to “Springold” and “Loadel”, no significant expression changes were observed based on transcriptomic data, which is consistent with our results [37,38,39]. Similar inhibition of CAT antioxidant defense was observed after 48 h at 4 °C in Ocimum basilicum L. [53], as was the case for cold stress exposure in the sensitive cultivar (ILC533) Cicer arietinum [54]. Also, catalase is duplicated in plants, and it has been shown that different catalase genes can have specific functions. This has been shown for Arabidopsis thaliana [55], barley [56], cotton [57], pepper [58], and others. As mentioned above, two catalase genes have been identified in the peach genome. CAT1 exhibits high levels of expression exclusively in leaf tissues and responds to changes in light and season. In contrast, CAT2 shows high activity in shoots in vitro and responds to seasonal changes but not to light. CAT1 is thought to be more involved in photorespiration, whereas CAT2 is involved in the stress response [59]. Data on the expression pattern of these genes in flower buds or under cold stress have not been studied, so the total expression of CAT1 and CAT2 was analyzed in this study. Which catalase contributes more to the response to cold stress is unknown and requires further research.
All varieties showed an increase in catalase activity with a simultaneous decrease in total gene expression. This could be explained by the fact that in resistant cultivars under short-term cold stress, the level of enzymes is sufficient to activate only the biochemical defense mechanism, which is confirmed by the increase in activity. A decrease in expression may be due to a switch to other pathways during the continuation of the stress effect and, accordingly, the lack of need to maintain a high level of expression of this enzyme. It is also likely that the increase in expression occurs only in the first hours after stress for a rapid response, which requires more detailed studies.
Analysis of the level of peroxidase activity and expression of four genes encoding peroxidase revealed patterns that differed depending on the variety’s cold tolerance. Peroxidase (POD or PRX, EC number 1.11.1.7) plays two important roles in plants: development and growth (1) and stress responses and resistance to abiotic and biotic factors (2) [60,61]. It is suggested that peroxidase activity could be a biochemical indicator of stress [62]. The evolution of peroxidase is inextricably linked to duplications, and some plants have a lot of genes encoding this enzyme (for example, Oryza sativa japonica has 138 PODs) [63]. Duplication of genes can lead to their paralogization and subfunctionalization, which is one of the evolutionary mechanisms of adaptation. Such a process is observed for peroxidase genes that differ in expression patterns under different conditions. Some POD genes in B. pendula demonstrated different gene expressions under low-temperature conditions [64]. The specific role of various genes of this family has been proven in works on the creation of transgenic plants [65,66]. We also obtained the differences in peroxidase gene expression profiles, which is probably explained by the fact that it is a multigenic family. It was shown earlier that gene expression has a strong individual variability, so it is necessary to assess the expression of several genes at once [48].
In the present study, a decrease in peroxidase activity and an increase in the expression level of PODA2 were observed in the varieties “Springold” and “Loadel”. Such an increase in the expression of some genes encoding peroxidase under cold stress was found in varieties with similar cold tolerance. The expression of POD31 and PODA2 increased after cold stress at −25 °C for 48 h in peach cv. “Cold Princess” [37]. Peroxidase 4 was found to be upregulated in peach cv. “Donghe No. 1” in response to cold, particularly at −30 °C [39]. Peroxidase 5 was also upregulated in peach cv. “Xiahui 6” treated at −2 °C for 26 h [38]. Thus, cultivars with intermediate cold tolerance showed an increase in some encoded POD genes upon exposure to cold. At the same time, no peroxidase gene was identified with significantly reduced expression (according to our results and literature data).
In contrast to MT cultivars, HT cultivars tended to increase in POD activity with a simultaneous decrease in the POD gene expressions. The expression of some peroxidase genes tended to increase (POD15, PODA2), and others tended to decrease (POD4, POD31) in “Podarok Like”. This variety is intermediate in resistance between “Sprigold”/”Loadel” and “Temissovskij”. On the other hand, peroxidase activity also increased in the highly resistant variety “Temisovskij” against a background of inhibition of the expression level of POD15, POD31, and POD4. The PODA2 gene also showed a tendency to decrease its expression level.
Thus, we observe the same reaction: the increase in catalase activity in resistant varieties (MT as well as HT) is accompanied by a decrease in the expression of coding genes. Probably, the cold level for these resistant varieties was not close to critical, so after a rapid response to the stress factor (first 12 h), there was a normalization and, accordingly, a decrease in expression. At the same time, peroxidase in MT varieties shows an opposite response to cold stress. There is a cumulative decrease in activity, and as a result, there is an activation of the expression of coding genes.
As discussed above, the reduction in antioxidant burden during oxidative stress could be explained by a compensatory response aiming to redistribute energy resources for adaptive mechanisms. However, this would result in oxidative damage to cellular components, which contradicts the previously established resistance of the varieties. The inhibition of antioxidant defenses in these varieties would be expected to be associated with a reduced oxidative burden under cold stress conditions. It is known that NO donors, such as sodium nitroprusside treatment, can induce chilling tolerance by increasing the AOX protein expression and activity of peach fruits [67,68]. The alternative oxidase pathway safeguards the balance between respiration and other metabolic processes by converting intracellular oxygen and water into the H2O molecule and preventing the blockage of electron flow. Del-Saz et al. (2018) and Wang et al. (2011) provided evidence that AOX plays a crucial role in reducing the production of ROS in plant tissues under stress conditions [69,70].
The findings of our study indicate that the antioxidant activity level of MT cultivars exhibits a notable increase following exposure to cold stress. This should be attributed to an elevation in the concentration of ROS within cells. Enhanced electron transport across the mitochondrial membrane through the cytochrome pathway results in augmented production of ROS. This represents a response aimed at expeditious adaptation to unfavorable environmental factors. However, prolonged exposure to such factors can precipitate plant exhaustion.

5. Conclusions

The response of antioxidant enzymes to cold stress was studied for the first time in cultivars not contrasting in resistance but in cultivars with different degrees of resistance, such as “Temisovskij”, “Podarok Like”, “Springold”, and “Loadel”. The opposite reactions of peroxidase to short-term frost were shown. The peroxidase activity decreased and the expression of three peroxidase genes increased in moderately resistant varieties, which could be a manifestation of a compensatory mechanism when the cold threshold is reached in these varieties. The organism tries to compensate for the low enzyme activity and neutralize the effect of the stress factor. In highly resistant varieties, probably the critical threshold of cold exposure was not reached, so we observed a different reaction of peroxidase. Moreover, the characteristics of the expression of the antioxidant complex genes in varieties with different cold tolerances showed that there are peculiarities in the functioning of POD genes, and the study of duplications in the context of the tolerance of varieties to different negative factors is promising. The data obtained may be useful for understanding cold-resistance mechanisms and selecting resistant peach cultivars.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy15030556/s1, Table S1. Antioxidant enzyme activity. Average ± SE are reported. Table S2. Antioxidant gene expression. Average ± SE are reported.

Author Contributions

Conceptualization, E.V.; methodology, E.V. and V.T.; formal analysis, O.G, E.V. and E.K.; investigation, V.U., E.V., A.S., V.T. and O.G.; resources, A.S.; writing—original draft preparation, E.V., E.C., V.T., V.U., A.S., S.D. and E.K.; writing—review and editing, E.V. and E.K.; visualization, E.K.; supervision, S.D. All authors have read and agreed to the published version of the manuscript.

Funding

The study is supported by the Kurchatov Genomic Centre of the NBG–NSC (075-15-2019-1670).

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Mrázová, M.; Rampáčková, E.; Šnurkovič, P.; Ondrášek, I.; Nečas, T.; Ercisli, S. Determination of Selected Beneficial Substances in Peach Fruits. Sustainability 2021, 13, 14028. [Google Scholar] [CrossRef]
  2. Iglesias, I.; Echeverria, G. Current situation, trends and challenges for efficient and sustainable peach production. Sci. Hortic. 2022, 296, 110899. [Google Scholar] [CrossRef]
  3. Niu, R.; Zhao, X.; Wang, C.; Wang, F. Physiochemical responses and ecological adaptations of peach to low-temperature stress: Assessing the cold resistance of local peach varieties from Gansu, China. Plants 2023, 12, 4183. [Google Scholar] [CrossRef] [PubMed]
  4. Luna, V.; Reinoso, H.; Lorenzo, E.; Bottini, R.; Abdala, G. Dormancy in peach (Prunus persica L.) flower buds: II. Comparative morphology and phenology in floral and vegetative buds, and the effect of chilling and gibberellin A 3. Trees 1991, 5, 244–246. [Google Scholar] [CrossRef]
  5. Hillmann, L.; Elsysy, M.; Goeckeritz, C.; Hollender, C.; Rothwell, N.; Blanke, M.; Einhorn, T. Preanthesis changes in freeze resistance, relative water content, and ovary growth preempt bud phenology and signify dormancy release of sour cherry floral buds. Planta 2021, 254, 74. [Google Scholar] [CrossRef]
  6. Linden, L. Measuring Cold Hardiness in Woody Plants. Ph.D. Thesis, Department of Applied Biology, University of Helsinki, Helsinki, Finland, 2002. Publication No. 10. [Google Scholar]
  7. Chaar, J.E. Characterization of Peach [Prunus persica (L.) Batsch.] Cultivars for Frost Resistance. Acta Agronómica 2015, 64, 230–237. [Google Scholar] [CrossRef]
  8. Elmanova, T.S.; Opanasenko, N.E. Ecological and Physiological Characteristics of Peach; Agrarian Science: Moscow, Russia, 2010; pp. 17–54. (In Russian) [Google Scholar]
  9. Strimbeck, G.R.; Schaberg, P.G.; Fossdal, C.G.; Schröder, W.P.; Kjellsen, T.D. Extreme low temperature tolerance in woody plants. Front. Plant Sci. 2015, 6, 884. [Google Scholar] [CrossRef]
  10. Torres, E.; Miarnau, X. Frost Damage Mitigation in Flowers and Fruitlets of Peach and Almond from the Application of a Multi-Attribute Approach Biostimulant. Plants 2024, 13, 1603. [Google Scholar] [CrossRef]
  11. Drepper, B.; Bamps, B.; Gobin, A.; Van Orshoven, J. Strategies for managing spring frost risks in orchards: Effectiveness and conditionality—A systematic review protocol. Environ. Evid. 2021, 10, 32. [Google Scholar] [CrossRef]
  12. Ding, A.; Bao, F.; Ding, A.; Zhang, Q. Cold hardiness of prunus mume ‘Xiang ruibai’and its parents based on biological indexes and physical parameters. Forests 2022, 13, 2163. [Google Scholar] [CrossRef]
  13. Palonen, P.; Buszard, D. Current state of cold hardiness research on fruit crops. Can. J. Plant Sci. 1997, 77, 399–420. [Google Scholar] [CrossRef]
  14. Szalay, L.; Gyökös, I.G.; Békefi, Z. Cold Hardiness of Peach Flowers at Different Phenological Stages. Hort. Sci. 2018, 45, 119–124. [Google Scholar] [CrossRef]
  15. Layne, R.E.C. Cold hardiness of peaches and nectarines following a test winter. Fruit Var. J. 1982, 36, pp 90–98. [Google Scholar]
  16. Meng, Q.R.; Liang, Y.Q.; Wang, W.F.; Du, S.H.; Li, Y.H.; Yang, J.M. Study on Supercooling Point and Freeezing Point in Floral Organs of Apricot; Agricultural Sciences in China: Beijing, China, 2007; Volume 6, pp. 1330–1335. [Google Scholar]
  17. Gorina, V.M.; Richter, A.A.; Zaitsev, G.P. Response of generative buds of apricot plants to artificial freezing. Statistica 2012, 5, 6. (In Russian) [Google Scholar]
  18. Halász, J.; Hegedűs, A.; Karsai, I.; Tósaki, Á.; Szalay, L. Correspondence between SOC1 Genotypes and Time of Endodormancy Break in Peach (Prunus persica L. Batsch) Cultivars. Agronomy 2021, 11, 1298. [Google Scholar] [CrossRef]
  19. Zhang, W.; Zhang, H.; Ning, L.; Li, B.; Bao, M. Quantitative Proteomic Analysis Provides Novel Insights into Cold Stress Responses in Petunia Seedlings. Front. Plant Sci. 2016, 7, 136. [Google Scholar] [CrossRef]
  20. Bai, M.; Zeng, W.; Chen, F.; Ji, X.; Zhuang, Z.; Jin, B.; Wang, J.; Jia, L.; Peng, Y. Transcriptome expression profiles reveal response mechanisms to drought and drought-stress mitigation mechanisms by exogenous glycine betaine in maize. Biotechnol. Lett. 2022, 44, 367–386. [Google Scholar] [CrossRef]
  21. Wang, Y.; Wang, J.; Sarwar, R.; Zhang, W.; Geng, R.; Zhu, K.-M.; Tan, X.-L. Research progress on the physiological response and molecular mechanism of cold response in plants. Front. Plant Sci. 2024, 15, 1334913. [Google Scholar] [CrossRef]
  22. Hossain, M.A.; Bhattacharjee, S.; Armin, S.M.; Qian, P.; Xin, W.; Li, H.Y.; Burritt, D.J.; Fujita, M.; Tran, L.S.P. Hydrogen peroxide priming modulates abiotic oxidative stress tolerance: Insights from ROS detoxification and scavenging. Front. Plant Sci. 2015, 6, 420. [Google Scholar] [CrossRef]
  23. Černý, M.; Habánová, H.; Berka, M.; Luklová, M.; Brzobohatý, B. Hydrogen peroxide: Its role in plant biology and crosstalk with signalling networks. Int. J. Mol. Sci. 2018, 19, 2812. [Google Scholar] [CrossRef]
  24. Saxena, I.; Srikanth, S.; Chen, Z. Cross talk between H2O2 and interacting signal molecules under plant stress response. Front. Plant Sci. 2016, 7, 570. [Google Scholar] [CrossRef] [PubMed]
  25. Li, J.; Yang, Y.; Sun, K.; Chen, Y.; Chen, X.; Li, X. Exogenous melatonin enhances cold, salt and drought stress tolerance by improving antioxidant defense in tea plant (Camellia sinensis (L.) O. Kuntze). Molecules 2019, 24, 1826. [Google Scholar] [CrossRef] [PubMed]
  26. Dreyer, A.; Dietz, K.J. Reactive oxygen species and the redox-regulatory network in cold stress acclimation. Antioxidants 2018, 7, 169. [Google Scholar] [CrossRef] [PubMed]
  27. Jain, G.; Gould, K.S. Are betalain pigments the functional homologues of anthocyanins in plants? Environ. Exp. Bot. 2015, 119, 48–53. [Google Scholar] [CrossRef]
  28. Zhang, Y.H.; Rong, J.D.; Li, S.P.; He, T.Y.; Chen, L.Y.; Zheng, Y.S. Effect of low temperature on biochemical characteristics of Prunus campanulata Maxim. J. Fujian Coll. For. 2013, 33, 326–329. [Google Scholar]
  29. Wang, Y.; Li, Y.; Wang, J.; Xiang, Z.; Xi, P.; Zhao, D. Physiological changes and differential gene expression of tea plants (Camellia sinensis (L.) Kuntze var. niaowangensis QH Chen) under cold stress. DNA Cell Biol. 2021, 40, 906–920. [Google Scholar] [CrossRef]
  30. Ritonga, F.N.; Chen, S. Physiological and molecular mechanism involved in cold stress tolerance in plants. Plants 2020, 9, 560. [Google Scholar] [CrossRef]
  31. An, X.; Xu, Y.; Jiang, L.; Huan, C.; Yu, Z. Effects of postharvest temperature on apoptosis-related enzyme activity and gene expression in peach fruits (Prunus persica L. cv. Xiahui 8). Sci. Hortic. 2019, 245, 178–184. [Google Scholar] [CrossRef]
  32. Brizzolara, S.; Hertog, M.; Tosetti, R.; Nicolai, B.; Tonutti, P. Metabolic responses to low temperature of three peach fruit cultivars differently sensitive to cold storage. Front. Plant Sci. 2018, 9, 706. [Google Scholar] [CrossRef]
  33. Wang, K.; Yin, X.R.; Zhang, B.; Grierson, D.; Xu, C.J.; Chen, K.S. Transcriptomic and metabolic analyses provide new insights into chilling injury in peach fruit. Plant Cell Environ. 2017, 40, 1531–1551. [Google Scholar] [CrossRef]
  34. Nilo-Poyanco, R.; Vizoso, P.; Sanhueza, D.; Balic, I.; Meneses, C.; Orellana, A.; Campos-Vargas, R. A Prunus persica genome-wide RNA-seq approach uncovers major differences in the transcriptome among chilling injury sensitive and non-sensitive varieties. Physiol. Plant. 2019, 166, 772–793. [Google Scholar] [CrossRef] [PubMed]
  35. Szalay, L.; Hegedűs, A.; Stefanovits-Bányai, É. Presumable protective role of peroxidase and polyphenol oxidase enzymes against freezing stress in peach (Prunus persica/L./Batsch). Acta Biol. Szeged. 2005, 49, 121–122. [Google Scholar]
  36. Yu, D.J.; Jun, S.H.; Park, J.; Kwon, J.H.; Lee, H.J. Transcriptome analysis of genes involved in cold hardiness of peach tree (Prunus persica) shoots during cold acclimation and deacclimation. Genes 2020, 11, 611. [Google Scholar] [CrossRef] [PubMed]
  37. Li, Y.; Wang, Z.; Tian, Q.; Zhou, Y.; Xu, J.; Chang, R.; Chen, H.; Liu, G. Quantitative Proteomic Analyses on the Mechanisms of Cold Tolerance in Two Peach Cultivars (Prunus persica L. Batsch) Based on ITRAQ. Eur. J. Hortic. Sci. 2021, 86, 308–319. [Google Scholar] [CrossRef]
  38. Jiao, Y.; Shen, Z.; Yan, J. Transcriptome analysis of peach [Prunus persica (L.) Batsch] stigma in response to low-temperature stress with digital gene expression profiling. J. Plant Biochem. Biotechnol. 2017, 26, 141–148. [Google Scholar] [CrossRef]
  39. Li, Y.; Tian, Q.; Wang, Z.; Li, J.; Liu, S.; Chang, R.; Chen, H.; Liu, G. Integrated analysis of transcriptomics and metabolomics of peach under cold stress. Front. Plant Sci. 2023, 14, 1153902. [Google Scholar] [CrossRef]
  40. Plugatar, Y.V. (Ed.) Atlas of Cultivars of Fruit Crops From the Collection of the Nikitsky Botanical Gardens; PH “ARIAL”: Simferopol, Russia, 2018; 400p. (In Russian) [Google Scholar]
  41. Smykov, A.V.; Mesyats, N.V. Frost resistance and placement of peach cultivars in the Crimea. Plant Biol. Hortic. Theory Innov. 2024, 1, 67–80. (In Russian) [Google Scholar]
  42. Mitrofanova, I.; Lesnikova-Sedoshenko, N.; Tsiupka, V.; Smykov, A.; Mitrofanova, O. Use of Biotechnological Methods to Support the Production of New Peach Hybrids. Horticulturae 2021, 7, 533. [Google Scholar] [CrossRef]
  43. Fogle, H.W.K. Peach production. In Agriculture Handbook; USDA Agricultural Research Service: Washington, DC, USA, 1974; 90p. [Google Scholar]
  44. Korsakova, S.P.; Korsakov, P.B. Changes in climate norms on the southern coast of Crimea over the past 90 years. Plant Biol. Hortic. Theory Innov. 2023, 2, 84–95. (In Russian) [Google Scholar]
  45. De Melo-Abreu, J.P.; Mateos, L.; Villalobos, F.J. Frost protection. In Principles of Agronomy for Sustainable Agriculture; Springer International Publishing: Cham, Switzerland, 2024; pp. 497–511. [Google Scholar]
  46. Voskresenskaya, O.L. Bol’shoi Praktikum po Bioekologii (An Extended Practical Course in Biological Ecology); Mariisk. Univ.: Ioshkar Ola, Russia, 2006. [Google Scholar]
  47. Novikova, I.I.; Popova, E.V.; Kovalenko, N.M.; Krasnobaeva, I.L. The Effect of Bacillus subtilis in Combination with Chitosan Salicylate on Peroxidase and Catalase Activity in B. sorokiniana Infected Wheat. Appl. Biochem. Microbiol. 2024, 60, 241–250. [Google Scholar] [CrossRef]
  48. Vodiasova, E.; Meger, Y.; Uppe, V.; Tsiupka, V.; Chelebieva, E.; Smykov, A. Class III Peroxidases in the Peach (Prunus persica): Genome-Wide Identification and Functional Analysis. Plants 2024, 13, 127. [Google Scholar] [CrossRef] [PubMed]
  49. Haider, M.S.; Kurjogi, M.M.; Khalil-ur-Rehman, M.; Pervez, T.; Songtao, J.; Fiaz, M.; Jogaiah, S.; Wang, C.; Fang, J. Drought stress revealed physiological, biochemical and gene-expressional variations in ‘Yoshihime’peach (Prunus persica L.) cultivar. J. Plant Interact. 2018, 13, 83–90. [Google Scholar] [CrossRef]
  50. Tong, Z.; Gao, Z.; Wang, F.; Zhou, J.; Zhang, Z. Selection of reliable reference genes for gene expression studies in peach using real-time PCR. BMC Mol. Biol. 2009, 10, 71. [Google Scholar] [CrossRef] [PubMed]
  51. Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
  52. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  53. Rezaie, R.; Abdollahi Mandoulakani, B.; Fattahi, M. Cold stress changes antioxidant defense system, phenylpropanoid contents and expression of genes involved in their biosynthesis in Ocimum basilicum L. Sci. Rep. 2020, 10, 5290. [Google Scholar] [CrossRef]
  54. Karami-Moalem, S.; Maali-Amiri, R.; Kazemi-Shahandashti, S.S. Effect of cold stress on oxidative damage and mitochondrial respiratory properties in chickpea. Plant Physiol. Biochem. 2018, 122, 31–39. [Google Scholar] [CrossRef]
  55. Su, T.; Wang, P.; Li, H.; Zhao, Y.; Lu, Y.; Dai, P.; Ren, T.; Wang, X.; Li, X.; Shao, Q.; et al. The Arabidopsis catalase triple mutant reveals important roles of catalases and peroxisome-derived signaling in plant development. J. Integr. Plant Biol. 2018, 60, 591–607. [Google Scholar] [CrossRef]
  56. Skadsen, R.W.; Schulze-Lefert, P.; Herbst, J.M. Molecular cloning, characterization and expression analysis of two catalase isozyme genes in barley. Plant Mol. Biol. 1995, 29, 1005–1014. [Google Scholar] [CrossRef]
  57. Wang, W.; Cheng, Y.; Chen, D.; Liu, D.; Hu, M.; Dong, J.; Zhang, X.; Song, L.; Shen, F. The catalase gene family in cotton: Genome-wide characterization and bioinformatics analysis. Cells 2019, 8, 86. [Google Scholar] [CrossRef]
  58. Lee, S.H.; An, C.S. Differential expression of three catalase genes in hot pepper (Capsicum annuum L.). Mol. Cells 2005, 20, 247–255. [Google Scholar] [CrossRef] [PubMed]
  59. Bagnoli, F.; Danti, S.; Magherini, V.; Cozza, R.; Innocenti, A.M.; Racchi, M.L. Molecular cloning, characterisation and expression of two catalase genes from peach. Funct. Plant Biol. 2004, 31, 349–357. [Google Scholar] [CrossRef] [PubMed]
  60. Passardi, F.; Cosio, C.; Penel, C.; Dunand, C. Peroxidases have more functions than a swiss army knife. Plant Cell Rep. 2005, 24, 255–265. [Google Scholar] [CrossRef] [PubMed]
  61. Kidwai, M.; Ahmad, I.Z.; Chakrabarty, D. Class III peroxidase: An indispensable enzyme for biotic/abiotic stress tolerance and a potent candidate for crop improvement. Plant Cell Rep. 2020, 39, 1381–1393. [Google Scholar] [CrossRef]
  62. Oldonil, C.M.; Nienow, A.A.; Schons, J.; Mayer, A.N. Peroxidase activity and initial growth of ‘Barbosa’ peach on clonal rootstocks. Rev. Bras. Frutic. 2019, 41, e-086. [Google Scholar]
  63. Passardi, F.; Longet, D.; Penel, C.; Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants. Phytochemistry 2004, 65, 1879–1893. [Google Scholar] [CrossRef]
  64. Cai, K.W.; Liu, H.; Chen, S.; Zhao, X.Y.; Chen, S. Genome-wide identification and analysis of Class III peroxidases in Betula pendula. BMC Genom. 2021, 22, 314. [Google Scholar] [CrossRef]
  65. Su, P.S.; Yan, J.; Li, W.; Wang, L. A member of wheat class III peroxidase gene family, Ta PRX-2A, enhanced the tolerance of salt stress. BMC Plant Biol. 2020, 20, 15. [Google Scholar] [CrossRef]
  66. Aleem, M.; Riaz, A.; Raza, Q.; Aleem, M.; Aslam, M.; Kong, K.; Atif, R.M.; Kashif, M.; Bhat, J.A.; Zhao, T. Genome-wide characterization and functional analysis of class III peroxidase gene family in soybean reveal regulatory roles of GsPOD40 in drought tolerance. Genomics 2022, 114, 45–60. [Google Scholar] [CrossRef]
  67. Jiao, C.; Chai, Y.; Duan, Y. Inositol 1,4,5-trisphosphate mediates nitric-oxide-induced chilling tolerance and defense response in postharvest peach fruit. J. Agric. Food Chem. 2019, 67, 4764–4773. [Google Scholar] [CrossRef]
  68. Song, C.; Zhao, Y.; Li, A.; Qi, S.; Lin, Q.; Duan, Y. Postharvest nitric oxide treatment induced the alternative oxidase pathway to enhance antioxidant capacity and chilling tolerance in peach fruit. Plant Physiol. Biochem. 2021, 167, 113–122. [Google Scholar] [CrossRef] [PubMed]
  69. Del-Saz, N.F.; Ribas-Carbo, M.; McDonald, A.E.; Lambers, H.; Fernie, A.R.; Florez-Sarasa, I. An in vivo perspective of the role (s) of the alternative oxidase pathway. Trends Plant Sci. 2018, 23, 206–219. [Google Scholar] [CrossRef] [PubMed]
  70. Wang, J.; Rajakulendran, N.; Amirsadeghi, S.; Vanlerberghe, G.C. Impact of mitochondrial alternative oxidase expression on the response of Nicotiana tabacum to cold temperature. Physiol. Plant. 2011, 142, 339–351. [Google Scholar] [CrossRef] [PubMed]
Agronomy 15 00556 g001
Figure 1. Prunus persica flower bud state in the control (1, 3, 5, 7) and after low-temperature influence (2, 4, 6, 8): 1, 2—“Temisovskij”; 3, 4—“Podarok Like”; 5, 6—“Loadel”; 7, 8—“Springold”. Bars are 1 mm.
Figure 1. Prunus persica flower bud state in the control (1, 3, 5, 7) and after low-temperature influence (2, 4, 6, 8): 1, 2—“Temisovskij”; 3, 4—“Podarok Like”; 5, 6—“Loadel”; 7, 8—“Springold”. Bars are 1 mm.
Agronomy 15 00556 g001
Agronomy 15 00556 g002
Figure 2. Catalase activity in peach flower buds at different stages of the experiment. MTs—medium-tolerant cultivars, HTs—highly tolerant cultivars. All data are expressed in the manner of means ± standard error of the mean (the number of replicates n = 9), and significant differences from the control are marked with p ≤ 0.05 (*). Data were analyzed by two-way ANOVA followed by a Bonferroni post hoc multiple comparison test.
Figure 2. Catalase activity in peach flower buds at different stages of the experiment. MTs—medium-tolerant cultivars, HTs—highly tolerant cultivars. All data are expressed in the manner of means ± standard error of the mean (the number of replicates n = 9), and significant differences from the control are marked with p ≤ 0.05 (*). Data were analyzed by two-way ANOVA followed by a Bonferroni post hoc multiple comparison test.
Agronomy 15 00556 g002
Agronomy 15 00556 g003
Figure 3. Peroxidase activity in peach flower buds at different stages of the experiment. MTs—medium-tolerant cultivars, HTs—highly tolerant cultivars. All data are expressed in the manner of means ± standard error of the mean (the number of replicates n = 9), and significant differences from the control are marked with p ≤ 0.05. Data were analyzed by two-way ANOVA followed by a Bonferroni post hoc multiple comparison test.
Figure 3. Peroxidase activity in peach flower buds at different stages of the experiment. MTs—medium-tolerant cultivars, HTs—highly tolerant cultivars. All data are expressed in the manner of means ± standard error of the mean (the number of replicates n = 9), and significant differences from the control are marked with p ≤ 0.05. Data were analyzed by two-way ANOVA followed by a Bonferroni post hoc multiple comparison test.
Agronomy 15 00556 g003
Agronomy 15 00556 g004
Figure 4. The fold change in the relative expression of the CAT gene in highly and medium-tolerant peach cultivars following cold treatment for 12 h. The relative expression profiles of CAT normalized to the mean of reference genes in the experimental group. MTs—medium tolerant cultivars, HTs—highly tolerant cultivars. All data are expressed in the manner of means ± standard error of the mean (n = 9), and significant differences from the control are marked with p ≤ 0.05 (*). Data were analyzed by two-way ANOVA followed by a Bonferroni post hoc multiple comparison test.
Figure 4. The fold change in the relative expression of the CAT gene in highly and medium-tolerant peach cultivars following cold treatment for 12 h. The relative expression profiles of CAT normalized to the mean of reference genes in the experimental group. MTs—medium tolerant cultivars, HTs—highly tolerant cultivars. All data are expressed in the manner of means ± standard error of the mean (n = 9), and significant differences from the control are marked with p ≤ 0.05 (*). Data were analyzed by two-way ANOVA followed by a Bonferroni post hoc multiple comparison test.
Agronomy 15 00556 g004
Agronomy 15 00556 g005
Figure 5. The fold change in the relative expression of the POD gene in highly and medium-tolerant peach cultivars following cold treatment for 12 h. The relative expression profiles of CAT normalized to the mean of reference genes in the experimental group: (a) POD15, (b) POD4, (c) POD31, (d) PODA2. MTs—medium-tolerant cultivars, HTs—highly tolerant cultivars. All data are expressed in the manner of means ± standard error of the mean (n = 9), and significant differences from the control are marked with p ≤ 0.05 (*). Data were analyzed by two-way ANOVA followed by a Bonferroni post hoc multiple comparison test.
Figure 5. The fold change in the relative expression of the POD gene in highly and medium-tolerant peach cultivars following cold treatment for 12 h. The relative expression profiles of CAT normalized to the mean of reference genes in the experimental group: (a) POD15, (b) POD4, (c) POD31, (d) PODA2. MTs—medium-tolerant cultivars, HTs—highly tolerant cultivars. All data are expressed in the manner of means ± standard error of the mean (n = 9), and significant differences from the control are marked with p ≤ 0.05 (*). Data were analyzed by two-way ANOVA followed by a Bonferroni post hoc multiple comparison test.
Agronomy 15 00556 g005
Agronomy 15 00556 g006
Figure 6. Correlogram analysis between the activity of antioxidant enzymes (bold text) and the expression of antioxidant genes (Italic text)) in the Prunus persica: “Podarok Like”, “Springold”, “Loadel”, “Temisovskij”. Positive correlations appear in green, and negative correlations appear in orange. The color intensity is proportional to the coefficient of correlation. X—non-significant at p < 0.05 (adjustment: Holm).
Figure 6. Correlogram analysis between the activity of antioxidant enzymes (bold text) and the expression of antioxidant genes (Italic text)) in the Prunus persica: “Podarok Like”, “Springold”, “Loadel”, “Temisovskij”. Positive correlations appear in green, and negative correlations appear in orange. The color intensity is proportional to the coefficient of correlation. X—non-significant at p < 0.05 (adjustment: Holm).
Agronomy 15 00556 g006
Agronomy 15 00556 g007
Figure 7. The impact of short-term cold stress on high cold-tolerant and medium cold-tolerant cultivars of P. persica L.
Figure 7. The impact of short-term cold stress on high cold-tolerant and medium cold-tolerant cultivars of P. persica L.
Agronomy 15 00556 g007
Table 1. Frost resistance of flower buds of the studied peach varieties (% of intact buds, average value).
Table 1. Frost resistance of flower buds of the studied peach varieties (% of intact buds, average value).
VarietyStudy Period, Freezing ModeReference
January
−16 °C		February
−16 °C		March
−12 °C
Loadel25.925.015.9This study
Springold9.232.725.3This study
Podarok Like88.263.446.6[41]
Temisovskij97.556.177.3[41]
Table 2. Primer sequence of the target and reference genes for RT-qPCR.
Table 2. Primer sequence of the target and reference genes for RT-qPCR.
Gene NameSequenceReference
CATTTCTGGAAAGCGTGAGAAGTGCThis study
TGTCTGGCGCCCAAGATCTGTA
PODA2ACTTAGACCCCACAACTCCG[37]
CTCCCCATTACTTCCCACCA
POD4CATTGCTGCTCGAGACTCCGTTThis study
AGCTGGCTGAGGGTAGAAGTGG
POD15TCCAGGGTTGTGATGGTTCG[49]
AGACAACACCAGGGCAAACA
POD31CCCTACTACAACGTACCGCT[37]
ACCTGGATGAGCTGAGACAC
GAPDHATTTGGAATCGTTGAGGGTCTTATG[50]
AATGATGTTGAAGGAAGCAGCAC
ACTGTTATTCTTCATCGGCGTCTTCG[50]
CTTCACCATTCCAGTTCCATTGTC
Table 3. Results of analysis of variance for key antioxidant enzyme activity in peaches with different levels of cold tolerance studied under the control and cold stress conditions.
Table 3. Results of analysis of variance for key antioxidant enzyme activity in peaches with different levels of cold tolerance studied under the control and cold stress conditions.
DfSumMeanF valuePr (>F)
POD15
Peach varieties349.1416.381.930.175
Temperature16.636.630.7810.393
Residuals13110.358.489
POD4
Peach varieties317.585.861.9320.1743
Temperature123.0723.0667.6060.0163 *
Residuals1339.433.033
POD31
Peach varieties375.9125.31.860.1862
Temperature153.9953.993.9690.0678
Residuals13176.8513.6
PODA2
Peach varieties32.7150.9052.4040.114
Temperature10.4530.4531.2030.293
Residuals134.8940.3765
CAT
Peach varieties322.587.534.0720.03044 *
Temperature128.1228.1215.2090.00183 **
Residuals1324.031.85
CAT
Peach varieties3101.5133.84107.604.20 · 10−12 ***
Temperature192.7192.71294.804.99 · 10−13 ***
Residuals195.970.31
POD
Peach varieties30.0033440.00111483.1940.047 *
Temperature10.000140.00014020.4020.534
Residuals190.0066310.000349
Significant at the p-value of ≤0.001 (***), p-value of ≤0.01 (**), and p-value of ≤0.05 (*).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Vodiasova, E.; Chelebieva, E.; Kladchenko, E.; Grebennikova, O.; Uppe, V.; Tsiupka, V.; Dolgov, S.; Smykov, A. Changes of Catalase and Peroxidase Activity and Expression Under Cold Stress in Prunus persica Cultivars with Different Cold Tolerances. Agronomy 2025, 15, 556. https://doi.org/10.3390/agronomy15030556

AMA Style

Vodiasova E, Chelebieva E, Kladchenko E, Grebennikova O, Uppe V, Tsiupka V, Dolgov S, Smykov A. Changes of Catalase and Peroxidase Activity and Expression Under Cold Stress in Prunus persica Cultivars with Different Cold Tolerances. Agronomy. 2025; 15(3):556. https://doi.org/10.3390/agronomy15030556

Chicago/Turabian Style

Vodiasova, Ekaterina, Elina Chelebieva, Ekaterina Kladchenko, Oksana Grebennikova, Victoria Uppe, Valentina Tsiupka, Sergey Dolgov, and Anatoly Smykov. 2025. "Changes of Catalase and Peroxidase Activity and Expression Under Cold Stress in Prunus persica Cultivars with Different Cold Tolerances" Agronomy 15, no. 3: 556. https://doi.org/10.3390/agronomy15030556

APA Style

Vodiasova, E., Chelebieva, E., Kladchenko, E., Grebennikova, O., Uppe, V., Tsiupka, V., Dolgov, S., & Smykov, A. (2025). Changes of Catalase and Peroxidase Activity and Expression Under Cold Stress in Prunus persica Cultivars with Different Cold Tolerances. Agronomy, 15(3), 556. https://doi.org/10.3390/agronomy15030556

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop