Next Article in Journal
EAG-YOLOv11n: An Efficient Attention-Guided Network for Rice Leaf Disease Detection
Previous Article in Journal
Mapping of a Major Locus for Resistance to Yellow Rust in Wheat
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 15
Issue 11
10.3390/agronomy15112515
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Functional Analysis of Key Transporter Genes Involved in Cadmium Uptake and Translocation in Wheat

by
Na Liu
1,2,
Chaodong Yang
1,
Yi Wang
1,
Yonghui Lv
1,
Yixiu Wang
1,
Qing Wang
1,
Yuenan Li
1,
Yuanyuan Chen
1,
Haibo Zhang
1,2,
Hongyan Cheng
1,2,* and
Jiulan Dai
3,*
1
College of Resource and Environment, Shanxi Agricultural University, Taigu 030801, China
2
Soil Health Laboratory in Shanxi Province, Taiyuan 030031, China
3
Environment Research Institute, Shandong University, Qingdao 266237, China
*
Authors to whom correspondence should be addressed.
Agronomy 2025, 15(11), 2515; https://doi.org/10.3390/agronomy15112515
Submission received: 20 September 2025 / Revised: 18 October 2025 / Accepted: 27 October 2025 / Published: 29 October 2025
(This article belongs to the Section Plant-Crop Biology and Biochemistry)
Browse Figures
Versions Notes

Abstract

While the molecular mechanisms of cadmium (Cd) uptake are well-studied in rice and tobacco, hexaploid wheat remains less explored. Elucidating the roles of transporter genes in Cd uptake and translocation in wheat is critical for minimizing Cd accumulation in grains. This study compared the differences in the expression levels of Cd transporter families (including the natural resistance-associated macrophage protein (NRAMP), heavy metal ATPase (HMA), zinc-regulated transporter/iron-regulated transporter (ZIP), and yellow stripe-like (YSL) families) between two high Cd-accumulating wheat varieties and two low Cd-accumulating wheat varieties using qPCR. We found that low Cd-accumulating wheat varieties had higher expression levels of TaNRAMP5 and TaHMA2 in roots and TaHMA3 in aboveground tissues, and lower expression levels of TaNRAMP6, TaZIP5, and TaYSL6 in both roots and aboveground tissues compared to the high Cd-accumulating wheat varieties. Mantel test analysis revealed that the root expression levels of TaNRAMP5 and TaNRAMP6 and aboveground expression levels of TaZIP6 and TaHMA2 were significantly correlated with the Cd content of wheat tissues. Furthermore, the expression levels of TaZIP5 in roots and TaZIP5 and TaHMA3 in aboveground tissues were significantly correlated with the Cd translocation factor from roots to aboveground tissues, suggesting that TaNRAMP5, TaNRAMP6, TaZIP6, and TaHMA2 played key roles in Cd uptake and accumulation in wheat, and TaZIP5 and TaHMA3 were closely associated with Cd translocation from roots to aboveground tissues. Compared to low Cd-accumulating varieties, high Cd-accumulating wheat varieties exhibit significantly elevated levels of thiol-containing compounds for Cd chelation, including glutathione (7.65%~75.5% higher), phytochelatins (2.35%~47.2% higher), and non-protein thiols (13.2%~37.1% higher). These findings deepen insights into wheat Cd absorption processes. The identified transporter genes could serve as foundational resources for future breeding strategies aimed at reducing Cd accumulation in wheat, pending further functional validation.

1. Introduction

Soil heavy metal pollution, especially cadmium (Cd), is a global environmental challenge for the 21st century [1]. The average soil Cd concentrations in some agricultural fields in countries including China, the United States, Algeria, and India far exceed the maximum levels set by the World Health Organization (WHO) [2,3,4,5]. In China, Cd contamination ranks first among inorganic soil pollutants, and the area of Cd-contaminated farmland has reached 2.5 × 105 hm2, dominated by light to moderate contamination [6,7]. In recent years, ongoing industrial and agricultural inputs drive a consistent annual increase in soil Cd concentrations, averaging 4 μg kg−1 [1,8,9]. Elevated Cd levels in soil endanger crop safety through the food chain [10,11]. Wheat is a staple food for nearly 50% of the world’s population, with an annual global production of more than 750 million tons [12]. Compared with rice and maize, wheat usually shows a higher capacity for Cd accumulation [13]. Recent studies have confirmed that the Cd content of wheat grain in many areas exceeds the permissible limit of 0.1 mg kg−1 (GB2762, 2017). In some typical farmland areas, the proportion of Cd in wheat grains that exceeds the standard can reach 100% [14]. Food security and sustainable agricultural development are of paramount importance, and guaranteeing wheat safety from Cd-contaminated farmland is therefore imperatively needed.
For decades, environmentalists have investigated how to remediate Cd-contaminated farmland [15,16,17,18]. Planting low Cd-accumulating varieties emerges as a key strategy, valued for its economic viability and in situ applicability [10]. Numerous studies have confirmed that the Cd accumulation capacity varies widely among wheat varieties. In an acidic farmland (pH 5.90) with slight Cd contamination (soil total Cd of 0.322 mg kg−1), we planted 72 wheat varieties with grain Cd contents that ranged from 0.061 mg kg−1 to 0.157 mg kg−1. Screening and planting low Cd-accumulating wheat varieties can achieve safe wheat consumption [19]. Hu et al. [20] found that the grain Cd contents of 14 wheat varieties grown on Cd-contaminated farmland (soil total Cd of 1.63 mg kg−1, pH 6.60) differed, ranging from 0.186 mg kg−1 to 1.071 mg kg−1, with a difference of 0.885 mg kg−1 between the maximum and minimum contents. The genetic and physiological basis governing the variation in Cd accumulation among wheat cultivars remains to be fully elucidated. Extensive research has suggested that the differences in Cd accumulation in wheat varieties may be due to the differences in rhizosphere secretions [21], rhizosphere microbial communities [22], the ability of roots to absorb Cd from the soil, and the ability of roots to transport Cd to the aboveground [21]. However, less research has focused on the differences in Cd transporter proteins among wheat varieties, which is crucial for breeding low Cd-accumulating wheat varieties.
Cd transporter proteins are crucial for Cd accumulation in plants. Many transporters associated with Cd uptake and translocation have been identified in model plants [23,24]. Natural resistance-associated macrophage protein (NRAMP) is a crucial trans-membrane protein that can transport multiple divalent metal ions, such as Cd, iron (Fe), and manganese (Mn) [25,26,27]. NtNRAMP5 and NtNRAMP6 have been found to play important functions in Cd uptake in tobacco [28,29]. The transporters OsNRAMP1 and OsNRAMP5 are involved in Cd accumulation and tolerance in rice [30,31]. In addition, the overexpression of NRAMP5 reduced Cd accumulation [28], while the overexpression of NRAMP1 increased Cd accumulation in crops [32]. Heavy metal ATPase (HMA) and zinc-regulated transporter/iron-regulated transporter (ZIP) families regulate the translocation of Cd from the roots to the aboveground parts of plants via the xylem [33,34]. Cheng et al. [35] demonstrated that the overexpression of OsHMA2 facilitated the translocation of Cd from rice roots to the aboveground tissues, while the vacuolar compartmentalization of Cd was attenuated by downregulation of OsHMA3. Transgenic expression of SmZIP in tobacco enhanced Cd accumulation and translocation with concomitant alterations in ionic speciation and vacuolar sequestration patterns [36]. OsZIP6 has been demonstrated to be involved in the translocation of Cd from the roots to the aboveground as well as grain Cd distribution in rice [37]. It has been found that the transporters responsible for Cd uptake and transport in rice include OsNRAMP2 and OsNRAMP3 of the NRAMP family, OsHMA2 and OsHMA3 of the HMA family, and OsZIP6 of the ZIP family. Yellow stripe-like (YSL) families are embedded in the plasma membrane, where YSL3 regulates the root Cd uptake and YSL7 loads Cd chelates into the xylem [38]. The functions of these Cd transporters are well characterized in rice and tobacco. However, whether and how these transporters are regulated to control the uptake and translocation of Cd in wheat remains poorly understood.
In addition to Cd transport proteins, thiol-containing compounds such as glutathione (GSH), phytochelatins (PCs), and non-protein thiols (NPTs) also play significant roles in Cd accumulation and tolerance. Thiol-based chelators exert dual protective effects through ligand-specific Cd chelation and scavenge excess reactive oxygen species (ROS). Furthermore, Cd chelator contents vary among varieties [39].
Therefore, this study compared the gene expression differences in Cd transporter protein families (e.g., NRAMP, HMA, ZIP, and YSL) and the Cd chelator contents between high and low Cd-accumulating wheat varieties, elucidated how these transporters and chelators regulated the uptake and translocation of Cd in wheat, and further revealed the molecular mechanism of low Cd accumulation in wheat. These findings provide critical insights for implementing safe utilization protocols in Cd-contaminated agricultural lands.

2. Materials and Methods

2.1. Experimental Materials and Design

Four wheat varieties with different Cd accumulation capacities—‘Jimai 22’ (JM22), ‘Taishan 24’ (TS24), ‘Zhoumai 27’ (ZM27), and ‘Zhoumai 32’ (ZM32)—were compared in the present study. These are the main wheat varieties in the Huang-Huai-Hai region, with the characteristics of high yield, excellent quality, and strong resistance to pests and diseases. Three Cd treatment levels (the control and 1 and 5 mg kg−1 total Cd) were set for the pot experiment with reference to the National Soil Contamination Survey Bulletin and the Soil Environmental Quality Risk Control Standard for Soil Contamination of Agricultural Land (GB15618—2018). Each treatment consisted of three parallel experiments. The tested soil, which was collected from the experimental station of Shanxi Agricultural University, was calcareous brown soil with a pH of 8.32, a total Cd content of 0.09 mg kg−1, and an organic matter content of 12.37 g kg−1. Soil total N, P, K were 0.39, 0.52, 18.54 g kg−1, and available N, P, K were 27.98, 12.62, 129.07 mg kg−1, respectively. Uniform and full wheat seeds were vernalized and planted in polyethylene plastic pots (diameter 23.5 cm × height 14 cm) and grown for three weeks, then thinned to eight plants per pot. Plant samples were collected when the wheat grew to the seedling stage.

2.2. Determination of Cd Content in Wheat

During the seedling phase, wheat plants were collected and dissected into roots and aboveground parts. Immersing the roots in a 20 mmol L−1 EDTA-2Na solution for 15 min removed the Cd adsorbed on their surfaces, and then the aboveground tissues and roots were rinsed with deionized water. The samples were dried at 105 °C for 30 min, then dried at 45 °C to constant weight, and finally ground and mixed evenly. Next, each sample was accurately weighed to 0.1000 (0.1000 ± 0.0003) g and placed into a digestion tube and soaked overnight in 2 mL perchloric acid and 8 mL nitric acid. The sample was digested in an automatic graphite digester (EHD36, DigiBlock, Cambridge, MA, USA) at 250 °C until the digest was colorless or pale yellow. Following cooling, the remaining liquid was transferred to a 50 mL volumetric flask, and filtered through a 0.45-μm filter membrane. The Cd content was then determined using inductively coupled plasma mass spectrometry (NexION 350, PerKinElmer, Greenville, SC, USA). For quality assurance and quality control, the certified wheat reference material (GBW 10011) was subjected to the same analytical procedure as the samples. The experimentally determined value was 0.017 ± 0.002 mg kg−1, which lies well within the certified range of 0.018 ± 0.004 mg kg−1, demonstrating the method’s accuracy and traceability.

2.3. Determination of Gene Expression

The relative expression level of Cd transporter proteins was quantified via quantitative real-time PCR (qPCR) technology, which involved three steps: total RNA extraction, reverse transcription, and quantitative PCR. RNA was extracted by TRIzol method, and the concentration and purity were detected using the Nanodrop 2000 (Thermo, Waltham, MA, USA). RNA purity was evaluated by A260/A280 ratios, and these data are provided in a Supplementary Data. The reverse transcription reaction system was prepared using the G3337 kit (4 µL 5 × SweScriptAll-in-One SuperMix for qPCR, 1 µL gDNA remover, 10 μL total RNA, and nuclease-free water added to a total volume of 20 µL) (Servicebio, Wuhan, China). The PCR master mix was prepared (7.5 µL 2 × Universal Blue SYBR Green qPCR master mix, 1.5 µL forward and reverse primers (2.5 μM), 2.0 µL cDNA, and 4.0 µL nuclease-free water) (Servicebio, China). PCR was performed on the CFX Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. The thermal cycling parameters were specified as: initial denaturation at 95 °C for 30 s; followed by 40 cycles of denaturation at 95 °C for 15 s, annealing and extension for 30 s. Primer information is shown in Table 1. A melting curve was generated starting at 65 °C with an increment of 0.5 °C to exclude interference from primer dimers and other non-specific products. We analyzed the melting temperatures (Tm) for all target genes and confirmed the presence of a single peak in each case (Supplementary Figure S1), indicating amplification specificity. The threshold cycle (Ct) values were determined using Thermo Fisher Scientific’s StepOne™ Software v2.3. The Ct values from three technical replicates were averaged, and only data with a standard deviation (SD) of less than 0.5 were considered valid. The relative quantification of each target gene was analyzed using the 2–ΔΔCt method by normalizing to a housekeeping gene. The results are expressed as the mean ± standard deviation of replicate experiments for each group.

2.4. Determination of Cd Chelators

Fresh wheat samples were utilized to determine the contents of Cd chelators, including GSH, NPTs, and PCs. The GSH content was determined using the spectrophotometric method based on the instructions of the GSH assay kit from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The NPT content was determined using the 5,5-dithio-bis-(2-nitrobenzoic acid) colorimetric method following the instructions of the Typing thiol (-SH) assay kit from the Nanjing Jiancheng Bioengineering Institute. The PC content was calculated according to the subtraction method as follows: PCs = NPT − GSH [41,42].

2.5. Statistical Analysis

Significant differences between wheat varieties were analyzed using Tukey’s test (p < 0.05) in one-way analysis of variance (ANOVA) using SPSS 26.0. Graphs were created using OriginPro 9.1 and R 4.1.2.

3. Results

3.1. Differences in Cd Accumulation and Translocation Among Wheat Varieties

Significant differences were observed among the Cd contents of the roots and aboveground parts of the four wheat varieties under Cd stress (Figure 1A). Regardless of 5 or 1 mg kg−1 Cd stress, the root and aboveground Cd contents of JM22 and TS24 were significantly lower than those of ZM32 and ZM27. The Cd content in the roots of ZM27 under 1 mg kg−1 Cd stress was 1.42 times and 1.32 times that of JM22 and TS24, respectively, while under 5 mg kg−1 Cd stress, the Cd content in the roots of ZM27 was 2.02 and 1.85 times that of JM22 and TS24, respectively. However, Cd translocation factors from the roots to aboveground were significantly higher in JM22 and TS24 than in ZM32 and ZM27 under 5 mg kg−1 Cd stress (Figure 1B). Based on the Cd content, JM22 and TS24 were defined as low Cd-accumulating wheat varieties, while ZM32 and ZM27 were defined as high Cd-accumulating wheat varieties.

3.2. Expression Differences in NRAMP Family Genes Between High and Low Cd-Accumulating Wheat Varieties

Under 1 mg kg−1 Cd stress, the relative expression levels of TaNRAMP5 in the roots of low Cd-accumulating wheat varieties were significantly higher compared to high Cd-accumulating wheat varieties (Figure 2A). Specifically, the relative expression of TaNRAMP5 in JM22 and TS24 was significantly increased by 108.9 times and 115.4 times, respectively, compared with ZM32, while it was significantly increased by 3.58 times and 3.85 times, respectively, compared with ZM27. In the aboveground tissues, the TaNRAMP5 gene also exhibited distinct expression patterns between the low Cd-accumulating wheat variety JM22 and the high Cd-accumulating wheat variety ZM32, with JM22 showing a higher expression level under both high and 1 mg kg−1 Cd stress. In the control group, no statistically significant variation in TaNRAMP5 gene expression was observed between high and low Cd-accumulating wheat varieties in both roots and aboveground tissues. The expression of the TaNRAMP5 gene in the roots of ZM32 was markedly up-regulated under 5 mg kg−1 Cd stress.
Generally, the TaNRAMP6 gene showed a consistent expression pattern in the control and under 1 mg kg−1 Cd stress, with high Cd-accumulating wheat varieties showing a higher expression level of TaNRAMP6 in the roots and aboveground parts than low Cd-accumulating wheat varieties (Figure 2B). Under 1 mg kg−1 Cd stress, in the roots, the relative expression of TaNRAMP6 in ZM27 and ZM32 was 2.21 times and 1.75 times that in JM22, respectively, and 2.13 times and 1.69 times that in TS24, respectively. In the aboveground tissues, the relative expression levels of TaNRAMP6 in ZM27 and ZM32 were 1.58 times and 1.66 times that in JM22, respectively, and 1.66 times and 1.75 times that in TS24, respectively. Under 5 mg kg−1 Cd stress, the expression level of TaNRAMP6 in the roots of low Cd-accumulating wheat varieties was up-regulated, while the opposite results were observed in the aboveground tissues of high Cd-accumulating wheat varieties compared with the control. It was observed that the expression of TaNRAMP6 was higher in wheat roots than in the aboveground tissues.

3.3. Expression Differences in HMA Family Genes Between High and Low Cd-Accumulating Wheat Varieties

In the control group, the expression of TaHMA2 in the aboveground tissues of high Cd-accumulating wheat varieties was lower than that of low Cd-accumulating wheat varieties (Figure 3A). Under 5 mg kg−1 Cd stress, the expression level of TaHMA2 in the aboveground tissues of wheat was down-regulated. In general, the root expression of TaHMA2 was lower in high-Cd accumulating wheat varieties than in low-Cd accumulating wheat varieties, except for JM22 under 5 mg kg−1 Cd stress. The expression of the TaHMA3 gene in the aboveground tissues of JM22 was significantly higher than that of other wheat varieties in both the control and 1 mg kg−1 Cd stress groups (Figure 3B). The relative expression of TaHMA3 in the aboveground tissues of JM22 was 57.8%, 49.8%, and 54.0% higher than that of TS24, ZM27, and ZM32, respectively, under 1 mg kg−1 Cd stress. No significant differences in TaHMA3 expression were observed in the aboveground tissues among four wheat varieties under 5 mg kg−1 Cd stress.

3.4. Expression Differences in ZIP Family Genes Between High and Low Cd-Accumulating Wheat Varieties

The expression of TaZIP5 in the roots and aboveground tissues of ZM32, a high Cd-accumulating wheat variety, was significantly higher than that of the other three wheat varieties in both the control and Cd-stressed groups (Figure 4A). The relative expression of TaZIP5 in ZM32 roots was 24.7–50.3 times higher than that in the other three wheat varieties, and the relative expression of TaZIP5 in the aboveground tissues was 20.0–44.5 times higher than that in other wheat varieties. The expression of TaZIP5 in wheat roots was down-regulated with increasing Cd stress. However, for the aboveground parts of wheat, the expression of TaZIP5 was highest under 1 mg kg−1 Cd stress. Generally, the expression of TaZIP5 was higher in wheat roots than in the aboveground parts of wheat. Under 5 mg kg−1 Cd stress, the expression of the TaZIP6 gene was down-regulated in the aboveground tissues but up-regulated in the roots, especially in the wheat variety ZM32 (Figure 4B).

3.5. Expression Differences in YSL Family Genes Between High and Low Cd-Accumulating Wheat Varieties

In the control group, no statistically significant variation in TaYSL1 gene expression was observed among four wheat varieties in the aboveground tissues (Figure 5A). However, under Cd stress, the expression of TaYSL1 in the aboveground tissues of TS24 was lower than that of the other three wheat varieties. In the roots, the expression of TaYSL1 in the low Cd-accumulating wheat variety TS24 was significantly lower than that in the high Cd-accumulating wheat variety ZM27, and was not significantly different from ZM32 under both 1 and 5 mg kg−1 Cd stress.
The TaYSL6 gene exhibited significantly lower expression in the aboveground tissues and roots of low Cd-accumulating wheat varieties than in high Cd-accumulating wheat varieties regardless of 1 or 5 mg kg−1 Cd stress (Figure 5B). In the aboveground tissues, the relative expression of TaYSL6 in ZM27 was significantly increased by 48.5% and 76.5% under 1 mg kg−1 Cd stress compared with JM22 and TS24, respectively, while it was significantly increased by 41.8% and 40.4% under 5 mg kg−1 Cd stress, respectively. The relative expression of TaYSL6 in ZM32 was significantly increased by 53.2% and 82.2% under 1 mg kg−1 Cd stress compared with JM22 and TS24, respectively, while it was significantly increased by 37.0% and 35.7% under 5 mg kg−1 Cd stress, respectively. The expression levels of TaYSL6 in the roots of wheat were higher than those in the aboveground parts. Under 5 mg kg−1 Cd stress, the expression level of TaYSL6 in the aboveground parts of wheat was down-regulated.

3.6. Differences in Cd Chelators Content Between High and Low Cd-Accumulating Wheat Varieties

The GSH content was higher in the aboveground parts of high Cd-accumulating wheat varieties than in low Cd-accumulating wheat varieties, especially ZM32 (Figure 6A). In the control group, the GSH content of ZM32 was significantly higher than that of JM22 and TS24 by 42.77% and 73.49%, respectively. The NPTs and PCs contents exhibited similar patterns between the high Cd-accumulating wheat varieties and low Cd-accumulating wheat varieties, with the high Cd-accumulating wheat varieties having higher NPTs and PCs contents (Figure 6B,C). With increasing Cd stress, the GSH, NPTs, and PCs contents increased.

3.7. Mantel Test Analysis of Cd Content with Transporters and Cd Chelators

The results of mantel test analysis indicated that the Cd content in wheat (roots and aboveground parts) was highly significantly correlated with the expression levels of TaNRAMP5 and TaNRAMP6 in the roots and TaZIP6 in the aboveground tissues (p < 0.01), and significantly correlated with the expression level of TaHMA2 in the aboveground tissues (p < 0.05) (Figure 7). The Cd contents in both the roots and aboveground parts of wheat exhibited a highly significant correlation with the contents of PCs, GSH, and NPTs (p < 0.01). The translocation factor of Cd from the roots to the aboveground tissues showed a highly significant correlation with the expression level of TaZIP5 in roots (p < 0.01) and a significant correlation with the expression levels of TaZIP5 in the aboveground tissues and TaHMA3 in the roots (p < 0.05). The results of principal component analysis (PCA) also confirmed that the contents of PCs, GSH, and NPTs, the expression levels of TaNRAMP5, TaNRANP6, TaZIP5, and TaHMA3 in the roots, as well as the expression levels of TaZIP6 and TaHMA2 in the aboveground tissues, are closely associated with Cd content and Cd translocation in wheat (Supplementary Figure S2).

4. Discussion

It is an undeniable fact that wheat varieties exhibit marked differences in Cd accumulation. The transfer of Cd from the soil to wheat grain involves the following steps: root uptake, vacuolar sequestration, translocation from the roots to the aboveground tissues, and distribution to the grain. Different transporter proteins are required for each process. Furthermore, the expression levels of Cd transporter proteins are significantly different in wheat varieties with different Cd accumulation capacities. This conclusion was confirmed by comparing the expression levels of Cd transporters in two high Cd-accumulating wheat varieties (ZM27 and ZM32) and two low Cd-accumulating wheat varieties (JM22 and TS24) in this paper. It was observed that the expression levels of TaNRAMP6, TaZIP5, and TaYSL6 in the roots and aboveground parts of high Cd-accumulating wheat varieties were significantly higher than those of low Cd-accumulating wheat varieties, while the expression levels of TaNRAMP5 and TaHMA2 in the roots and TaHMA3 in the aboveground tissues of high Cd-accumulating wheat varieties were significantly lower than those of low Cd-accumulating wheat varieties.

4.1. The Function of the NRAMP Family in Cd Uptake and Accumulation in Plants

NRAMP, which is located in the plasma membrane, an essential transmembrane protein that is responsible for the uptake and translocation of a variety of divalent metal ions in plants, such as Cd, Fe, Mn, and lead (Pb) [43,44]. NRAMP members and their specific functions have been demonstrated in model plants, but less has been elucidated in wheat. In this research, it was found that a high expression level of TaNRAMP6 was associated with high Cd content in wheat tissues (Figure 2B). Zhang et al. [29] demonstrated that the Cd contents in the roots of the NtNRAMP6a/6b tobacco mutant were significantly higher than those of the wild type under Cd stress, and that knockdown of the NtNRAMP6a and NtNRAMP6b genes reduced the aboveground Cd content in tobacco through affecting the translocation of Cd from roots to stems. Many studies have also revealed that NRAMP6 was involved in Cd transport in plants, such as Arabidopsis [45], and that the overexpression of NRAMP6 increased the Cd content in plant roots. Similarly, in Sedum alfredii, a Cd hyper-accumulator, SaNRAMP6 gene expression was found to be up-regulated under Cd stress [46]. In contrast to TaNRAMP6, a high expression level of TaNRAMP5 was associated with low Cd content in wheat tissue (Figure 2A). In other words, the expression of TaNRAMP5 was significantly higher in low Cd-accumulating wheat varieties than in high Cd-accumulating wheat varieties. This was consistent with the fact that knockdown of the OsNRAMP5 gene resulted in higher Cd content in rice tissues in previous research [26]. Tang et al. [28] found that the deletion of 104 amino acids at the c-terminus of the NtNRAMP5 protein resulted in lower Cd accumulation in both the roots and aboveground parts of tobacco but had no significant effect on Cd transport from roots to aboveground tissues. Allelic variation in the coding region of NtNRAMP5 may explain the differences in the Cd accumulation capacity among tobacco varieties. Zhang et al. [29] also confirmed that the difference in Cd accumulation ability between the tobacco varieties Jinying and Komotini Basma was due to differential expression levels of the NtNRAMP5 gene. In Arabidopsis thaliana, VrNRAMP5 has been found to regulate Cd tolerance and accumulation via controlling the ability of roots to take up Cd and altering the intracellular distribution of Cd [18]. However, studies on Triticum polonicum found that TpNRAMP5 increased Cd accumulation [47]. Research on tobacco has concluded that NtNRAMP6 mainly affects the translocation of Cd from the roots to aboveground tissues, while NtNRAMP5 primarily influences Cd uptake by roots. The same phenomenon has been reported in barley [48] and rice [49]. In rice, the expression of OsNRAMP5 was confined to the root epidermis, the root exodermis, the outer layer of the root cap, and the tissues surrounding the xylem [26]. In contrast, OsNRAMP6 is mainly expressed in young leaves, with higher expression in leaves than in roots [27]. Furthermore, NRAMP6 and NRAMP5 are also closely related to plant Cd tolerance through the regulation of the Cd content in plant tissues. Wang et al. [50] demonstrated that NRAMP genes regulate Cd accumulation in wheat through three core mechanisms. First, they serve as the main route for Cd uptake, and their expression levels directly influence Cd influx rates. Second, they concurrently activate the endoplasmic reticulum protein processing pathway to maintain proteostasis and coordinate with ABC transporters to promote Cd efflux. Finally, they form a synergistic network with defense pathways, including benzoxazinoid biosynthesis and phytochelatin-mediated detoxification. The collective efficiency of this integrated system provides the molecular foundation for phenotypic variability in Cd accumulation among wheat varieties. Mantel test analysis also showed that the Cd contents in both the roots and aboveground parts of wheat were highly significantly correlated with the expression levels of TaNRAMP5 and TaNRAMP6 in the roots (Figure 7). Current functional interpretations of TaNRAMP5 and TaNRAMP6 rely primarily on correlations between their expression levels and tissue Cd content. To establish causal roles, future studies should integrate multi-omics expression profiling with targeted genetic manipulations, as demonstrated by Liu et al. [51]. For example: Overexpressing TaNRAMP6 in the low-Cd-accumulating wheat cultivar JM22 to evaluate its impact on Cd uptake and distribution; knocking out TaNRAMP5 in JM22 to assess tissue-specific Cd concentration changes.

4.2. The Function of the HMA Family in Cd Uptake and Accumulation in Plants

Upon NRAMP5 mediated Cd influx into root cortical cells, part of Cd was compartmentalized into the vacuoles, while the other part was transferred to the aboveground tissues. In rice, vacuolar Cd sequestration is regulated by OsHMA3 [52], and the translocation of Cd from the roots to aboveground is regulated by OsHMA2 [53]. In addition, OsHMA2 has been reported to participate in the distribution of grain Cd [54]. OsHMA3 localizes to the vesicular membrane and OsHMA2 localizes in the plasma membrane of the root pericycle, with both exhibiting Cd transporter activities. Homologs of OsHMA3 and OsHMA2 have been found in barley, wheat, and maize [55,56,57], but their functions in Cd accumulation remain to be elucidated. The present study revealed that the expression levels of TaHMA2 in the roots and TaHMA3 in the aboveground tissues of high Cd-accumulating wheat varieties were significantly lower than those of low Cd-accumulating wheat varieties (Figure 3). The same phenomenon was reported in rice, where Cd content in rice grains was significantly diminished by OsHMA3 overexpression due to increased Cd immobilization in root vacuoles by OsHMA3, and consequently decreased the translocation of Cd from the roots to aboveground tissues [58]. Lu et al. [59] also demonstrated that the overexpression of OsHMA3 in indica rice reduced the grain Cd content by 94~98% compared to the wild type. The overexpression of HvHMA3 in barley was found to play a similar role to OsHMA3, enhancing Cd sequestration in the roots [60]. Zhang et al. [61] demonstrated that TaHMA3 genes in wheat encode tono-plast-localized proteins, which are critical for vacuolar Cd sequestration. Functional overexpression of the rice gene OsHMA3 in wheat dramatically reduced Cd translocation from root to shoot by nearly 10-fold, leading to a 96% decrease in grain Cd accumulation in wheat. Consistent with the report by Zhang et al. [61], our study also found that TaHMA3 overexpression may be a promising approach to mitigate Cd content in wheat. Regarding HMA2, studies in rice have found that knocking out OsHMA2 tends to reduce grain Cd content [62], which is inconsistent with the results of the current study. We found that Cd content in wheat was significantly negatively correlated with the expression level of TaHMA2 in the aboveground tissues (p < 0.05) (Figure 7), and further in-depth studies on the role of TaHMA2 in Cd accumulation in wheat are required.

4.3. The Function of the ZIP Family in Cd Uptake and Accumulation in Plants

The ZIP family has also been confirmed as an important transporter involved in Cd accumulation and tolerance. Most ZIP family members localize to the plasma membrane, although some members also localize to the tonoplast and endomembrane [63]. Plasma membrane-localized ZIP transporters mediate Cd influx into root epidermal cells via proton-coupled symport [64]. The ZIP family has been detected in a wide variety of plants, including rice [65], wheat [66], maize [67], and legumes [68]. The results of the current research indicated that the relative expression levels of TaZIP5 in the roots and aboveground tissues of the high Cd-accumulating wheat variety ZM32 were 24.7~44.3 times higher than those of the low Cd-accumulating varieties (Figure 4A). Consistent with these findings, Wu et al. [69] also reported that the expression level of BcZIPs was higher in the Brassica campestris ssp. chinensis variety ‘Kang Re605,’ with a high Cd accumulation capacity, while it was lower in the variety ‘Wu Yueman,’ with a low Cd accumulation capacity. Previous research confirmed that the expression levels of SmZIP family genes were up-regulated in Salix matsudana Koidz under Cd stress [70]. Cd is transported by ZIP transporter proteins in the root epidermis, cortex, and vascular bundle, and the overexpression of the SmZIP family has been found to significantly increase the Cd content in tobacco. Furthermore, in tobacco roots and leaves, the up-regulation of SmZIP expression altered the subcellular distribution and the chemical form of Cd, resulting in the decline in cell-wall Cd sequestration, an increase in the soluble fraction, and an elevated proportion of acid-extractable Cd [36]. Similar results were reported in Vicia sativa [71] and Thlaspi caerulescens [72], where the overexpression of the ZIP family promoted Cd uptake and translocation. In the present study, the root Cd content was significantly correlated with the expression level of TaZIP6 in the aboveground tissues, which suggested that TaZIP6 played a crucial role in increasing the Cd content in wheat (Figure 7). Accordingly, its function in wheat requires further in-depth investigation.

4.4. The Function of the YSL Family in Cd Uptake and Accumulation in Plants

YSL belongs to a family of oligopeptide transporter proteins identified in maize [73], rice [74], Arabidopsis [75], barley [76], and other plants [77]. Different members of the YSL family exhibit distinct substrate specificity, expression patterns, and localization, and thus possess various functions. Most YSL family members are primarily responsible for the uptake of heavy metals from the soil into the root cells. To date, research on the functions of the YSL family has primarily focused on the uptake of heavy metals such as Fe, Mn, and zinc (Zn), while relatively limited studies have examined on Cd uptake [75,78]. In the present study, the expression level of TaYSL6 was significantly higher in the aboveground tissues and roots of high Cd-accumulating wheat varieties than in low Cd-accumulating wheat varieties regardless of 1 or 5 mg kg−1 Cd stress (Figure 5B). This phenomenon suggests that TaYSL6 may play an important role in increasing Cd content in wheat. Through interactome analysis, Bari et al. [79] demonstrated that OsYSL6, as a functional partner of the Cd uptake genes OsHMA3 and OsNRAMP1, affected Cd content in rice. The role of YSL6 in Cd uptake and transport needs to be further investigated, especially in wheat.

4.5. The Function of the Cd Chelators in Cd Accumulation and Tolerance

Cd is accumulated and transported within plants through transporter proteins (including the NRAMP family, HMA family, ZIP family, and the YSL family), and exerts toxic effects on plants. In response, plants trigger a series of defense mechanisms to alleviate Cd toxicity. One of these defense mechanisms is to complex Cd with thiol-containing compounds such as GSH, PCs, and NPTs. The results of the current study showed that the PCs, GSH, and NPTs contents were significantly higher in high Cd-accumulating wheat varieties than in low Cd-accumulating wheat varieties, and that the contents of these chelators increased under increasing Cd stress. Consistent with the findings of this study, Yamazaki et al. [62] revealed that Cd stress promoted the expression levels of the OsGS and OsPCS genes, which enzymatically synthesized GSH and PCs, respectively, in the roots and aboveground tissues. Under Cd stress, the high Cd-accumulating wheat varieties in this study had higher contents of PCs, GSH, and NPTs to chelate Cd and mitigate the toxic effects of Cd compared to low Cd-accumulating varieties (Figure 6). The results of the mantel test analysis also showed that the Cd contents in both the roots and aboveground tissues of wheat were highly significantly correlated with the contents of PCs, GSH, and NPTs (Figure 7). These chelators play crucial roles in Cd accumulation and the mitigation of Cd toxicity. It should be noted that the PCs values reported in this study were determined using an indirect spectrophotometric assay. While this approach provides a reliable estimate of PC-related thiols under the experimental conditions, the measurements may be influenced by the presence of other non-GSH thiol compounds. Therefore, conclusions regarding PC levels should be interpreted with this limitation in mind. Further validation using more specific techniques, such as HPLC–MS, would be valuable to confirm these findings. Other defense mechanisms—such as reactive oxygen species scavenging—Wang et al. [80] confirmed that overexpression of TaHSP17.4 and TaHOP enhances wheat stress tolerance through the activation of genes related to reactive oxygen species scavenging and components of the abscisic acid signaling pathway. In addition, the mechanism by which soil microorganisms boost plant stress tolerance—through improved soil structure, stimulated rhizosphere activity, and enhanced nutrient uptake—is clearly demonstrated in the work of Ren et al. [81]. Their study showed that Bacillus subtilis effectively promoted plant growth and increased resistance to environmental stresses.
The current study highlights the role of the transporter protein family (NRAMP, HMA, ZIP, and YSL) and Cd chelators (PCs, GSH, and NPTs) in Cd uptake, accumulation, and tolerance in wheat through comparing the differences in gene expression levels and chelator contents between high and low Cd-accumulating wheat varieties. These findings offer promising genetic targets for breeding low-Cd wheat varieties; however, translating them into practical applications requires a systematic validation process. First, allelic variation in key transporter genes should be characterized across diverse wheat germplasm to identify low-Cd associated alleles, as exemplified by Abubakar et al. [82] for WOX14 in ramie. Second, promising alleles must be validated using molecular markers and multi-environment field trials to confirm phenotypic stability. Finally, integrating the functions of transporter genes with key developmental traits—particularly root system architecture—could improve Cd exclusion without compromising yield. Such a systematic strategy will facilitate the effective utilization of these genetic resources in low-Cd wheat breeding programs.

5. Conclusions

Under 5 mg kg−1 Cd stress, the expression levels of TaNRAMP6 and TaZIP6 in the roots of wheat were down-regulated, while the expression levels of TaHMA2, TaZIP6, and TaYSL6 in the aboveground tissues were up-regulated. The genes TaNRAMP5, TaNRAMP6, TaZIP6, and TaHMA2 may contribute to Cd uptake and accumulation in wheat, and TaZIP5 and TaHMA3 may be associated with Cd translocation from the roots to the aboveground tissues. Differences in the expression levels of Cd transporter genes between high and low Cd-accumulating wheat varieties might underlie the differences between varieties in terms of Cd accumulation. Therefore, these results provide important genetic resources for breeding low Cd-accumulating wheat, which could prove beneficial for ensuring wheat food safety.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy15112515/s1, Figure S1: Melting curves for genes TaNRAMP5 (A), TaNRAMP6 (B), TaHMA2 (C), TaHMA3 (D), TaZIP5 (E), TaZIP6 (F), TaYSL1 (G), and TaYSL6 (H); Figure S2: Principal component analysis of Cd content with transporters and Cd chelators; Table S1: Coefficient matrix of mantel test on the effects of transporters and chelators on Cd content; Supplementary Data: Raw Cq data and RNA information.

Author Contributions

N.L.: Conceptualization, Formal analysis, Writing—original draft, Funding acquisition. C.Y.: Conceptualization, Resources, Writing—review and editing. Y.W. (Yi Wang): Conceptualization, Resources, Writing—review and editing. Y.L. (Yonghui Lv): Conceptualization, Resources, Writing—review and editing. Y.W. (Yixiu Wang): Conceptualization, Resources, Writing—review and editing. Q.W.: Conceptualization, Resources, Writing—review and editing. Y.L. (Yuenan Li): Conceptualization, Resources, Writing—review and editing. Y.C.: Conceptualization, Resources, Writing—review and editing. H.Z.: Methodology, Validation, Investigation. H.C.: Methodology, Validation, Investigation, Funding acquisition. J.D.: Conceptualization, Funding acquisition, Investigation, Writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China [grant number 42107044]; the Young Science & Technology Leadership Program of Shanxi Agricultural University [grant number 2022YQPYGC07]; the Major Special Science and Technology Projects of Shanxi Province (202301140601015); the Shanxi Scholarship Council of China [grant number 2021-069]; and the Shanxi Province Excellent Doctor Award Fund [grant number SXBYKY2021038].

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.

Acknowledgments

We thank LetPub (www.letpub.com.cn) for its linguistic assistance during the preparation of this manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Huang, X.H.; Li, X.Z.; Zheng, L.P.; Zhang, Y.; Sun, L.; Feng, Y.H.; Du, J.Y.; Lu, X.S.; Wang, G.Q. Comprehensive assessment of health and ecological risk of cadmium in agricultural soils across China: A tiered framework. J. Hazard. Mater. 2024, 465, 133111. [Google Scholar] [CrossRef]
  2. Naggar, Y.A.; Naiem, E.; Mona, M.; Giesy, J.P.; Seif, A. Metals in agricultural soils and plants in Egypt. Toxicol. Environ. Chem. 2014, 96, 730–742. [Google Scholar] [CrossRef]
  3. Houessionon, M.G.K.; Ouendo, E.M.D.; Bouland, C.; Takyi, S.A.; Kedote, N.M.; Fayomi, B.; Fobil, J.N.; Basu, N. Environmental heavy metal contamination from Electronic Waste (e-waste) recycling activities worldwide: A systematic review from 2005 to 2017. Int. J. Environ. Res. Public Health 2021, 18, 3517. [Google Scholar] [CrossRef] [PubMed]
  4. Zakaria, Z.; Zulkafflee, N.S.; Redzuan, N.A.M.; Selamat, J.; Ismail, M.R.; Praveena, S.M.; Tóth, G.; Razis, A.F.A. Understanding potential heavy metal contamination, absorption, translocation and accumulation in rice and human health risks. Plants 2021, 10, 1070. [Google Scholar] [CrossRef]
  5. Rahman, S.U.; Han, J.C.; Ahmad, M.; Gao, S.; Khan, K.A.; Li, B.; Zhou, Y.; Zhao, X.; Huang, Y.F. Toxic effects of lead (Pb), cadmium (Cd) and tetracycline (TC) on the growth and development of Triticum aestivum: A meta-analysis. Sci. Total Environ. 2023, 904, 166677. [Google Scholar] [CrossRef] [PubMed]
  6. Luo, L.; Ma, Y.B.; Zhang, S.Z.; Wei, D.P.; Zhu, Y.G. An inventory of trace element inputs to agricultural soils in China. J. Environ. Manag. 2009, 90, 2524–2530. [Google Scholar] [CrossRef]
  7. Hussain, B.; Ashraf, M.N.; Rahman, S.U.; Abbas, A.; Li, J.M.; Farooq, M. Cadmium stress in paddy fields: Effects of soil conditions and remediation strategies. Sci. Total Environ. 2021, 754, 142188. [Google Scholar] [CrossRef]
  8. Su, C.; Jiang, L.Q.; Zhang, W.J. A review on heavy metal contamination in the soil worldwide: Situation, impact and remediation techniques. Environ. Skept. Crit. 2014, 3, 24. [Google Scholar]
  9. Zhao, F.J.; Ma, Y.B.; Zhu, Y.G.; Tang, Z.; McGrath, S.P. Soil contamination in China: Current status and mitigation strategies. Environ. Sci. Technol. 2015, 49, 750–759. [Google Scholar] [CrossRef]
  10. Li, X.F.; Zhou, D.M. A meta-analysis on phenotypic variation in cadmium accumulation of rice and wheat: Implications for food cadmium risk control. Pedosphere 2019, 29, 545–553. [Google Scholar] [CrossRef]
  11. Hou, D.Y.; Jia, X.Y.; Wang, L.W.; McGrath, S.P.; Zhu, Y.G.; Hu, Q.; Zhao, F.J.; Bank, M.S.; O’Connor, D.; Nriagu, J. Global soil pollution by toxic metals threatens agriculture and human health. Science 2025, 388, 316–321. [Google Scholar] [CrossRef] [PubMed]
  12. Xu, J.h.; Hu, C.Y.; Wang, M.L.; Zhao, Z.S.; Zhao, X.X.; Cao, L.; Lu, Y.F.; Cai, X.Y. Changeable effects of coexisting heavy metals on transfer of cadmium from soils to wheat grains. J. Hazard. Mater. 2022, 423, 127182. [Google Scholar] [CrossRef]
  13. Ma, J.F.; Shen, R.F.; Shao, J.F. Transport of cadmium from soil to grain in cereal crops: A review. Pedosphere 2021, 31, 3–10. [Google Scholar] [CrossRef]
  14. Li, X.F. Technical solutions for the safe utilization of heavy metal-contaminated farmland in China: A critical review. Land Degrad. Dev. 2019, 30, 1773–1784. [Google Scholar] [CrossRef]
  15. Li, H.; Luo, N.; Li, Y.W.; Cai, Q.Y.; Li, H.Y.; Mo, C.H.; Wong, M.H. Cadmium in rice: Transport mechanisms, influencing factors, and minimizing measures. Environ. Pollut. 2017, 224, 622–630. [Google Scholar] [CrossRef]
  16. You, Y.; Wang, Y.; Zhang, S.Y.; Sun, X.H.; Liu, H.J.; Guo, Y.T.; Du, S.T. Different pathways for exogenous ABA-mediated down-regulation of cadmium accumulation in plants under different iron supplies. J. Hazard. Mater. 2022, 440, 129769. [Google Scholar] [CrossRef]
  17. Chen, G.; Du, R.Y.; Wang, X. Genetic regulation mechanism of cadmium accumulation and its utilization in rice breeding. Int. J. Mol. Sci. 2023, 24, 1247. [Google Scholar] [CrossRef]
  18. Wang, Y.; Huang, X.Y.; Li, X.; Lu, Q.; Wu, T.; Shao, M.H.; Liu, Y.L.; Chen, X.; Chen, Y.H.; Peng, K.J. The plasma membrane-localized transporter VrNramp5 of Vigna radiata L. governs cadmium tolerance and accumulation in Arabidopsis thaliana. Environ. Exp. Bot. 2024, 220, 105712. [Google Scholar] [CrossRef]
  19. Liu, N.; Huang, X.M.; Sun, L.M.; Li, S.S.; Chen, Y.H.; Cao, X.Y.; Wang, W.X.; Dai, J.L.; Rinnan, R. Screening stably low cadmium and moderately high micronutrients wheat cultivars under three different agricultural environments of China. Chemosphere 2020, 241, 125065. [Google Scholar] [CrossRef] [PubMed]
  20. Hu, P.J.; Tu, F.; Simin, L.; Pan, Y.J.; Kong, C.; Zhang, X.M.; Wang, S.H.; Sun, Y.Q.; Qiu, D.; Wu, L.H.; et al. Low-Cd wheat varieties and soil Cd safety thresholds for local soil health management in south Jiangsu province, east China. Agric. Ecosyst. Environ. 2023, 341, 108211. [Google Scholar] [CrossRef]
  21. Liu, N.; Miao, Y.J.; Zhou, X.X.; Gan, Y.D.; Liu, S.W.; Wang, W.X.; Dai, J.L. Roles of rhizospheric organic acids and microorganisms in mercury accumulation and translocation to different winter wheat cultivars. Agric. Ecosyst. Environ. 2018, 258, 104–112. [Google Scholar] [CrossRef]
  22. Liu, N.; Liu, Q.; Min, J.M.; Zhang, S.J.; Li, S.S.; Chen, Y.H.; Dai, J.L. Specific bacterial communities in the rhizosphere of low-cadmium and high-zinc wheat (Triticum aestivum L.). Sci. Total Environ. 2022, 838, 156484. [Google Scholar] [CrossRef] [PubMed]
  23. Pilon, M.; Cohu, C.M.; Ravet, K.; Abdel-Ghany, S.E.; Gaymard, F. Essential transition metal homeostasis in plants. Curr. Opin. Plant Biol. 2009, 12, 347–357. [Google Scholar] [CrossRef]
  24. Clemens, S.; Ma, J.F. Toxic heavy metal and metalloid accumulation in crop plants and foods. Annu. Rev. Plant Biol. 2016, 67, 489–512. [Google Scholar] [CrossRef] [PubMed]
  25. Nevo, Y.; Nelson, N. The NRAMP family of metal-ion transporters. Biochim. Biophys. Acta (BBA)-Mol. Cell Res. 2006, 1763, 609–620. [Google Scholar] [CrossRef]
  26. Ishimaru, Y.; Takahashi, R.; Bashir, K.; Shimo, H.; Senoura, T.; Sugimoto, K.; Ono, K.; Yano, M.; Ishikawa, S.; Arao, T.; et al. Characterizing the role of rice NRAMP5 in manganese, iron and cadmium transport. Sci. Rep. 2012, 2, 286. [Google Scholar] [CrossRef]
  27. Tian, W.J.; He, G.D.; Qin, L.J.; Li, D.D.; Meng, L.L.; Huang, Y.; He, T.B. Genome-wide analysis of the NRAMP gene family in potato (Solanum tuberosum): Identification, expression analysis and response to five heavy metals stress. Ecotoxicol. Environ. Saf. 2021, 208, 111661. [Google Scholar] [CrossRef]
  28. Tang, Z.; Cai, H.L.; Li, J.; Lv, Y.L.; Zhang, W.W.; Zhao, F.J. Allelic variation of NtNramp5 associated with cultivar variation in cadmium accumulation in tobacco. Plant Cell Physiol. 2017, 58, 1583–1593. [Google Scholar] [CrossRef] [PubMed]
  29. Zhang, J.S.; Zhang, X.L.; Jia, M.G.; Fu, Q.; Guo, Y.S.; Wang, Z.H.; Kong, D.J.; Lin, Y.C.; Zhao, D.G. Two novel transporters NtNRAMP6a and NtNRAMP6b are involved in cadmium transport in tobacco (Nicotiana tabacum L.). Plant Physiol. Biochem. 2023, 202, 107953. [Google Scholar] [CrossRef]
  30. Ryuichi, T.; Yasuhiro, I.; Takeshi, S.; Hugo, S.; Satoru, I.; Tomohito, A.; Hiromi, N.; Nishizawa, N.K. The OsNRAMP1 iron transporter is involved in Cd accumulation in rice. J. Exp. Bot. 2011, 62, 4843–4850. [Google Scholar] [CrossRef]
  31. Tang, L.; Dong, J.Y.; Qu, M.M.; Lv, Q.M.; Zhang, L.P.; Peng, C.; Hu, Y.Y.; Li, Y.K.; Ji, Z.Y.; Mao, B.G.; et al. Knockout of OsNRAMP5 enhances rice tolerance to cadmium toxicity in response to varying external cadmium concentrations via distinct mechanisms. Sci. Total Environ. 2022, 832, 155006. [Google Scholar] [CrossRef]
  32. Liu, W.H.; Huo, C.S.; He, L.S.; Ji, X.; Yu, T.; Yuan, J.W.; Zhou, Z.Y.; Song, L.R.; Yu, Q.; Chen, J.; et al. The NtNRAMP1 transporter is involved in cadmium and iron transport in tobacco (Nicotiana tabacum). Plant Physiol. Biochem. 2022, 173, 59–67. [Google Scholar] [CrossRef]
  33. Tan, L.T.; Zhu, Y.X.; Fan, T.; Peng, C.; Wang, J.R.; Sun, L.; Chen, C.Y. OsZIP7 functions in xylem loading in roots and inter-vascular transfer in nodes to deliver Zn/Cd to grain in rice. Biochem. Biophys. Res. Commun. 2019, 512, 112–118. [Google Scholar] [CrossRef]
  34. Zhao, F.J.; Tang, Z.; Song, J.J.; Huang, X.Y.; Wang, P. Toxic metals and metalloids: Uptake, transport, detoxification, phytoremediation, and crop improvement for safer food. Mol. Plant 2022, 15, 27–44. [Google Scholar] [CrossRef]
  35. Cheng, J.H.; Zhang, S.; Yi, Y.; Qin, Y.; Chen, Z.H.; Deng, F.L.; Zeng, F.R. Hydrogen peroxide reduces root cadmium uptake but facilitates root-to-shoot cadmium translocation in rice through modulating cadmium transporters. Plant Physiol. Biochem. 2023, 200, 107754. [Google Scholar] [CrossRef]
  36. Jiang, Y.; Han, J.H.; Xue, W.X.; Wang, J.Y.; Wang, B.H.; Liu, L.J.; Zou, J.H. Overexpression of SmZIP plays important roles in Cd accumulation and translocation, subcellular distribution, and chemical forms in transgenic tobacco under Cd stress. Ecotoxicol. Environ. Saf. 2021, 214, 112097. [Google Scholar] [CrossRef] [PubMed]
  37. Tao, J.Y.; Lu, L.L. Advances in genes-encoding transporters for cadmium uptake, translocation, and accumulation in plants. Toxics 2022, 10, 411. [Google Scholar] [CrossRef] [PubMed]
  38. Huang, B.F.; Liao, Q.; Fu, H.L.; Ye, Z.Y.; Mao, Y.X.; Luo, J.M.; Wang, Y.T.; Yuan, H.W.; Xin, J.L. Effect of potassium intake on cadmium transporters and root cell wall biosynthesis in sweet potato. Ecotoxicol. Environ. Saf. 2023, 250, 114501. [Google Scholar] [CrossRef] [PubMed]
  39. Li, J.N.; Wang, Y.R.; Zheng, L.; Li, Y.; Zhou, X.L.; Li, J.J.; Gu, D.F.; Xu, J.W.; Lu, Y.P.; Chen, X.; et al. The intracellular transporter AtNRAMP6 is involved in Fe homeostasis in Arabidopsis. Plant Sci. 2019, 10, 1124. [Google Scholar] [CrossRef]
  40. Wang, X.J. Study on the Differences of Cadmium Absorption and Transport Among Wheat Varieties. Master’s Thesis, Henan Agricultural University, Zhengzhou, China, 2020. [Google Scholar]
  41. Lu, Y.; Li, T.; Li, R.J.; Zhang, P.; Li, X.X.; Bai, Z.Q.; Wu, J.W. Role of SbNRT1.1B in cadmium accumulation is attributed to nitrate uptake and glutathione-dependent phytochelatins biosynthesis. J. Hazard. Mater. 2024, 479, 135655. [Google Scholar] [CrossRef]
  42. Han, M.; Feng, J.H.; Zhai, Y.J.; Si, Y.J.; Liu, X.N.; Han, Y.R.; Hu, J.H.; Su, T.; Cao, F.L. Promoted metabolic remolding by overexpression of AspAT9 ameliorates cadmium toxicity in Arabidopsis. J. Hazard. Mater. 2025, 483, 136688. [Google Scholar] [CrossRef]
  43. Li, D.Q.; Wang, L.L.; Li, Z.M.; Li, H.S.; Chen, G.K. Effect of cadmium stress on non-protein thiols in the seedlings of high- and low-cadmium-accumulating rice cultivars. Agro-Environ. Sci. 2019, 38, 2697–2704. [Google Scholar] [CrossRef]
  44. Chang, J.D.; Gao, W.P.; Wang, P.; Zhao, F.J. OsNRAMP5 is a major transporter for lead uptake in rice. Environ. Sci. Technol. 2022, 56, 17481–17490. [Google Scholar] [CrossRef]
  45. Cailliatte, R.; Lapeyre, B.; Briat, J.F.; Mari, S.; Curie, C. The NRAMP6 metal transporter contributes to cadmium toxicity. Biochem. J. 2009, 422, 217–228. [Google Scholar] [CrossRef]
  46. Chen, S.S.; Han, X.J.; Fang, J.; Lu, Z.T.; Qiu, W.M.; Liu, M.Y.; Sang, J.; Jiang, J.; Zhuo, R.Y. Sedum alfredii SaNramp6 metal transporter contributes to cadmium accumulation in transgenic Arabidopsis thaliana. Sci. Rep. 2017, 7, 13318. [Google Scholar] [CrossRef] [PubMed]
  47. Peng, F.; Wang, C.; Zhu, J.S.; Zeng, J.; Kang, H.Y.; Fan, X.; Sha, L.; Zhang, H.Q.; Zhou, Y.H.; Wang, Y. Expression of TpNRAMP5, a metal transporter from Polish wheat (Triticum polonicum L.), enhances the accumulation of Cd, Co and Mn in transgenic Arabidopsis plants. Planta 2018, 247, 1395–1406. [Google Scholar] [CrossRef]
  48. Wu, D.Z.; Yamaji, N.; Yamane, M.; Kashino, F.M.; Sato, K.; Ma, J.F. The HvNramp5 transporter mediates uptake of cadmium and manganese, but not iron. Plant Physiol. 2016, 172, 1899–1910. [Google Scholar] [CrossRef]
  49. Sasaki, A.; Yamaji, N.; Yokosho, K.; Ma, J.F. Nramp5 is a major transporter responsible for manganese and cadmium uptake in rice. Plant Cell 2012, 24, 2155–2167. [Google Scholar] [CrossRef] [PubMed]
  50. Wang, Q.; Li, Y.N.; Wang, Y.X.; Zhang, M.J.; Lv, Y.H.; Zhang, H.B.; Liu, N.; Cheng, H.Y. Integrative proteomic and physiological analyses reveal differential responses between high- and low-Cd-accumulating wheat under Cd stress. Ecotoxicol. Environ. Saf. 2025, 302, 118662. [Google Scholar] [CrossRef]
  51. Liu, T.; Luo, T.; Guo, X.J.; Zou, X.; Zhou, D.H.; Sadia, A.; Gui, L.; Zhang, Y.; Zhang, R.; Luo, Z.Y. PgMYB2, a MeJA-responsive transcription factor, positively regulates the dammarenediol synthase gene expression in Panax Ginseng. Int. J. Mol. Sci. 2019, 20, 2219. [Google Scholar] [CrossRef] [PubMed]
  52. Ueno, D.; Yamaji, N.; Kono, I.; Chao, F.H.; Ando, T.; Yano, M.; Ma, J.F. Gene limiting cadmium accumulation in rice. Natl. Acad. Sci. USA 2010, 107, 16500–16505. [Google Scholar] [CrossRef] [PubMed]
  53. Satoh, N.N.; Mori, M.; Nakazawa, N.; Kawamoto, T.; Nagato, Y.; Sakurai, K.; Takahashi, H.; Watanabe, A.; Akagi, H. Mutations in rice (Oryza sativa) heavy metal ATPase 2 (OsHMA2) restrict the translocation of zinc and cadmium. Plant Cell Physiol. 2012, 53, 213–224. [Google Scholar] [CrossRef] [PubMed]
  54. Yamaji, N.; Xia, J.X.; Mitani, U.N.; Yokosho, L.; Ma, J.F. Preferential delivery of zinc to developing tissues in rice is mediated by P-type heavy metal ATPase OsHMA2. Plant Physiol. 2013, 162, 927–939. [Google Scholar] [CrossRef] [PubMed]
  55. Wu, D.Z.; Sato, K.; Ma, J.F. Genome-wide association mapping of cadmium accumulation in different organs of barley. New Phytol. 2015, 208, 817–829. [Google Scholar] [CrossRef]
  56. Zhao, X.W.; Luo, L.X.; Cao, Y.H.; Liu, Y.J.; Li, Y.H.; Wu, W.M.; Lan, Y.Z.; Jiang, Y.W.; Gao, S.B.; Zhang, Z.M.; et al. Genome-wide association analysis and QTL mapping reveal the genetic control of cadmium accumulation in maize leaf. BMC Genom. 2018, 19, 91. [Google Scholar] [CrossRef]
  57. Zhou, M.; Zheng, S.G.; Liu, R.; Lu, L.; Zhang, Z.H.; Zhang, L.; Levi, Y.; Wu, Y. The genome-wide impact of cadmium on microRNA and mRNA expression in contrasting Cd responsive wheat genotypes. BMC Genom. 2019, 20, 615. [Google Scholar] [CrossRef]
  58. Sasaki, A.; Yamaji, N.; Ma, J.F. Overexpression of OsHMA3 enhances Cd tolerance and expression of Zn transporter genes in rice. J. Exp. Bot. 2014, 65, 6013–6021. [Google Scholar] [CrossRef]
  59. Lu, C.N.; Zhang, L.X.; Tang, Z.; Huang, X.Y.; Ma, J.F.; Zhao, F.J. Producing cadmium-free Indica rice by overexpressing OsHMA3. Environ. Int. 2019, 126, 619–626. [Google Scholar] [CrossRef]
  60. Lei, G.J.; Fujii-Kashino, M.; Wu, D.Z.; Hisano, H.; Saisho, D.; Deng, F.; Yamaji, N.; Sato, K.; Zhao, F.J. Breeding for low cadmium barley by introgression of a Sukkula-like transposable element. Nat. Food 2020, 1, 489–499. [Google Scholar] [CrossRef]
  61. Zhang, L.X.; Gao, C.; Chen, C.; Zhang, W.; Huang, X.Y.; Zhao, F.J. Overexpression of rice OsHMA3 in wheat greatly decreases cadmium accumulation in wheat grain. Environ. Sci. Technol. 2020, 54, 10100–10108. [Google Scholar] [CrossRef]
  62. Yamazaki, S.; Ueda, Y.; Mukai, A.; Ochiai, K.; Matoh, T. Rice phytochelatin synthases OsPCS1 and OsPCS2 make different contributions to cadmium and arsenic tolerance. Plant Direct 2018, 2, e00034. [Google Scholar] [CrossRef] [PubMed]
  63. Zheng, X.; Chen, L.; Li, X.F. Arabidopsis and rice showed a distinct pattern in ZIPs genes expression profile in response to Cd stress. Bot. Stud. 2018, 59, 22. [Google Scholar] [CrossRef]
  64. Viehweger, K. How plants cope with heavy metals. Bot. Stud. 2014, 55, 35. [Google Scholar] [CrossRef] [PubMed]
  65. Swamy, B.P.M.; Descalsota, G.I.L.; Nha, C.T.; Amparado, A.; Inabangan-Asilo, M.A.; Manito, C.; Tesoro, F.; Reinke, R. Identification of genomic regions associated with agronomic and biofortification traits in DH populations of rice. PLoS ONE 2018, 13, e0201756. [Google Scholar] [CrossRef]
  66. Evens, N.P.; Buchner, P.; Williams, L.E.; Hawkesford, M.J. The role of ZIP transporters and group F bZIP transcription factors in the Zn-deficiency response of wheat (Triticum aestivum). Plant J. 2017, 92, 291–304. [Google Scholar] [CrossRef]
  67. Mao, H.D.; Yu, L.J.; Li, Z.J.; Liu, H.; Han, R. Molecular evolution and gene expression differences within the HD-Zip transcription factor family of Zea mays L. Genetica 2016, 144, 243–257. [Google Scholar] [CrossRef]
  68. Astudillo, C.; Fernandez, A.C.; Blair, M.W.; Cichy, K.A. The Phaseolus vulgaris ZIP gene family: Identification, characterization, mapping, and gene expression. Front. Plant Sci. 2013, 4, 286. [Google Scholar] [CrossRef] [PubMed]
  69. Wu, X.; Chen, J.H.; Yue, X.M.; Wei, X.N.; Zou, J.W.; Chen, Y.H.; Su, N.N.; Cui, J. The zinc-regulated protein (ZIP) family genes and glutathione s-transferase (GST) family genes play roles in Cd resistance and accumulation of pakchoi (Brassica campestris ssp. chinensis). Ecotoxicol. Environ. Saf. 2019, 183, 109571. [Google Scholar] [CrossRef]
  70. Zou, J.H.; Wang, G.; Ji, J.; Wang, J.Y.; Wu, H.F.; Ou, Y.J.; Li, B.B. Transcriptional, physiological and cytological analysis validated the roles of some key genes linked Cd stress in Salix matsudana Koidz. Environ. Exp. Bot. 2017, 134, 116–129. [Google Scholar] [CrossRef]
  71. Zhang, X.X.; Li, X.; Tang, L.; Peng, Y.Z.; Qian, M.; Guo, Y.F.; Rui, H.Y.; Zhang, F.Q.; Hu, Z.B.; Chen, Y.H.; et al. The root iron transporter 1 governs cadmium uptake in Vicia sativa roots. J. Hazard. Mater. 2020, 398, 122873. [Google Scholar] [CrossRef]
  72. Plaza, S.; Tearall, K.L.; Zhao, F.J.; Buchner, P.; McGrath, S.P.; Hawkesford, M.J. Expression and functional analysis of metal transporter genes in two contrasting ecotypes of the hyperaccumulator Thlaspi caerulescens. J. Exp. Bot. 2007, 58, 1717–1728. [Google Scholar] [CrossRef]
  73. Curie, C.; Panaviene, Z.; Loulergue, C.; Dellaporta, S.L.; Briat, J.F.; Walker, E.L. Maize yellow stripe1 encodes a membrane protein directly involved in Fe (III) uptake. Nature 2001, 409, 346–349. [Google Scholar] [CrossRef] [PubMed]
  74. Aoyama, T.; Kobayashi, T.; Takahashi, M.; Nagasaka, S.; Usuda, K.; Kakei, Y.; Ishimaru, Y.; Nakanishi, H.; Mori, S.; Nishizawa, N.K. OsYSL18 is a rice iron (III)–deoxymugineic acid transporter specifically expressed in reproductive organs and phloem of lamina joints. Plant Mol. Biol. 2009, 70, 681–692. [Google Scholar] [CrossRef] [PubMed]
  75. Curie, C.; Cassin, G.; Couch, D.; Divol, F.; Higuchi, K.; Jean, M.L.; Misson, J.; Schikora, A.; Czernic, P.; Mari, S. Metal movement within the plant: Contribution of nicotianamine and yellow stripe 1-like transporters. Ann. Bot. 2009, 103, 1–11. [Google Scholar] [CrossRef] [PubMed]
  76. Murata, Y.; Ma, J.F.; Yamaji, N.; Ueno, D.; Nomoto, K.; Iwashita, T. A specific transporter for iron (III)–phytosiderophore in barley roots. Plant J. 2006, 46, 563–572. [Google Scholar] [CrossRef]
  77. Gendre, D.; Czernic, P.; Conéjéro, G.; Pianelli, K.; Briat, J.F.; Lebrun, M.; Mari, S. TcYSL3, a member of the YSL gene family from the hyper-accumulator Thlaspi caerulescens, encodes a nicotianamine-Ni/Fe transporter. Plant J. 2007, 49, 1–15. [Google Scholar] [CrossRef]
  78. Sasaki, A.; Yamaji, N.; Xia, J.; Ma, J.F. OsYSL6 is involved in the detoxification of excess manganese in rice. Plant Physiol. 2011, 157, 1832–1840. [Google Scholar] [CrossRef]
  79. Bari, M.A.; El-Shehawi, A.M.; Elseehy, M.M.; Naheen, N.N.; Rahman, M.M.; Kabir, A.H. Molecular characterization and bioinformatics analysis of transporter genes associated with Cd-induced phytotoxicity in rice (Oryza sativa L.). Plant Physiol. Biochem. 2021, 167, 438–448. [Google Scholar] [CrossRef]
  80. Wang, Y.X.; Yu, T.F.; Wang, C.X.; Wei, J.T.; Zhang, S.X.; Liu, Y.W.; Chen, J.; Zhou, Y.B.; Chen, M.; Ma, Y.Z.; et al. Heat shock protein TaHSP17.4, a TaHOP interactor in wheat, improves plant stress tolerance. Int. J. Biol. Macromol. 2023, 246, 125694. [Google Scholar] [CrossRef]
  81. Ren, P.Q.; Zhou, B.B.; Bi, Y.P.; Chen, X.P.; Yao, S.X.; Yang, X.L. Bacillus subtilis can promote cotton phenotype, yield, nutrient uptake and water use efficiency under drought stress by optimizing rhizosphere microbial community in arid area. Ind. Crops Prod. 2025, 227, 120784. [Google Scholar] [CrossRef]
  82. Abubakar, S.A.; Wu, Y.M.; Chen, F.M.; Zhu, A.G.; Chen, P.; Chen, K.M.; Qiu, X.J.; Huang, X.Y.; Zhao, H.H.; Chen, J.K.; et al. Comprehensive analysis of WUSCEL-related homeobox gene family in Ramie (Boehmeria nivea) indicates its potential role in adventitious root development. Biology 2023, 12, 1475. [Google Scholar] [CrossRef] [PubMed]
Agronomy 15 02515 g001
Figure 1. Cd content (A) and Cd translocation factor (B) of four wheat varieties under Cd stress; Lowercase letters indicate significant differences among the four wheat varieties (p < 0.05, Tukey’s test).
Figure 1. Cd content (A) and Cd translocation factor (B) of four wheat varieties under Cd stress; Lowercase letters indicate significant differences among the four wheat varieties (p < 0.05, Tukey’s test).
Agronomy 15 02515 g001
Agronomy 15 02515 g002
Figure 2. Relative expression levels of TaNRAMP5 (A) and TaNRAMP6 (B) in the roots and aboveground parts between high and low Cd-accumulating wheat varieties under Cd stress. Lowercase letters indicate significant differences among the four wheat varieties (p < 0.05, Tukey’s test).
Figure 2. Relative expression levels of TaNRAMP5 (A) and TaNRAMP6 (B) in the roots and aboveground parts between high and low Cd-accumulating wheat varieties under Cd stress. Lowercase letters indicate significant differences among the four wheat varieties (p < 0.05, Tukey’s test).
Agronomy 15 02515 g002
Agronomy 15 02515 g003
Figure 3. Relative expression levels of TaHMA2 (A) and TaHMA3 (B) in the roots and aboveground parts between high and low Cd-accumulating wheat varieties under Cd stress. Lowercase letters indicate significant differences among the four wheat varieties (p < 0.05, Tukey’s test).
Figure 3. Relative expression levels of TaHMA2 (A) and TaHMA3 (B) in the roots and aboveground parts between high and low Cd-accumulating wheat varieties under Cd stress. Lowercase letters indicate significant differences among the four wheat varieties (p < 0.05, Tukey’s test).
Agronomy 15 02515 g003
Agronomy 15 02515 g004
Figure 4. Relative expression levels of TaZIP5 (A) and TaZIP6 (B) in the roots and aboveground parts between high and low Cd-accumulating wheat varieties under Cd stress. Lowercase letters indicate significant differences among the four wheat varieties (p < 0.05, Tukey’s test).
Figure 4. Relative expression levels of TaZIP5 (A) and TaZIP6 (B) in the roots and aboveground parts between high and low Cd-accumulating wheat varieties under Cd stress. Lowercase letters indicate significant differences among the four wheat varieties (p < 0.05, Tukey’s test).
Agronomy 15 02515 g004
Agronomy 15 02515 g005
Figure 5. Relative expression levels of TaYSL1 (A) and TaYSL6 (B) in the roots and aboveground parts between high and low Cd-accumulating wheat varieties under Cd stress. Lowercase letters indicate significant differences among the four wheat varieties (p < 0.05, Tukey’s test).
Figure 5. Relative expression levels of TaYSL1 (A) and TaYSL6 (B) in the roots and aboveground parts between high and low Cd-accumulating wheat varieties under Cd stress. Lowercase letters indicate significant differences among the four wheat varieties (p < 0.05, Tukey’s test).
Agronomy 15 02515 g005
Agronomy 15 02515 g006
Figure 6. Contents of GSH (A), PCs (B), and NPTs (C) of four wheat cultivars under Cd stress. GSH, PCs, and NPTs are abbreviations for glutathione, phytochelatins, and non-protein thiols, respectively. Lowercase letters indicate significant differences among the four wheat varieties (p < 0.05, Tukey’s test).
Figure 6. Contents of GSH (A), PCs (B), and NPTs (C) of four wheat cultivars under Cd stress. GSH, PCs, and NPTs are abbreviations for glutathione, phytochelatins, and non-protein thiols, respectively. Lowercase letters indicate significant differences among the four wheat varieties (p < 0.05, Tukey’s test).
Agronomy 15 02515 g006
Agronomy 15 02515 g007
Figure 7. Mantel test analysis of Cd content with transporters and Cd chelators (n = 36). A indicates the expression level of transporter genes in the aboveground part, and R indicates the expression level of transporter genes in the roots. TF is the abbreviation of translocation factor. The units for GSH, NPT, and PCs are μmol g−1 FW, and the unit for Cd content is mg kg−1. The level of significance was defined as follows: p < 0.05 *; p < 0.01 **; p < 0.001 ***; p < 0.0001 ****.
Figure 7. Mantel test analysis of Cd content with transporters and Cd chelators (n = 36). A indicates the expression level of transporter genes in the aboveground part, and R indicates the expression level of transporter genes in the roots. TF is the abbreviation of translocation factor. The units for GSH, NPT, and PCs are μmol g−1 FW, and the unit for Cd content is mg kg−1. The level of significance was defined as follows: p < 0.05 *; p < 0.01 **; p < 0.001 ***; p < 0.0001 ****.
Agronomy 15 02515 g007
Table 1. Primer sequences used in qPCR reaction.
Table 1. Primer sequences used in qPCR reaction.
GeneSequence (5′ ⟶ 3′)Reference
TaNRAMP5-FTCTGGGTGATTCTGATTGGC[40]
TaNRAMP5-RCGGCTTTGGATACTCGGTC
TaNRAMP6-FATGTTGCCATTGTATCACTCTCTG[40]
TaNRAMP6-RTTCTTGAATAGTACGGATGCTGAC
TaHMA2-FGGGCATCCGCTTATTTGG[40]
TaHMA2-RTTCCACTGCCTTTCTCCCTC
TaHMA3-FGGGATGTCGTCGTTGATGAG[40]
TaHMA3-RACCGTCCAAGTTGAGCGTG
TaZIP5-FAAGTTCAAGGCTAGGTCCATCGTGenebank accession no. DQ490132.1
TaZIP5-RTCTTGTTGTACACCCGTGATATGC
TaZIP6-FGTCATCATCTCTGAAACTGAAGAAGG[40]
TaZIP6-RCCCTCTATACATTTCACTATGRCC
TaYSL1-FCCTGACACTCACCTCACCACGenebank accession no. XM_044500292.1
TaYSL1-RCTTAAAACTGCGAGCCCACG
TaYSL6-FTCGCCTTCTGCAACTCATACAAGenebank accession no. XM_044598002.1
TaYSL6-RCTAAGCCTGCAATCACACCAC
The designations F and R correspond to the forward primer and reverse primer, respectively. Annealing temperature of 60 °C.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, N.; Yang, C.; Wang, Y.; Lv, Y.; Wang, Y.; Wang, Q.; Li, Y.; Chen, Y.; Zhang, H.; Cheng, H.; et al. Functional Analysis of Key Transporter Genes Involved in Cadmium Uptake and Translocation in Wheat. Agronomy 2025, 15, 2515. https://doi.org/10.3390/agronomy15112515

AMA Style

Liu N, Yang C, Wang Y, Lv Y, Wang Y, Wang Q, Li Y, Chen Y, Zhang H, Cheng H, et al. Functional Analysis of Key Transporter Genes Involved in Cadmium Uptake and Translocation in Wheat. Agronomy. 2025; 15(11):2515. https://doi.org/10.3390/agronomy15112515

Chicago/Turabian Style

Liu, Na, Chaodong Yang, Yi Wang, Yonghui Lv, Yixiu Wang, Qing Wang, Yuenan Li, Yuanyuan Chen, Haibo Zhang, Hongyan Cheng, and et al. 2025. "Functional Analysis of Key Transporter Genes Involved in Cadmium Uptake and Translocation in Wheat" Agronomy 15, no. 11: 2515. https://doi.org/10.3390/agronomy15112515

APA Style

Liu, N., Yang, C., Wang, Y., Lv, Y., Wang, Y., Wang, Q., Li, Y., Chen, Y., Zhang, H., Cheng, H., & Dai, J. (2025). Functional Analysis of Key Transporter Genes Involved in Cadmium Uptake and Translocation in Wheat. Agronomy, 15(11), 2515. https://doi.org/10.3390/agronomy15112515

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop