Next Article in Journal
The Effects of Maize–Soybean and Maize–Peanut Intercropping on the Spatiotemporal Distribution of Soil Nutrients and Crop Growth
Previous Article in Journal
The Role of Genotype and Sowing Time in Reducing the Risk of Infection with Fusarium spp. in Maize
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Compound Sodium Nitrophenolate (CSN) Improves Photo-Synthesis and Forage Quality in Hemarthria compressa

1
College of Landscape Architecture, Jiangsu Vocational College of Agriculture and Forestry, Jurong 212400, China
2
Tropical Crops Genetic Resources Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou 571737, China
3
College of Forestry and Grassland Science, Nanjing Forestry University, Nanjing 210037, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Agronomy 2025, 15(11), 2526; https://doi.org/10.3390/agronomy15112526
Submission received: 16 September 2025 / Revised: 16 October 2025 / Accepted: 28 October 2025 / Published: 30 October 2025
(This article belongs to the Topic Plant Breeding, Genetics and Genomics, 2nd Edition)

Abstract

Hemarthria compressa is a valuable C4 forage grass, prized for its high biomass (dry weight, DW) and palatability, that plays a significant role in forage production and ecological restoration. Improving its nutritional quality and productivity remains a key objective. Although compound sodium nitrophenolate (CSN) is known to promote growth and stress tolerance in crops, its impact on forage grasses is unclear. Therefore, this study investigated the effects of foliar-applied CSN on the photosynthesis, growth, and nutritional quality of H. compressa and explored the underlying molecular mechanisms. The results demonstrated that CSN significantly improved the photosynthetic efficiency (Fv/Fm), increased the chlorophyll and carotenoid content, enhanced carbon fixation, and promoted biomass (DW) accumulation. Additionally, the crude protein content rose while the acid detergent fiber content decreased. Transcriptome analysis revealed the enrichment of differentially expressed genes involved in photosynthesis antenna proteins, carbon fixation, and starch/sucrose metabolism. Consequently, CSN reduced the lignin content while improving both biomass and forage quality. These findings provide molecular insights and practical strategies for forage cultivation and breeding.

1. Introduction

Hemarthria compressa is an important perennial forage grass native to tropical and subtropical regions [1,2]. It is a typical C4 photosynthetic plant, which enables it to achieve a high photosynthetic efficiency and productivity in warm climates [3,4]. This species is characterized by its prolonged vegetative growth period and exceptional regrowth capacity following defoliation, making it highly suitable for repeated harvesting [5]. H. compressa significantly contributes to ruminant nutrition and plays a pivotal role in sustaining livestock production systems and supporting the ecological stability of managed grasslands [6,7,8]. Additionally, it exhibits robust adaptability to diverse agroecological conditions and considerable tolerance to abiotic stresses such as drought, waterlogging, and low soil fertility [9,10].
The agronomic performance of forage crops, including their yield potential and nutritional quality, directly determines their utility in animal husbandry and economic value in forage-based production systems [11,12,13]. Key nutritional indicators, such as the crude protein (CP), neutral detergent fiber (NDF), and acid detergent fiber (ADF) content, are critical for evaluating both biomass accumulation and forage digestibility [13,14,15]. Therefore, improving both the biomass yield and the compositional quality of H. compressa is essential for maximizing its forage utilization efficiency and enhancing its functional role in sustainable animal agriculture [16,17].
Despite its recognized value, research specifically aimed at enhancing the nutritional quality of H. compressa remains limited. Existing studies have primarily focused on assessing phenotypic traits, productivity metrics, and genetic diversity [18,19]. However, recent findings suggest that exogenous application of micronutrients or plant biostimulants can positively influence its nutritional attributes [20,21]. For instance, foliar supplementation with silicon and selenium has been shown to significantly boost the dry matter yield and increase essential nutrient concentrations in whipgrass tissues [22]. These studies indicated that external modulation strategies may be effective in improving forage production. Nevertheless, the molecular mechanisms through which such interventions influence photosynthetic function and nutrient assimilation in H. compressa remain poorly understood.
Compound sodium nitrophenolate (CSN) is a synthetic plant growth regulator composed of a synergistic blend of sodium nitrophenolates. It is widely recognized for its potent growth-promoting properties across a broad spectrum of plant species [23]. In C4 crops, accumulating field and physiological evidence indicates that nitrophenolate-based biostimulants can enhance photosynthetic performance and productivity [23,24]. In maize (Zea mays), foliar Atonik (commercial CSN/Atonik formulations) applications at critical growth stages have been associated with improved physiological status and higher yield in multi-site trials, consistent with photosynthesis stimulation in a C4 context [25].Similarly, in sorghum (Sorghum bicolor), Atonik treatments (seed soaking 2.5–5 mL/L) under field conditions increased plant height, leaf area, chlorophyll index, and grain yield across seasons, further supporting a photosynthesis-linked productivity gain in C4 crops [24].These observations, together with reports of CSN-enhanced carbon assimilation, motivated us to investigate whether CSN can similarly improve photosynthesis, nutrient assimilation, and forage quality in H. compressa. CSN has been documented to stimulate vegetative growth, enhance photosynthetic capacity, and bolster plant tolerance to various abiotic stressors [26,27,28]. For example, its application in Brassica napus has been associated with increased net photosynthetic and transpiration rates without adversely affecting tissue hydration status [23]. Additionally, in stress physiology studies on salt-tolerant crops, such as cotton (Gossypium hirsutum), CSN treatment has been shown to significantly elevate antioxidant enzyme activity, particularly superoxide dismutase, thereby enhancing plant resilience [29]. However, empirical evidence regarding the efficacy of CSN in modulating forage yield and nutritive value in H. compressa is currently lacking.
Therefore, the present study investigates the physiological and molecular effects of CSN on photosynthetic efficiency and forage quality in H. compressa. Plants were treated with an optimized concentration of CSN via foliar application during the active growth phase. Physiological parameters, including the net photosynthetic rate, transpiration rate, and chlorophyll fluorescence indices, were quantified alongside key nutritional traits such as crude protein, crude fiber, and in vitro dry matter digestibility. Furthermore, high-throughput transcriptome sequencing of leaf samples from treated and control plants was conducted to identify differentially expressed genes and associated metabolic pathways. By integrating physiological measurements with transcriptomic analyses, we aimed to characterize the mechanism through which CSN enhances forage production. Our findings are expected to advance our understanding of CSN-mediated physiological regulation and provide a scientific basis for improving the nutritional quality, agronomic management, and molecular breeding of H. compressa.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

Healthy stem segments (approximately 10 cm in length) of H. compressa cv. JuNiu-1 were transplanted into plastic containers (20.0 cm length × 15.0 cm width × 20.0 cm height) filled with peat soil. The plants were cultivated in a greenhouse maintained at 65% relative humidity, under 800 μmol/m2/s photosynthetically active radiation, with a 16 h photoperiod and an average temperature of 30 °C (day)/25 °C (night).

2.2. Exogenous CSN Treatment

Plants were exogenously sprayed with three concentrations of compound sodium nitrophenolate (CSN): 1.0 mg/mL (CSN1), 2.0 mg/mL (CSN2), and 3.0 mg/mL (CSN3). The control group (CK) was sprayed with a solution of ddH2O mixed with fertilizer. The CSN solutions were applied as a combined solution with a water-soluble fertilizer (Scotts Miracle-Gro Co., Marysville, OH, USA). The treatment was applied twice, at 15-day intervals, over a total period of 30 days. Control plants were sprayed at the same time points.

2.3. Measurement of Morphological Traits and Biomass Accumulation

Plant morphological traits, including height, tiller number, leaf length, and leaf width, were measured at the late vegetative stage. Plant height was recorded as the vertical distance from the soil surface to the tip of the tallest leaf blade or stem using a measuring tape accurate to 0.1 cm. Ten individual plants were randomly selected from each treatment group, and their average was calculated. Tiller number per plant was determined by counting the number of independent shoots emerging from the plant base, with valid tillers defined as those bearing at least one fully expanded leaf. Leaf length and leaf width were measured on fully expanded functional leaves from the upper part of the plant. Leaf length was defined as the distance from the leaf base to the apex, and leaf width was measured at the widest point using a ruler or a labeled gauge for accuracy.
For biomass determination, whole plants were gently uprooted from the soil. Roots were carefully washed to remove adhering soil and blotted dry with filter paper to eliminate surface moisture. The plants were then separated into roots, stems, and leaves. Each organ was placed in a pre-weighed kraft paper bag and oven-dried following a two-step protocol: first at 105 °C for 30 min, then at 80 °C until a constant weight was achieved (defined as two consecutive weight measurements differing by less than 2.0 g). Dry weights were determined using an analytical balance and used to calculate aboveground and belowground biomass.

2.4. Determination of Photosynthetic Pigments, Fv/Fm, and Key Carbon Fixation Enzyme Activities

Approximately 0.4 g fresh leaf tissue (veins removed) was homogenized in 5 mL 80% acetone and centrifuged. The supernatant absorbance was measured at 663 nm, 645 nm (for chlorophyll a and b), and 470 nm (for carotenoids) using a UV–Vis spectrophotometer (UV-1800, Shimadzu Corporation, Kyoto, Japan). Chlorophyll a and b concentrations were determined using standard extinction coefficients, and total carotenoids were calculated following Lichtenthaler and Wellburn’s equations.
Fully expanded leaves were dark-adapted for 30 min, then measured with a PAM fluorometer (MINI-PAM/PAM-2500, Walz GmbH, Effeltrich, Germany.): minimal fluorescence (F0) under <0.1 µmol m−2 s−1 modulated light, followed by maximum fluorescence (Fm) using a saturating pulse. The maximum quantum efficiency of PSII (Fv/Fm) was calculated as (Fm − F0)/Fm.
Leaf enzyme extracts were prepared from ~0.2 g fresh leaf tissue (veins removed) ground in liquid nitrogen and homogenized in 1.6 mL ice-cold extraction buffer (50 mM HEPES-KOH pH 7.5, 5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 2 mM DTT, 2% w/v PVPP, 10% v/v glycerol). The homogenate was centrifuged at 12,000× g for 15 min at 4 °C and the supernatant was collected. Soluble protein concentration was determined by the Bradford method using BSA as standard.
For PEPC, the PEPC Activity Assay Kit (Order No. D799448, Sangon Biotech, Shanghai, China) was used. This kit is based on the coupling of oxaloacetate formation and NADH oxidation via malate dehydrogenase (MDH). The reaction is monitored by the decrease in absorbance at 340 nm. The assay was conducted in a 1 mL reaction volume following the manufacturer’s instructions. Enzyme activity is expressed as µmol NADH oxidized min−1 mg−1 protein.
For Rubisco, the Rubisco Activity Assay Kit (Order No. D799833, Sangon Biotech, Shanghai, China) was employed (Ultraviolet Colorimetric Method). In this kit, Rubisco-catalyzed carboxylation (RuBP + CO2→3-PGA) is coupled via auxiliary enzymes ( GAPDH and PGK from Sangon Biotech, Shanghai, China) and an ATP regeneration system (e.g., CrP/CPK) such that NADH oxidation at 340 nm reflects Rubisco activity. The reaction mixture was prepared according to kit instructions in a 1.0 mL volume, and absorbance change at 340 nm was recorded over time. Activities were normalized by soluble protein and reported as µmol NADH oxidized min−1 mg−1 protein.
Quality control measures included blank controls (without extract) and heat-inactivated controls to subtract background NADH oxidation. Each biological replicate (n = 3) was assayed in three technical replicates, and means of technical replicates were used for subsequent statistical analysis.
The instruments used included a UV–Vis spectrophotometer or microplate reader capable of measuring at 340 nm, a low-temperature centrifuge (≥12,000× g), precision pipettes, quartz cuvettes or UV-transparent plates, an ice bath, and cooling facilities.

2.5. Determination of Crude Protein, Moisture, Fiber Components, and Ash Content in H. compressa

Approximately 15 g of mixed fresh plant material was collected and evenly subsampled for analysis. Crude protein was determined via the Kjeldahl method (AOAC 976.05), involving H2SO4 digestion with a CuSO4/K2SO4 catalyst, steam distillation of ammonia into boric acid, and titration with standardized HCl; nitrogen content (mg N/g dry weight) was converted to crude protein using a factor of 6.25 [30,31,32,33]. Moisture content (% fresh weight) was measured by oven-drying preheated samples at 105 °C for 30 min followed by drying at 65 °C to constant weight (≤2.0 g change). Neutral detergent fiber (NDF), acid detergent fiber (ADF), and acid detergent lignin (ADL) were sequentially analyzed using the Van Soest detergent method with an ANKOM 200 Fiber Analyzer (A200; ANKOM Technology, Macedon, NY, USA). Ground samples (1 mm) were refluxed in neutral and acid detergent solutions, after which the residues were dried and weighed. Lignin content was determined by sulfuric acid digestion of the ADF residue [34,35]. Hemicellulose was calculated as NDF–ADF and cellulose as ADF–ADL. Ash content (% dry weight) was determined by ashing oven-dried samples at 550 °C for 4 h in a muffle furnace and weighing the inorganic residue [31].

2.6. Transcriptome Analysis

Fresh leaf samples of H. compressa at 30 days in different treatments—control (CK) and Compound Sodium Nitrophenolate at 2 mg/L (CSN2)—were collected and sent to Frasergen Bioinformatics Co., Ltd. (Wuhan, China) for transcriptome sequencing. Total RNA was extracted and purified from CK and CSN2 treatment groups using the RNAprep Pure Plant Kit (Tiangen Biotech, Beijing, China), following the manufacturer’s protocol. The RNA concentration and purity of all nine samples were assessed using a NanoDrop 2000 spectrophotometer (NanoDrop, Wilmington, DE, USA), and RNA integrity (RIN > 7.0) was confirmed using a Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). cDNA libraries were constructed using the TruSeq Stranded mRNA Sample Prep Kit (Illumina, San Diego, CA, USA), and sequencing was performed on the Illumina HiSeq™ 2000 platform according to the manufacturer’s instructions.
Raw sequencing reads were filtered to obtain high-quality clean reads using SOAPnuke (v2.1.0); The raw sequence data have been deposited in the National Genomics Data Center (NGDC) under the submission number PRJCA048433. All subsequent analyses were conducted using clean reads. Functional annotation of unigenes was performed using Blast2GO Basic version 1.0 [36] by aligning sequences against major publicly available databases [36]. Differentially expressed genes (DEGs) between CSN2 and control samples were identified using the edgeR package (v2.0) [37], with an adjusted p-value (padj < 0.05) and |log2FoldChange| ≥ 1 considered to represent significantly differential expression. KEGG pathway enrichment analysis was conducted to investigate the biological functions and metabolic pathways associated with DEGs. Each treatment group included three biological replicates to ensure experimental robustness and statistical accuracy.
KEGG pathway enrichment analysis was performed to elucidate the biological functions and metabolic pathways associated with the differentially expressed genes (DEGs). Functional annotation and enrichment analyses were conducted using EggNOG-mapper v2.1.9 [38] and the clusterProfiler package (v4.2) [39] in R, with a significance threshold of FDR < 0.05. Each treatment group included three biological replicates to ensure experimental robustness and statistical reliability.

2.7. Quantitative Real-Time PCR (qRT-PCR) Analysis

Total RNA was extracted from H. compressa leaves using the FastPure® Plant RNA Isolation Mini Kit (Vazyme Biotech Co., Ltd., Nanjing, China) following the manufacturer’s protocol. Twenty genes that were significantly upregulated in the transcriptome analysis were selected for validation by quantitative real-time PCR (qRT-PCR). For each 20 μL reaction, the qRT-PCR mixture contained 2.0 μL of diluted cDNA template, 0.5 μL of each gene-specific primer, and 10.0 μL of 2× SYBR Green Master Mix (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA). The qRT-PCR reactions were run on a StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Primers were designed using Primer Premier v5.0 and are listed in Table 1. The actin gene was used as an internal reference, and relative gene expression levels were calculated using the 2−ΔΔCT method. Each qRT-PCR assay was performed with three independent biological replicates to ensure reproducibility.

3. Results

3.1. Effects of Compound Sodium Nitrophenolate (CSN) Concentrations on Morphological Traits of H. compressa

The application of CSN at different concentrations produced significant effects on the morphological development of H. compressa (Figure 1). Compared with CK, all of the CSN treatments significantly enhanced the plant height, tiller number, leaf length, and shoot and root weight (Figure 2).
The CSN1, CSN2, and CSN3 treatments increased the plant height by 52.8%, 54.7%, and 49.1%, respectively, compared with CK; the number of tillers increased by 69.2%, 123.1%, and 115.4%, respectively. The leaf length also showed consistent enhancement, with increases of 22.9%, 20.8%, and 18.8% in the three treatments, respectively.
Meanwhile, the CSN treatments significantly increased both the shoot and root dryweight (DW). The shoot weight increased by 22.2%, 63.3%, and 61.7% with the CSN1, CSN2, and CSN3 treatments, respectively; the root weight increased substantially by 52.4%, 85.7%, and 83.5% in the corresponding treatments. These results indicate that exogenous foliar CSN application effectively stimulates vegetative growth in H. compressa, with particularly pronounced effects observed at medium (2.0 mg/mL) and high (3.0 mg/mL) concentrations. However, there was no significant difference between the CSN2 and CSN3 treatments. These data suggested that CSN at these concentrations optimally promoted morphological development.

3.2. Effects of Different CSN Concentrations on Photosynthesis in H. compressa

Foliar application of CSN at different concentrations produced significant physiological effects in H. compressa during its vegetative growth stage. Compared with the control group, all of the CSN treatments notably enhanced pigment accumulation, PSII efficiency, and the activities of key carbon fixation enzymes (Figure 3).
Compared with CK, the chlorophyll a content increased by 43.8%, 53.1%, and 56.3% in treatments CSN1 to CSN3, respectively; the chlorophyll b levels also increased, with enhancements of 62.5%, 62.5%, and 75.0% with the CSN1, CSN2, and CSN3 treatments, respectively. The chlorophyll a/b ratio decreased by 11.5%, 5.8%, and 10.7%, respectively, with the CSN1, CSN2, and CSN3 treatments, reflecting modest adjustments in pigment composition to optimize photosynthetic efficiency. The total chlorophyll consequently increased by 47.5%, 55.0%, and 60.0%, respectively. Meanwhile, the carotenoid content also increased significantly: compared to CK, carotenoid content increased by 15.8%, 36.8%, and 42.1% with the CSN1, CSN2, and CSN3 treatments, respectively. These results indicate that CSN enhances both the photosynthetic efficiency and photoprotective capacity. Additionally, Fv/Fm was significantly improved under the CSN treatments, increasing by 16.7%, 23.6%, and 19.4% with the CSN1, CSN2, and CSN3 treatments, respectively.
Moreover, the activities of two key enzymes involved in carbon fixation were significantly enhanced by the CSN treatments. The PEPC activity increased by 40.9%, 66.4%, and 69.1% with treatments CSN1, CSN2, and CSN3, respectively. Similarly, Rubisco activity increased by 26.8%, 65.9%, and 61.0% under the same treatments. These enhancements suggest that CSN regulates carbon assimilation by modulating the activity of essential photosynthetic enzymes.
Therefore, CSN significantly enhanced photosynthesis in H. compressa by promoting pigment biosynthesis, photoprotective mechanisms, PSII efficiency, and the activity of carbon assimilation enzymes. The most pronounced effects were observed at medium (CSN2, 2.0 mg/mL) and high (CSN3, 3.0 mg/mL) concentrations, highlighting their potential for improving photosynthetic efficiency and biomass accumulation in forage grass production.

3.3. CSN Modulates Nutritional and Fiber Profiles in H. compressa

To evaluate the effect of CSN on forage quality, the nutritional composition and fiber fractions of H. compressa were analyzed (Table 2).
The crude protein (CP) content increased significantly in response to CSN application. Compared with the control (147.3 mg/g), the CP levels rose to 163.5 mg/g with CSN1, 177.6 mg/g with CSN2, and 172.5 mg/g with CSN3. These results indicate that CSN, particularly at medium to high concentrations, promotes protein biosynthesis and enhances the forage’s nutritive value.
The moisture content remained stable across the different treatments, suggesting that CSN did not notably influence the water retention. The lignin content decreased substantially with the CSN treatments compared with the control (130.5 mg/g), implying reduced structural recalcitrance. The hemicellulose content showed little variation, ranging from 211.1 to 223.3 mg/g across the treatments.
The fiber fractions were strongly affected by CSN; for example, the neutral detergent fiber (NDF) content declined from 70.6% with the control to 60.6%, 61.4%, and 62.5% with CSN1, CSN2, and CSN3, respectively. The acid detergent fiber (ADF) content was similarly reduced from 38.3% in the control to 33.9%, 32.9%, and 33.8% in the respective CSN treatments. These reductions suggest that CSN modulates cell wall metabolism, thereby improving forage digestibility and palatability.
The ash content also increased following CSN application. Relative to the control (8.53%), the ash content rose to 9.88%, 11.48%, and 11.22% with CSN1, CSN2, and CSN3, respectively, reflecting enhanced mineral uptake or deposition associated with CSN-induced metabolic activity. CSN application significantly modified the nutritional profile of H. compressa by increasing crude protein, reducing the lignin and fibrous fractions, and elevating mineral accumulation, collectively contributing to improved forage quality.

3.4. Transcriptomic Alterations in H. compressa in Response to Compound Sodium Nitrophenolate (CSN) Treatment

The principal component analysis (PCA) of global gene expression profiles revealed a clear separation between the CSN-treated and control (CK) groups, indicating substantial transcriptomic alterations following CSN application. The first two principal components (PC1 and PC2) explained 68.34% and 16.30% of the total variance, respectively, together accounting for 84.64% of the overall variability among the samples (Figure 4A). This separation demonstrates the strong influence of CSN treatment on the transcriptional landscape of H. compressa. Comparisons between the CSN and CK group transcriptomes identified a total of 13,039 differentially expressed genes (DEGs), comprising 8114 upregulated and 4925 downregulated transcripts in response to the CSN treatments (Figure 4B).

3.5. KEGG Pathway Enrichment Analysis of Differentially Expressed Genes (DEGs)

The KEGG enrichment analysis of the DEGs between the CSN-treated and control groups revealed that CSN markedly influenced pathways associated with carbon assimilation and energy metabolism. The most significant enrichments were observed in the “Carbon fixation by Calvin cycle”, “Carbon metabolism”, and “Starch and sucrose metabolism” pathways, underscoring the central role of CSN in regulating carbon flow and carbohydrate utilization.
Photosynthesis-related pathways were also enriched, particularly “Photosynthesis—antenna proteins”, indicating enhanced light harvesting and energy transfer. Together, these findings suggest that CSN improves photosynthetic efficiency and promotes the allocation of assimilates toward carbohydrate metabolism.
In addition, enrichment was detected in secondary metabolism pathways such as “Phenylpropanoid biosynthesis” and “Flavonoid biosynthesis”, suggesting that CSN simultaneously modulates both primary carbon metabolism and secondary metabolic adjustments to optimize growth and stress adaptation in H. compressa (Figure 5).

3.6. CSN Treatment Enhances Photosynthetic Light Reactions and Carbon Fixation Pathways in H. compressa

RNA-seq with KEGG mapping showed that CSN changed the photosynthetic transcriptome in H. compressa.
CSN increased transcripts for Photosystem II (PsbA, PsbB, PsbC, PsbD), the cytochrome b6f complex (PetB, PetC), and Photosystem I (PsaA, PsaB, PsaC), and those of electron carriers (PetE/plastocyanin, PetF/ferredoxin) and FNR also rose. Transcripts for many ATP synthase subunits (α, β, γ, δ, ε, a, b, c) were present at a higher level as well. These changes point to greater electron transport and a higher photophosphorylation capacity (Figure 6A).
Regarding carbon fixation (Figure 6B), the CSN treatments elevated enzymes involved in RuBP regeneration, including SBPase, FBPase, transketolase, transaldolase, TPI, PGK, and GAPDH. In contrast, the RuBisCO large subunit (rbcL) was lower. In the C4 pathway, PEPC increased, while Alanine aminotransferase and Malate dehydrogenase decreased. Malic enzyme isoforms showed mixed responses (Figure 6B).

3.7. CSN Regulates the Expression of Flavonoid and Phenylpropanoid Biosynthesis Pathway Genes in H. compressa

The transcriptome analysis revealed significant transcriptional changes related to secondary metabolism following the CSN treatment. The KEGG enrichment analysis indicated that genes associated with flavonoid biosynthesis, including chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonoid 3′-hydroxylase (F3H), and flavonol synthase (FLS), were significantly upregulated (Figure 7A). Conversely, genes involved in lignin biosynthesis within the phenylpropanoid pathway, notably phenylalanine ammonia-lyase (PAL), 4-coumarate-CoA ligase (4CL), cinnamyl alcohol dehydrogenase (CAD), and cytochrome P450 (CYP450) family members, exhibited significant downregulation (Figure 7B).

3.8. qRT-PCR Validation of Pathway-Representative DEGs

To validate the RNA-Seq results, we quantified seven DEGs preselected to represent the analyzed pathways: LHCB3, PETE, psaC, SBPase, CHS1, F3H, and 4CL1 (Figure 8; primers in Table 1).
Across biological replicates (n = 3 per treatment), LHCB3, PETE, psaC, and SBPase showed significantly higher transcript levels in the CSN-treated samples than in the CK-treated samples (two-sided tests, p < 0.05; Figure 8). CHS1 and F3H transcript levels were also significantly higher with the CSN treatments than with CK (p < 0.05). In contrast, 4CL1 was significantly lower in with the CSN treatments than with CK (p < 0.05).

4. Discussion

In this study, we investigated the physiological and molecular mechanisms underlying the effects of exogenous CSN application on Hemarthria compressa. Our results demonstrated that the CSN treatment significantly enhanced the photosynthetic efficiency; promoted the accumulation of chlorophyll a, chlorophyll b, and carotenoids; and improved several key nutritional traits. The transcriptome analysis further revealed that genes associated with photosynthetic light harvesting, carbon fixation, and secondary metabolism were significantly upregulated in response to CSN application. Collectively, these findings provide new insights into the multifaceted role of CSN in regulating growth and quality formation in forage grasses. As previous studies reported, CSN acted as a safe and environmentally friendly plant growth regulator capable of improving yield and stress tolerance in diverse crops [40,41]. For example, in rice (Oryza sativa) and Common bean (Phaseolus vulgaris), CSN application enhanced photosynthetic parameters, antioxidant enzyme activity, and biomass accumulation [42,43,44]. Consistent with these reports, we observed that CSN significantly increased the maximum quantum efficiency of PSII (Fv/Fm) and pigment content in H. compressa. These enhancements indicate that CSN improves light capture and energy transfer processes, thereby strengthening the photosynthetic apparatus. The enrichment of the “Photosynthesis—antenna proteins” pathway in our transcriptome data provides molecular evidence for these physiological improvements, as genes encoding light-harvesting complex proteins (LHCb1, LHCb2, LHCa1, and LHCa4) were consistently upregulated. Such findings suggest that CSN facilitates the efficient utilization of absorbed light energy to support enhanced carbon assimilation [45,46,47].
In addition to its effects on photosynthesis, CSN treatment can enhance photosynthetic carbon assimilation, with control points including Rubisco activase in the Calvin–Benson cycle and phosphoenolpyruvate carboxylase (PEPC) in the C4 carboxylation pathway [48,49]. Upregulation of these pathways is consistent with reports that nitrophenolate-based biostimulants (CSN) increase photosynthetic activity and drive biomass or grain yield gains across various crops [23,50]. Furthermore, transcriptome studies under CSN or other biostimulants show broad metabolic reprogramming, frequently involving carbohydrate pathways (starch and sucrose metabolism) [28,51], aligning with physiological observations of elevated soluble sugar contents. Enhanced carbon assimilation and carbohydrate metabolism thus provide a plausible mechanistic link to the observed increase in biomass (dry weight, DW).
Our study showed that the CSN treatment led to higher levels of soluble sugar and crude protein in forage grass, the former increase being especially important. Higher sugar levels raise digestible energy and improve dry matter digestibility through supporting the microbial breakdown of structural carbohydrates in the rumen [52,53,54]. Sugars are also critical for silage production because they act as key substrates for lactic acid fermentation [55,56]. More sugars lead to a faster decline in pH, which helps preserve nutrients, reduce dry matter loss, and suppress undesirable microorganisms. It also improves aerobic stability during storage and feeding [57,58]. Taken together, our results show that CSN enhances sugar accumulation in forage grass. This improvement strengthens both the forage nutritional value and silage quality. These results therefore highlight the potential of CSN as an effective regulator in forage production systems.
Moreover, we observed that the CSN treatment reduced both the lignin and cellulose content in plants. Because lignin and cellulose arise from distinct metabolic routes, their regulation is considered separately: lignin is derived from the phenylpropanoid/monolignol pathway, whereas cellulose is associated with carbohydrate/cell wall polysaccharide metabolism. Accordingly, lignin reduction under CSN was associated with the downregulation of phenylpropanoid genes (e.g., CAD, class III peroxidases), consistent with decreased cell wall lignification. By contrast, the decrease in cellulose likely reflected adjustments in carbon partitioning and cell wall polysaccharide metabolism downstream of enhanced assimilation, rather than phenylpropanoid regulation. CSN likely suppressed the expression of key lignin biosynthesis genes, such as cinnamyl alcohol dehydrogenase (CAD) and peroxidases. As a result, reduced lignification decreased the cell wall’s ability to act as a physical barrier and improved the availability of polysaccharides for enzymatic degradation, contributing to higher forage digestibility. At the same time, the metabolic flux associated with phenylpropanoids shifted toward flavonoid biosynthesis; therefore, the flavonoid levels increased with the CSN treatment. The increased amount of flavonoids also enhanced stress resilience through antioxidant and signaling functions. By contrast, the hemicellulose content remained stable, suggesting selective adjustment of cell wall components. These biochemical and structural modifications explained the declines in the neutral detergent fiber (NDF) and acid detergent fiber (ADF) content. Together, the results show that CSN improves the forage quality through both digestibility and stress adaptation. These changes occurred alongside increased biomass (DW) and improved forage quality indices.
The coordinated modulation of photosynthetic, carbon metabolic, and secondary metabolic pathways highlights the central role of CSN in reprogramming plant physiological networks. By simultaneously enhancing light energy capture, optimizing carbon assimilation, and reducing lignin accumulation, CSN enables H. compressa to sustain growth and maintain its nutritional quality. This integrated regulatory effect suggests that CSN could serve as an effective biostimulant in forage grass production systems, contributing to improved forage yield and nutritional quality under challenging environmental conditions.
Moreover, the enhancement of photosynthetic efficiency and carbon metabolism under CSN treatment may improve plant adaptation to abiotic stresses such as drought and salinity [23,59]. Increases in chlorophyll content and Fv/Fm indicate higher light-use efficiency and greater photosystem stability. These traits are critical for maintaining photosynthetic capacity under stress [60]. Meanwhile, the upregulation of flavonoids and the accumulation of soluble sugars help scavenge reactive oxygen species and maintain cellular osmotic balance, thereby protecting membrane integrity and key enzyme activities and stabilizing cellular homeostasis. These physiological adjustments not only support continued growth under adverse conditions but also improve silage quality and storability by preserving higher nutrient content and reducing fiber-related degradation.
Comparison with other foliar regulators such as sodium bicarbonate (NaHCO3). No study has directly compared CSN and NaHCO3 as foliar inputs under optimal, non-stress conditions. Recent chamber experiments showed that a 0.52% NaHCO3 spray increased chlorophyll (SPAD) values in tomato and pepper seedlings. The increase appeared within 48 h in tomato and within eight days in pepper [61]. This response was associated with improved nitrogen status, as higher nitrate levels were detected in both the spray and plant sap. In greenhouse and field pathosystems, NaHCO3 and related bicarbonate salts have repeatedly suppressed powdery mildew in tomato and roses [62,63]. These treatments reduced defoliation and, in some cases, improved yield indices. Collectively, these findings indicate that NaHCO3 can function as a low-cost and environmentally friendly foliar input that supports plant health primarily through its chemical and protective effects. In contrast to NaHCO3, CSN functions primarily through physiological and metabolic regulation rather than direct chemical protection. Our results show that CSN enhances photosynthesis and carbon metabolism, leading to greater growth and improved nutritional quality. A direct comparison between CSN and NaHCO3 under identical foliar protocols and optimal conditions would therefore be valuable. We have demonstrated the important role of CSN in improving forage quality; however, the physiological and metabolic differences between the two remain to be fully elucidated. In addition, there is currently no evidence that CSN is permitted for use in organic farming. Notably, CSN can increase biomass by enhancing photosynthetic efficiency, but its biosafety still requires systematic experimental validation. Overall, CSN exhibits strong potential as a biostimulant with practical value for improving both yield and quality in forage production.Nevertheless, several limitations should be acknowledged. First, the present study was conducted under controlled conditions, and the effectiveness of CSN in field environments with variable climates and soil properties remains to be validated. Second, although the transcriptome analysis provided valuable insights into CSN-responsive pathways, further functional characterization of key genes, particularly those involved in flavonoid and lignin biosynthesis, is necessary to confirm their roles in CSN-mediated regulation [64]. Finally, the potential trade-offs between enhanced nutritional quality and other agronomic traits, such as lodging resistance and biomass allocation, should be evaluated in future breeding programs [65]. Moreover, testing CSN treatments across different environmental conditions and genetic backgrounds will be crucial for assessing its robustness and applicability in diverse agroecosystems. Such studies will not only advance our understanding of CSN’s mode of action but also provide a theoretical basis for applying plant growth regulators in other forage and cereal crops to enhance resilience and productivity [66].

5. Conclusions

Foliar compound sodium nitrophenolate (CSN) application significantly enhanced biomass production and forage quality in H. compressa through coordinated physiological and transcriptional responses. CSN boosted photosynthetic efficiency by increasing light harvesting (elevated chlorophyll, carotenoid, and Fv/Fm) and carbon assimilation (enhanced PEPC/Rubisco activity and soluble sugars), leading to vigorous growth. Concurrently, CSN modulated secondary metabolism, reducing the lignin and fiber content while increasing crude protein and soluble carbohydrates, thereby improving forage digestibility and nutritional value. These results demonstrate CSN’s efficacy as a practical biostimulant for improving both the yield and quality of C4 forage grasses (Figure 9).

Author Contributions

Conceptualization, Z.L. and P.H.; methodology, F.H.; software, Y.W.; validation, R.Z.; formal analysis, P.H.; data curation, C.D.; writing—original draft preparation, Z.L.; writing—review and editing, W.W.; funding acquisition, C.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Forestry Science and Technology Innovation and Promotion Project of Jiangsu Province (LYK[2022]23) and Chinese Academy of Tropical Agricultural Sciences for Science and Technology Innovation Team of National Tropical Agricultural Science Center (NO.CATASCXTD202503).

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

The authors utilized GPT-5.0 (San Francisco, CA, USA) by OpenAI solely for the purpose of checking and correcting spelling, grammar, and punctuation. The scientific content and intellectual substance of the work remain entirely the responsibility of the authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Yan, Y.-H.; Li, J.-L.; Zhang, X.-Q.; Yang, W.-Y.; Wan, Y.; Ma, Y.-M.; Zhu, Y.-Q.; Peng, Y.; Huang, L.-K. Effect of naphthalene acetic acid on adventitious root development and associated physiological changes in stem cutting of Hemarthria compressa. PLoS ONE 2014, 9, e90700. [Google Scholar] [CrossRef] [Scilit]
  2. Zhang, J.; Huang, X.; Huang, D.-j.; Zhang, Y.; Huang, L.-k.; Lu, L.; Yan, H.-d. Studies on genetic diversity and phylogenetic relationships of limpograss (Hemarthria altissima) and related species based on combined chloroplast DNA intergenic spacer data. Biochem. Syst. Ecol. 2016, 69, 91–100. [Google Scholar] [CrossRef] [Scilit]
  3. Langdale, J.A. C4 cycles: Past, present, and future research on C4 photosynthesis. Plant Cell 2011, 23, 3879–3892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Nelson, T. The grass leaf developmental gradient as a platform for a systems understanding of the anatomical specialization of C4 leaves. J. Exp. Bot. 2011, 62, 3039–3048. [Google Scholar] [CrossRef] [Scilit]
  5. Chen, Y.; Huang, L.; Yan, H.; Zhang, X.; Xu, B.; Ma, X. Cloning and characterization of an ABA-independent DREB transcription factor gene, HcDREB2, in Hemarthria compressa. Hereditas 2016, 153, 3. [Google Scholar] [CrossRef] [Scilit]
  6. Huang, L.; Zhang, X.; Xie, W.; Zhang, J.; Cheng, L.; Yan, H. Molecular diversity and population structure of the forage grass Hemarthria compressa (Poaceae) in south China based on SRAP markers. Genet. Mol. Res. 2012, 11, 2441–2450. [Google Scholar] [CrossRef] [Scilit]
  7. Huang, X.; Yan, H.-D.; Zhang, X.-Q.; Zhang, J.; Frazier, T.P.; Huang, D.-J.; Lu, L.; Huang, L.-K.; Liu, W.; Peng, Y. De novo transcriptome analysis and molecular marker development of two Hemarthria species. Front. Plant Sci. 2016, 7, 496. [Google Scholar] [CrossRef] [Scilit]
  8. Guo, Z.-H.; Fu, K.-X.; Zhang, X.-Q.; Bai, S.-Q.; Fan, Y.; Peng, Y.; Huang, L.-K.; Yan, Y.-H.; Liu, W.; Ma, X. Molecular insights into the genetic diversity of Hemarthria compressa germplasm collections native to southwest China. Molecules 2014, 19, 21541–21559. [Google Scholar] [CrossRef] [Scilit]
  9. Jing, H.; Xue, X.; Zhang, X.; Xu, X.; Tang, Y.; Wang, H.; Zheng, J.; Yang, H.; Han, Y. Metabolomics and microbiome analysis elucidate the detoxification mechanisms of Hemarthria compressa, a low cadmium accumulating plant, in response to cadmium stress. J. Hazard. Mater. 2025, 487, 137226. [Google Scholar] [CrossRef] [Scilit]
  10. Li, W.; Zhou, X.; Qu, M.; Zheng, Y.; Shen, B.; Zeng, B.; Feng, Y.; Pang, K.; Wu, J.; Zeng, B. WGCNA analysis reveals hub genes in the Hemarthria compressa roots in response to waterlogging stress. Sci. Rep. 2025, 15, 13841. [Google Scholar] [CrossRef] [Scilit]
  11. Zhang, Q.; Bell, L.W.; Shen, Y.; Whish, J.P. Indices of forage nutritional yield and water use efficiency amongst spring-sown annual forage crops in north-west China. Eur. J. Agron. 2018, 93, 1–10. [Google Scholar]
  12. Capstaff, N.M.; Miller, A.J. Improving the yield and nutritional quality of forage crops. Front. Plant Sci. 2018, 9, 535. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Xu, L.; Tang, G.; Wu, D.; Zhang, J. Yield and nutrient composition of forage crops and their effects on soil characteristics of winter fallow paddy in South China. Front. Plant Sci. 2024, 14, 1292114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Sun, B.; Yuan, S.; Naser, M.; Zhou, Y.; Jia, H.; Yu, Y.; Yao, X.; Wu, T.; Song, W.; Jiang, B. Evaluation of forage quality in various soybean varieties and high-yield cultivation techniques. Field Crops Res. 2024, 317, 109546. [Google Scholar]
  15. Rehman, M.A.U.; Zulfiqar, Z. Techniques for Evaluating the Nutritional Profile and Digestibility of Animal Feedstuffs by Different Laboratory Methods. Appl. Anim. Sci. Bull. 2024, 1, 1–10. [Google Scholar]
  16. Devi, A.; Sharma, M.; Badola, R.; Hussain, S.A. Unveiling the mysteries of Asian herbivores resource partitioning in tropical wet-grassland ecosystem. Glob. Ecol. Conserv. 2024, 54, e03079. [Google Scholar] [CrossRef] [Scilit]
  17. Shen, B.; Li, W.; Zheng, Y.; Zhou, X.; Zhang, Y.; Qu, M.; Wang, Y.; Yuan, Y.; Pang, K.; Feng, Y. Morphological and molecular response mechanisms of the root system of different Hemarthria compressa species to submergence stress. Front. Plant Sci. 2024, 15, 1342814. [Google Scholar] [CrossRef] [Scilit]
  18. Huang, L.; Zhang, Y.; Zhang, J.; Zhang, X.; Xie, W.; Jiang, X.; Peng, F.; Yan, Y.; Ma, X.; Liu, W. Genetic stability and DNA fingerprinting of the Hemarthria compressa cultivar “Guangyi”. Biochem. Syst. Ecol. 2014, 55, 310–316. [Google Scholar] [CrossRef] [Scilit]
  19. Chen, H.; Chen, H.; Hu, L.; Wang, L.; Wang, S.; Wang, M.L.; Cheng, X. Genetic diversity and a population structure analysis of accessions in the Chinese cowpea [Vigna unguiculata (L.) Walp.] germplasm collection. Crop J. 2017, 5, 363–372. [Google Scholar] [CrossRef] [Scilit]
  20. Lin, F.; Jing, H.; Xue, X.; Wu, F.; Zhou, H.; Guan, Y.; Wang, H.; Han, Y. Physiology and metabolomics reveal the accumulation patterns and tolerance mechanisms of energy grass Hybrid Pennisetum under elevated Cadmium stress. Ind. Crops Prod. 2025, 232, 121274. [Google Scholar] [CrossRef] [Scilit]
  21. Meena, D.C.; Birthal, P.S.; Kumara, T.K. Biostimulants for sustainable development of agriculture: A bibliometric content analysis. Discov. Agric. 2025, 3, 2. [Google Scholar] [CrossRef] [Scilit]
  22. Liao, R.; Zhang, W.; Xu, R.; Li, K.; Wei, W.; Sheng, R. Endophytic microbial communities and functional shifts in Hemarthria compressa grass in response to Silicon and Selenium amendment. BMC Plant Biol. 2025, 25, 169. [Google Scholar] [CrossRef] [Scilit]
  23. Przybysz, A.; Gawrońska, H.; Gajc-Wolska, J. Biological mode of action of a nitrophenolates-based biostimulant: Case study. Front. Plant Sci. 2014, 5, 713. [Google Scholar] [CrossRef] [Scilit]
  24. Abood, N.M.; Mirare, S.S. Effect of seed soaking with a growth regulator (atonik) and seeding dates on the vegetative growth characteristics of Sorghum bicolor L. Iraqi J. Agric. Sci. 2024, 55, 951–961. [Google Scholar]
  25. Batool, Z.; Ishfaq, M.; Akbar, N.; Zulfiqar, U.; Anjum, S.A.; Shafiq, M.; Nazir, S.; Aziz, A. Exogenous application of Atonik (sodium nitrophenolate) under skip irrigation regimes modulated the physiology, growth and productivity of Zea mays L. Arch. Agron. Soil Sci. 2023, 69, 2325–2339. [Google Scholar]
  26. Yueshan, J.; Sun, M.; Yansu, L.; Xiaojie, F.; Menglu, L.; Aokun, S.; Chaoxing, H.; Yan, Y.; Jun, W.; Xianchang, Y. Sodium nitrophenolate mediates brassinosteroids signaling to enhance cold tolerance of cucumber seedling. Plant Physiol. Biochem. 2024, 206, 108317. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Wang, L.; Zheng, J.; Zhou, G.; Li, J.; Qian, C.; Lin, G.; Li, Y.; Zuo, Q. Moderate nitrogen application improved salt tolerance by enhancing photosynthesis, antioxidants, and osmotic adjustment in rapeseed (Brassica napus L.). Front. Plant Sci. 2023, 14, 1196319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Zhou, M.; Di, Q.; Yan, Y.; He, C.; Wang, J.; Li, Y.; Yu, X.; Sun, M. Multi-omics reveal the molecular mechanisms of Sodium Nitrophenolate in enhancing cold tolerance through hormonal and antioxidant pathways in cucumber. Plant Physiol. Biochem. 2025, 223, 109836. [Google Scholar] [CrossRef] [Scilit]
  29. Dong, Z.; Huang, J.; Qi, T.; Fu, Q.; Meng, A.; Fu, Y. Effects of plant regulators on the seed germination and antioxidant enzyme activity of cotton under compound salt stress. Plants 2023, 12, 4112. [Google Scholar] [CrossRef] [Scilit]
  30. Hristov, A.; Mertens, D.; Zaman, S.; Vander Pol, M.; Price, W. Variability in feed and total mixed ration neutral detergent fiber and crude protein analyses among commercial laboratories. J. Dairy Sci. 2010, 93, 5348–5362. [Google Scholar] [CrossRef] [Scilit]
  31. Jančík, F.; Koukolová, V.; Homolka, P.; Haman, J. Comparison of analyses to predict ruminal fibre degradability and indigestible fibre in temperate grass silages. S. Afr. J. Anim. Sci. 2011, 41, 297–308. [Google Scholar] [CrossRef] [Scilit]
  32. Cassida, K.; Turner, K.; Foster, J.; Hesterman, O. Comparison of detergent fiber analysis methods for forages high in pectin. Anim. Feed Sci. Technol. 2007, 135, 283–295. [Google Scholar] [CrossRef] [Scilit]
  33. Liu, J.; Hao, J.; Zhao, M.; Yan, X.; Jia, Y.; Wang, Z.; Ge, G. Effects of different temperature and density on quality and microbial population of wilted alfalfa silage. BMC Microbiol. 2024, 24, 380. [Google Scholar] [CrossRef] [Scilit]
  34. Zou, Y.; Dong, S.; Du, Y.; Li, S.; Wang, Y.; Cao, Z. Effects of moisture content or particle size on the in situ degradability of maize silage and alfalfa haylage in lactating dairy cows. Anim. Nutr. 2016, 2, 249–252. [Google Scholar] [CrossRef] [Scilit]
  35. Hall, M.B.; Mertens, D.R. Comparison of alternative neutral detergent fiber methods to the AOAC definitive method. J. Dairy Sci. 2023, 106, 5364–5378. [Google Scholar] [CrossRef] [Scilit]
  36. Conesa, A.; Götz, S.; García-Gómez, J.M.; Terol, J.; Talón, M.; Robles, M. Blast2GO: A universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 2005, 21, 3674–3676. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Cantalapiedra, C.P.; Hernández-Plaza, A.; Letunic, I.; Bork, P.; Huerta-Cepas, J. eggNOG-mapper v2: Functional annotation, orthology assignments, and domain prediction at the metagenomic scale. Mol. Biol. Evol. 2021, 38, 5825–5829. [Google Scholar] [CrossRef] [Scilit]
  39. Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. clusterProfiler: An R package for comparing biological themes among gene clusters. Omics J. Integr. Biol. 2012, 16, 284–287. [Google Scholar] [CrossRef] [Scilit]
  40. He, Z.; Zhou, M.; Feng, X.; Di, Q.; Meng, D.; Yu, X.; Yan, Y.; Sun, M.; Li, Y. The role of brassinosteroids in plant cold stress response. Life 2024, 14, 1015. [Google Scholar] [CrossRef] [Scilit]
  41. Huang, Y.; Cai, S.; Ruan, X.; Xu, J.; Cao, D. CSN improves seed vigor of aged sunflower seeds by regulating the fatty acid, glycometabolism, and abscisic acid metabolism. J. Adv. Res. 2021, 33, 1–13. [Google Scholar] [CrossRef] [Scilit]
  42. Quintero-Calderon, E.H.; Sanchez-Reinoso, A.D.; Chavez-Arias, C.C.; Garces-Varon, G.; Restrepo-Diaz, H. Rice seedlings showed a higher heat tolerance through the foliar application of biostimulants. Not. Bot. Horti Agrobot. Cluj-Napoca 2021, 49, 12120. [Google Scholar] [CrossRef] [Scilit]
  43. Banful, B.K.; Attivor, D. Growth and yield response of two hybrid rice cultivars to ATONIK plant growth regulator in a Tropical environment. Environ. Earth Ecol. 2017, 1, 33–45. [Google Scholar] [CrossRef] [Scilit]
  44. Kocira, A.; Kocira, S.; Świeca, M.; Złotek, U.; Jakubczyk, A.; Kapela, K. Effect of foliar application of a nitrophenolate–based biostimulant on the yield and quality of two bean cultivars. Sci. Hortic. 2017, 214, 76–82. [Google Scholar] [CrossRef] [Scilit]
  45. Sherin, G.; Aswathi, K.R.; Puthur, J.T. Photosynthetic functions in plants subjected to stresses are positively influenced by priming. Plant Stress 2022, 4, 100079. [Google Scholar] [CrossRef] [Scilit]
  46. Wu, R.; Ran, K.; Zhao, S.; Cheng, F. Genome-wide identification of the light-harvesting chlorophyll A/b binding protein gene family in Pyrus bretschneideri and their transcriptomic features under drought stress. Horticulturae 2023, 9, 522. [Google Scholar] [CrossRef] [Scilit]
  47. Xiang, P.; Marat, T.; Huang, J.; Cheng, B.; Liu, J.; Wang, X.; Wu, L.; Tan, M.; Zhu, Q.; Lin, J. Response of photosynthetic capacity to ecological factors and its relationship with EGCG biosynthesis of tea plant (Camellia sinensis). BMC Plant Biol. 2025, 25, 199. [Google Scholar] [CrossRef] [Scilit]
  48. Carvalho, P.; Gomes, C.; Saibo, N.J. C4 Phosphoenolpyruvate Carboxylase: Evolution and transcriptional regulation. Genet. Mol. Biol. 2023, 46, e20230190. [Google Scholar] [CrossRef] [Scilit]
  49. Chen, J.-H.; Tang, M.; Jin, X.-Q.; Li, H.; Chen, L.-S.; Wang, Q.-L.; Sun, A.-Z.; Yi, Y.; Guo, F.-Q. Regulation of Calvin–Benson cycle enzymes under high temperature stress. Abiotech 2022, 3, 65–77. [Google Scholar]
  50. Szparaga, A.; Kocira, S.; Kocira, A.; Czerwińska, E.; Świeca, M.; Lorencowicz, E.; Kornas, R.; Koszel, M.; Oniszczuk, T. Modification of growth, yield, and the nutraceutical and antioxidative potential of soybean through the use of synthetic biostimulants. Front. Plant Sci. 2018, 9, 1401. [Google Scholar] [CrossRef] [Scilit]
  51. Du Jardin, P. Plant biostimulants: Definition, concept, main categories and regulation. Sci. Hortic. 2015, 196, 3–14. [Google Scholar] [CrossRef] [Scilit]
  52. Klevenhusen, F.; Zebeli, Q. A review on the potentials of using feeds rich in water-soluble carbohydrates to enhance rumen health and sustainability of dairy cattle production. J. Sci. Food Agric. 2021, 101, 5737–5746. [Google Scholar]
  53. Weimer, P.J. Degradation of cellulose and hemicellulose by ruminal microorganisms. Microorganisms 2022, 10, 2345. [Google Scholar] [CrossRef] [Scilit]
  54. Chen, H.; Wang, C.; Huasai, S.; Chen, A. Effects of dietary forage to concentrate ratio on nutrient digestibility, ruminal fermentation and rumen bacterial composition in Angus cows. Sci. Rep. 2021, 11, 17023. [Google Scholar] [CrossRef] [Scilit]
  55. Zhao, X.; Sun, Y.; Chang, Z.; Yao, B.; Han, Z.; Wang, T.; Shang, N.; Wang, R. Innovative Lactic Acid Production Techniques Driving Advances in Silage Fermentation. Fermentation 2024, 10, 533. [Google Scholar] [CrossRef] [Scilit]
  56. Guo, X.; Xu, D.; Li, F.; Bai, J.; Su, R. Current approaches on the roles of lactic acid bacteria in crop silage. Microb. Biotechnol. 2023, 16, 67–87. [Google Scholar]
  57. Wang, D.; Luo, C.; Li, C.; Zhang, S.; Lu, N.; Yang, Z.; Yu, X.; Cao, Z.; Yang, H.; Li, S. Study on the relationship between fermentation-accumulated temperature and nutrient loss of whole-plant corn silage. Agronomy 2022, 12, 2752. [Google Scholar]
  58. Yan, Y.; Zhao, M.; Sun, P.; Zhu, L.; Yan, X.; Hao, J.; Si, Q.; Wang, Z.; Jia, Y.; Wang, M. Effects of different additives on fermentation characteristics, nutrient composition and microbial communities of Leymus chinensis silage. BMC Microbiol. 2025, 25, 296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Rouphael, Y.; Colla, G. Biostimulants in agriculture. Front. Media SA 2020, 11, 40–42. [Google Scholar]
  60. Di Sario, L.; Boeri, P.; Matus, J.T.; Pizzio, G.A. Plant biostimulants to enhance abiotic stress resilience in crops. Int. J. Mol. Sci. 2025, 26, 1129. [Google Scholar] [CrossRef] [Scilit]
  61. Massimi, M.; Radócz, L.; Kabashi, B. The response of chlorophyll content and ionic composition in tomato and pepper seedlings to foliar nutrition in growing chambers. Agronomy 2023, 13, 2234. [Google Scholar] [CrossRef] [Scilit]
  62. Ehret, D.; Utkhede, R.; Frey, B.; Menzies, J.; Bogdanoff, C. Foliar applications of fertilizer salts inhibit powdery mildew on tomato. Can. J. Plant Pathol. 2002, 24, 437–444. [Google Scholar]
  63. Horst, R.; Kawamoto, S.; Porter, L. Effect of sodium bicarbonate and oils on the control of powdery mildew and black spot of roses. Plant Dis. 1992, 76, 247–251. [Google Scholar] [CrossRef] [Scilit]
  64. Shi, J.; Yan, X.; Sun, T.; Shen, Y.; Shi, Q.; Wang, W.; Bao, M.; Luo, H.; Nian, F.; Ning, G. Homeostatic regulation of flavonoid and lignin biosynthesis in phenylpropanoid pathway of transgenic tobacco. Gene 2022, 809, 146017. [Google Scholar] [CrossRef] [Scilit]
  65. Xie, M.; Zhang, J.; Tschaplinski, T.J.; Tuskan, G.A.; Chen, J.-G.; Muchero, W. Regulation of lignin biosynthesis and its role in growth-defense tradeoffs. Front. Plant Sci. 2018, 9, 1427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  66. Gao, J.; Zhang, Y.; Xu, C.; Wang, X.; Wang, P.; Huang, S. Abscisic acid collaborates with lignin and flavonoid to improve pre-silking drought tolerance by tuning stem elongation and ear development in maize (Zea mays L.). Plant J. 2023, 114, 437–454. [Google Scholar] [PubMed]
Figure 1. Phenotypic effects of compound sodium nitrophenolate (CSN) treatments and the control group (CK) on the morphological development of H. compressa at 30 days. From left to right: CK, CSN1 (1.0 mg/mL), CSN2 (2.0 mg/mL), and CSN3 (3.0 mg/mL).
Figure 1. Phenotypic effects of compound sodium nitrophenolate (CSN) treatments and the control group (CK) on the morphological development of H. compressa at 30 days. From left to right: CK, CSN1 (1.0 mg/mL), CSN2 (2.0 mg/mL), and CSN3 (3.0 mg/mL).
Agronomy 15 02526 g001
Figure 2. Effects of compound sodium nitrophenolate (CSN) treatments on morphological traits of H. compressa. (A) Plant height, (B) number of tillers, (C) leaf length, (D) leaf width, (E) shoot dry weight (DW), and (F) root weight with CK and different CSN concentrations (CSN1: 1.0 mg/mL, CSN2: 2.0 mg/mL, CSN3: 3.0 mg/mL). Different letters above the bars indicate statistically significant differences among treatments according to Duncan’s multiple range test (p < 0.05). Error bars represent standard errors (SE) of the means.
Figure 2. Effects of compound sodium nitrophenolate (CSN) treatments on morphological traits of H. compressa. (A) Plant height, (B) number of tillers, (C) leaf length, (D) leaf width, (E) shoot dry weight (DW), and (F) root weight with CK and different CSN concentrations (CSN1: 1.0 mg/mL, CSN2: 2.0 mg/mL, CSN3: 3.0 mg/mL). Different letters above the bars indicate statistically significant differences among treatments according to Duncan’s multiple range test (p < 0.05). Error bars represent standard errors (SE) of the means.
Agronomy 15 02526 g002
Figure 3. Effects of compound sodium nitrophenolate (CSN) treatments on photosynthetic parameters of H. compressa. (A) Chlorophyll a content, (B) chlorophyll b content, (C) chlorophyll a/b ratio, (D) total chlorophyll content, (E) carotenoid content, (F) Fv/Fm, (G) PEPC activity, and (H) Rubisco activity under control group (CK) and CSN1 (1.0 mg/mL), CSN2 (2.0 mg/mL), and CSN3 (3.0 mg/mL) treatments. Different letters above the bars indicate statistically significant differences among treatments according to Duncan’s multiple range test (p < 0.05). Error bars represent standard errors (SE) of the means.
Figure 3. Effects of compound sodium nitrophenolate (CSN) treatments on photosynthetic parameters of H. compressa. (A) Chlorophyll a content, (B) chlorophyll b content, (C) chlorophyll a/b ratio, (D) total chlorophyll content, (E) carotenoid content, (F) Fv/Fm, (G) PEPC activity, and (H) Rubisco activity under control group (CK) and CSN1 (1.0 mg/mL), CSN2 (2.0 mg/mL), and CSN3 (3.0 mg/mL) treatments. Different letters above the bars indicate statistically significant differences among treatments according to Duncan’s multiple range test (p < 0.05). Error bars represent standard errors (SE) of the means.
Agronomy 15 02526 g003
Figure 4. PCA and differential gene expression in H. compressa under CSN treatment: (A) PCA shows distinct clustering of CK and CSN samples; (B) volcano plot highlights DEGs (padj < 0.05, |log2FC| ≥ 1), with red indicating upregulated genes, yellow indicating downregulated genes, and gray indicating non-significant genes.
Figure 4. PCA and differential gene expression in H. compressa under CSN treatment: (A) PCA shows distinct clustering of CK and CSN samples; (B) volcano plot highlights DEGs (padj < 0.05, |log2FC| ≥ 1), with red indicating upregulated genes, yellow indicating downregulated genes, and gray indicating non-significant genes.
Agronomy 15 02526 g004
Figure 5. KEGG enrichment analysis of differentially expressed genes (DEGs) between CSN-treated and control (CK) groups.
Figure 5. KEGG enrichment analysis of differentially expressed genes (DEGs) between CSN-treated and control (CK) groups.
Agronomy 15 02526 g005
Figure 6. Transcriptomic activation of photosynthesis and carbon fixation pathways in H. compressa under CSN treatment. (A) Photosynthesis. (B) Carbon fixation via the Calvin cycle. Colors indicate the expression levels of genes, with red representing up-regulation and green representing down-regulation.
Figure 6. Transcriptomic activation of photosynthesis and carbon fixation pathways in H. compressa under CSN treatment. (A) Photosynthesis. (B) Carbon fixation via the Calvin cycle. Colors indicate the expression levels of genes, with red representing up-regulation and green representing down-regulation.
Agronomy 15 02526 g006
Figure 7. Transcriptomic analysis of secondary metabolism pathways in H. compressa under CSN treatment. (A) Flavonoid biosynthesis pathway with significantly upregulated genes highlighted in red. (B) Phenylpropanoid biosynthesis pathway with significantly downregulated genes indicated in green. Colors indicate the expression levels of genes, with red representing up-regulation and green representing down-regulation.
Figure 7. Transcriptomic analysis of secondary metabolism pathways in H. compressa under CSN treatment. (A) Flavonoid biosynthesis pathway with significantly upregulated genes highlighted in red. (B) Phenylpropanoid biosynthesis pathway with significantly downregulated genes indicated in green. Colors indicate the expression levels of genes, with red representing up-regulation and green representing down-regulation.
Agronomy 15 02526 g007
Figure 8. Relative transcript levels (n = 3; mean ± SE) for LHCB3, PETE, psaC, SBPase, CHS1, F3H, and 4CL1 with CSN vs. CK treatments; asterisks denote p < 0.05. Z-scores represent standardized expression values, where red and blue indicate higher and lower relative expression levels, respectively.
Figure 8. Relative transcript levels (n = 3; mean ± SE) for LHCB3, PETE, psaC, SBPase, CHS1, F3H, and 4CL1 with CSN vs. CK treatments; asterisks denote p < 0.05. Z-scores represent standardized expression values, where red and blue indicate higher and lower relative expression levels, respectively.
Agronomy 15 02526 g008
Figure 9. Schematic representation of physiological responses in H. compressa to CSN treatment, highlighting enhanced photosynthesis, carbon assimilation, biomass accumulation, and improved forage quality.
Figure 9. Schematic representation of physiological responses in H. compressa to CSN treatment, highlighting enhanced photosynthesis, carbon assimilation, biomass accumulation, and improved forage quality.
Agronomy 15 02526 g009
Table 1. Primers.
Table 1. Primers.
Gene NameForward Primer (5′-3′)Reverse Primer (5′-3′)
LHCB3GCCATGGGACGTGCTGCTGTACGAGGACGAGGTGCCCAGC
PETECGAGCCCAGCGAGTTCACAGGAGTACCTCAACGCGCGG
psaCTTCAAGAACAACTTCGGGCGGCAAGGTCACCGTCAACC
SBPaseCACCCATGTAGCTCCACTCTGATTTGTGTCCATGTATGTA
4CL1GAAGGTAAATGGCAGCATACCATTGGAGAAGGGAAGA
CHS1AGGGCAACATTCGATAACGGAGGAATGGTTCCCGATGT
F3HAGCTCATCAACTACTACGTAGGTGGCGCCTCTGGGCTTGT
Table 2. Nutritional composition and fiber content of H. compressa under different concentrations of compound sodium nitrophenolate (CSN).
Table 2. Nutritional composition and fiber content of H. compressa under different concentrations of compound sodium nitrophenolate (CSN).
TermsCKCSN1CSN2CSN3
Crude protein (mg/g DW)147.3 ± 2.5 c163.5 ± 3.0 b177.6 ± 2.8 a172.5 ± 2.3 a
Moisture content (% initial FW)85.73 ± 0.284.23 ± 0.385.78 ± 0.386.20 ± 0.2
Lignin (mg/g DW)130.53 ± 1.5 a106.3 ± 1.4 b110.20 ± 1.3 b109.51 ± 1.6 b
Hemicellulose (mg/g DW)217.52 ± 3.2215.94 ± 3.1211.07 ± 2.9223.32 ± 3.0
NDF (% DW)70.59 ± 1.2 a60.59 ± 1.3 b61.40 ± 1.1 b62.53 ± 1.2 b
ADF (% DW)38.31 ± 1.0 a33.92 ± 1.1 b32.88 ± 1.0 b33.81 ± 1.0 b
Ash content (% DW)8.53 ± 0.5 c9.88 ± 0.4 b11.48 ± 0.3 a11.22 ± 0.4 a
Different letters above the following the mean values indicate statistically significant differences among treatments according to Duncan’s multiple range test (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, Z.; Han, P.; Zhao, R.; Wu, Y.; Wei, W.; He, F.; Dong, C. Compound Sodium Nitrophenolate (CSN) Improves Photo-Synthesis and Forage Quality in Hemarthria compressa. Agronomy 2025, 15, 2526. https://doi.org/10.3390/agronomy15112526

AMA Style

Liu Z, Han P, Zhao R, Wu Y, Wei W, He F, Dong C. Compound Sodium Nitrophenolate (CSN) Improves Photo-Synthesis and Forage Quality in Hemarthria compressa. Agronomy. 2025; 15(11):2526. https://doi.org/10.3390/agronomy15112526

Chicago/Turabian Style

Liu, Zhongpeng, Peng Han, Ruijie Zhao, Yuanyuan Wu, Wenxuan Wei, Fahui He, and Chenfei Dong. 2025. "Compound Sodium Nitrophenolate (CSN) Improves Photo-Synthesis and Forage Quality in Hemarthria compressa" Agronomy 15, no. 11: 2526. https://doi.org/10.3390/agronomy15112526

APA Style

Liu, Z., Han, P., Zhao, R., Wu, Y., Wei, W., He, F., & Dong, C. (2025). Compound Sodium Nitrophenolate (CSN) Improves Photo-Synthesis and Forage Quality in Hemarthria compressa. Agronomy, 15(11), 2526. https://doi.org/10.3390/agronomy15112526

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop