Next Article in Journal
Determinants and Pathways of Nitrous Oxide Emissions from Soil Irrigated with Reclaimed Water
Next Article in Special Issue
Enhancing Tomato Growth and Quality Under Deficit Irrigation with Silicon Application
Previous Article in Journal
Reducing Nitrogen Application Rates and Straw Mulching Can Alleviate Greenhouse Gas Emissions from Wheat Field Soil and Improve Soil Quality
Previous Article in Special Issue
Response of Triticum Vulgare Growth and Nitrogen Allocation to Irrigation Methods and Regimes under Subsoiling Tillage
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Modeling the Effects of Irrigation and Its Interaction with Silicon on Quinoa Seed Yield and Water Use Efficiency in Arid Regions

1
Plant Production Department, Arid Lands Cultivation Research Institute (ALCRI), City of Scientific Research and Technological Applications (SRTA-City), New Borg El-Arab 21934, Alexandria, Egypt
2
Land and Water Technologies Department, Arid Lands Cultivation Research Institute (ALCRI), City of Scientific Research and Technological Applications (SRTA-City), New Borg El-Arab 21934, Alexandria, Egypt
3
Department of Biology, College of Science, Princess Nourah bint Abdulrahman University, P.O. Box 84428, Riyadh 11671, Saudi Arabia
4
Plant Protection and Biomolecular Diagnosis Department, Arid Lands Cultivation Research Institute (ALCRI), City of Scientific Research and Technological Applications (SRTA-City), New Borg El-Arab 21934, Alexandria, Egypt
*
Author to whom correspondence should be addressed.
Agronomy 2024, 14(9), 2088; https://doi.org/10.3390/agronomy14092088
Submission received: 19 August 2024 / Revised: 11 September 2024 / Accepted: 11 September 2024 / Published: 12 September 2024

Abstract

Despite quinoa (Chenopodium quinoa Willd.) gaining international popularity in the early 21st century for its nutritional benefits, there remains a critical need to optimize its cultivation practices in arid regions. Current research often overlooks the combined effects of supplemental irrigation and foliar treatments on quinoa’s yield and water efficiency, particularly under challenging environmental conditions like those in Borg El-Arab, Egypt. Field studies were conducted in Borg El-Arab, Alexandria, Egypt, during the winter seasons of 2021/2022 and 2022/2023 to determine the influence of supplemental irrigation (rainfed, 2000, and 4000 m3/hectare, respectively) and foliar spraying of sodium silicate (control, 200, and 400 ppm) on yield, yield components, seed quality, and water usage efficiency in quinoa cv. Chibaya grown in arid lands. Three replications were used in a split-plot design. The main plots were designated for irrigation, while the subplots were designated for foliar spraying. The results indicate that applying irrigation at a rate of 4000 m3/hectare significantly increased leaf dry weight per plant by 23.5%, stem dry weight per plant by 18.7%, total dry weight per 25 plants by 21.4%, leaf area per plant by 19.2%, and straw yield by 26.8% compared to the control treatment. There were no significant differences between irrigation with the rate of 4000 m3 or 2000 m3/hectare on biological yield kg/hectare, N (%), P (mg/100 g), and protein (%). The utilization of sodium silicate had no significance on all studied features except for straw yield kg ha−1 at the rate of 200 or 400 ppm. The results regarding the RAPD1 primer revealed that the 2000+0 silicon treatment was the only treatment that resemble the control with no up- or downregulated fragment. Moreover, 20 upregulated fragments were observed in all treatments, while 19 DNA fragments were downregulated. Furthermore, the results obtained regarding the RAPD2 primer revealed that 53 fragments were upregulated and 19 downregulated. Additionally, the RAPD3 primer demonstrated that 40 DNA fragments were upregulated, whereas 18 downregulated DNA fragments were detected. It may be inferred that the application of irrigation at a rate of 4000 m3 ha−1 might serve as a supplemental irrigation method. Spraying sodium silicate at a 400 mg L−1 concentration could alleviate the dry climate on the Egyptian shore.

1. Introduction

Quinoa (Chenopodium quinoa Willd.) is widely acknowledged for its remarkable tolerance to abiotic stress, making it an increasingly vital crop in challenging environments [1,2]. Originating in the Andean highlands of South America, quinoa has evolved under tough conditions marked by saline soils, drought, frost, and extreme temperature shifts [3,4,5,6]. Its unique adaptability, coupled with its rich nutritional profile, has sparked global interest in recent years [7,8]. Nevertheless, current quinoa production remains insufficient to meet the growing demand, especially under conditions of extreme environmental stress, such as drought and high salinity [3,4,9].
The anticipated effects of climate change include rising temperatures and irregular rainfall, leading to more frequent droughts, heatwaves, and heightened soil salinity, particularly in arid and semi-arid regions [10,11]. Moreover, poor irrigation management exacerbates water shortages, intensifying drought impacts. Projections suggest that by the 2090s, up to 30% of the world’s land area may experience severe drought [12]. Among the various abiotic factors, drought remains one of the most damaging to crop productivity [13]. Furthermore, increased evaporation rates due to high temperatures lead to significant water loss and greater salt buildup in soils [14]. The combined effects of drought and salinity pose serious threats to global food security, particularly in regions with limited water resources [15,16,17,18]. Therefore, integrated approaches are essential, including the implementation of smart irrigation techniques, foliar application of chemical compounds to boost plant resilience, and cultivating climate-resilient crops like quinoa and wheat [19].
Silicon (Si), the Earth’s second most abundant element [20,21], plays a critical role in enhancing plant growth and helping plants withstand various biotic and abiotic stresses [22]. Si has been shown to be particularly effective in improving plant tolerance to challenges such as heavy metals, drought, and extreme heat [23,24]. It strengthens plant cell walls by accumulating between cells and in outer layers, leading to increased leaf size, thickness, and dry weight [25,26]. Due to these benefits, Si is considered a vital nutrient for plants. Studies have consistently shown that Si application can positively impact crops like sorghum, rice, and wheat under drought conditions [25,27]. However, despite its abundance, Si availability in the biosphere is limited to just 0.03% [28,29]. Si is typically bound to other elements in soil, making it poorly soluble and difficult for plants to absorb [30]. Plants can only take up 0.1–0.6 mM of Si from water, making soluble silicate fertilizers an effective way to boost plant growth [31]. Despite its potential, research on Si’s role in enhancing drought resistance across diverse genetic lines remains limited, particularly in genotypes with varying Si accumulation capacities. Applying silicate to leaves helps form a protective silicate layer, reducing transpiration and helping plants manage drought stress more effectively while also reducing irrigation needs [32].
The ability of plants to withstand environmental stress is governed by a complex interplay of molecular mechanisms. Gaining insights into these mechanisms at the genetic level is key to developing crops with enhanced stress resilience [33,34]. Various molecular techniques are employed to study these responses, with differential display polymerase chain reaction (DD-PCR) being particularly effective for gene expression analysis [35]. DD-PCR is valued for its simplicity and wide applicability, allowing for the identification of genes that are either activated or suppressed under stress conditions [36,37]. This method was developed to overcome the limitations of older techniques, which were prone to errors, lacked sensitivity, and were time-consuming. Alongside DD-PCR, real-time PCR (RT-PCR) is recognized as one of the most precise methods for gene quantification, offering a broad dynamic range and high sensitivity, allowing for the detection of low-abundance transcripts and minor shifts in gene expression [6]. Evaluating gene expression under conditions of abiotic stress, such as drought, provides a more accurate understanding of antioxidant gene activation than enzyme activity measurements alone [36,38].
This study primarily aims to evaluate the effects of supplementary irrigation combined with foliar application of sodium silicate on quinoa yield and its yield components in Egypt’s arid conditions, addressing the country’s water scarcity and harsh climate.

2. Materials and Methods

The field study was conducted in Borg El-Arab, Alexandria, Egypt, located at 30.9133° N latitude and 29.5595° E longitude, with an elevation of approximately 5 m above sea level, about 10 km from the coast, during the winter seasons of 2021/2022 and 2022/2023. The region is characterized by a Mediterranean climate, with mild, wet winters and hot, dry summers. The average annual rainfall is around 200 mm, primarily occurring between November and February. Soil chemical and mechanical properties, as well as organic matter content, were analyzed at the Agricultural Research Center, Ministry of Agriculture, Egypt, following the procedures outlined in [39]. Table 1 summarizes the chemical and physical parameters of the soil at the testing site at depths ranging from 0 to 30 cm.
Low-quality irrigation water was indicated by an alkaline pH of 8.33, electrical conductivity of 2.98 dS m−1, and total dissolved salts of 2000 ppm. Soluble cation levels were 15.56, 8.23, 4.20, and 4.40 meq L−1 for Na+, K+, Ca2+, and Mg2+, respectively. Soluble anion levels were 18.20, 0.20, and 6.80 meq L−1 for Cl, CO32−, and HCO3, respectively.
The soil type in the study area is sandy loam, which is known for its good drainage but low nutrient retention capacity, making it suitable for drought-tolerant crops like quinoa.

2.1. Soil Analysis

Before initiating the experiment, the initial soil conditions were evaluated to establish a baseline for monitoring changes across different irrigation levels (Table 2 and Table 3). Throughout the study, soil samples were systematically collected from each subtreatment at two-month intervals, with three separate sampling periods. Each sample was air-dried, ground, and sieved through a 2 mm mesh to prepare for analysis, following the methods outlined in [40,41].
The distribution of soil particles was assessed using Robinson’s pipette method (Eijkelkamp Agriresearch Equipment, Giesbeek, the Netherlands). The total calcium carbonate content was determined by measuring the carbon dioxide released after treating the soil with 10% HCl. Soil pH and electrical conductivity (EC) were measured in soil–water suspensions with ratios of 1:2.5 w/v and 1:1 w/v, respectively.
Soluble cations such as sodium (Na+), potassium (K+), calcium (Ca2+), and magnesium (Mg2+) were analyzed in the 1:1 soil–water suspension. Sodium and potassium concentrations were measured using a flame photometer (PG Instruments M: FP902), while calcium and magnesium levels were determined through the EDTA titration method. Sulfate (SO42−) was quantified via barium sulfate precipitation, while chloride (Cl) and bicarbonate (HCO3) were measured by titration with silver nitrate and 0.01 N H2SO4, respectively.
Soil organic carbon (SOC) was determined using the Walkley–Black wet oxidation method. Dissolved organic carbon (DOC) was extracted by preparing a 1:5 (w/v) suspension of deionized water, shaking it for 24 h at 25 °C, and then filtering it through a 0.45 μm cellulose nitrate membrane filter. The DOC, which represents the soluble fraction of soil organic matter, was quantified using a TOC Analyzer (Torch Combustion TOC/TN Analyzer—Teledyne Tekmar, Ohio, USA) [42,43]. The DOC/SOC ratio was computed to reflect the proportion of dissolved organic carbon in the total organic carbon content.
Total nitrogen was assessed using the Kjeldahl method, and available phosphorus was extracted with 0.5 M NaHCO3 at pH 8.5 [39] and analyzed with a PG Instruments T80 UV/VIS Spectrophotometer. The C:N stoichiometric ratio, known as the “Redfield ratio”, was calculated based on the molar concentrations of carbon, nitrogen, and phosphorus [42]. Additionally, the cation exchange capacity (CEC) was calculated by summing the concentrations of all cations, and the effective percentage of each cation was reported as Na effective, K effective, Ca effective, and Mg effective, in cmol/kg.
Soil respiration generally increases as soil moisture increases [44]. Soil respiration, expressed as the metabolically emitted CO2 from the soil, was detected by the soda lime absorption method using the dark cover-box technique in the field [42]. Emitted CO2 from the soil surface was measured according to the delimited area incubated with soda lime for 24 h. Calculations were obtained after oven-drying of soda lime, then multiplied by 1.69 as a correction factor and presented in mg g−1 soil. The soil carbon loss emitted to the atmosphere as C-CO2 was calculated (CO2 readings multiplied by 12/44: M.W. of C/CO2) and then expressed in mg g−1 [42].
The calculation for irrigation water productivity (IWP) in kg m−3 was based on the method in [45]:
I W P = Y a A I W
where Ya is the seed yield from different treatments (kg ha−1) and AIW is the seasonal amount of applied water (m3 ha−1), determined using the following formula:
A W = A I W + P e f f + S
In this equation, AIW represents the applied irrigation water, Peff accounts for effective rainfall during the growing season, and S is the groundwater contribution to crop water use (which was disregarded since the water table was deeper than 2.0 m) [46].
The experimental field received a fertilization treatment consisting of 357 kg ha−1 of superphosphate (containing 15.5% P2O5) during seedbed preparation. This fertilizer was evenly mixed into the soil prior to sowing by raking to a depth of 10–15 cm, ensuring proper nutrient distribution. Nitrogen was supplied in the form of ammonium nitrate (33.5% N) at a rate of 238 kg ha−1. The nitrogen application was split into two equal doses: the first half was applied at the time of planting, while the remaining half was administered during the first irrigation and after initial rainfall. The experimental design was a split-plot arrangement with three replications. The main plots were designated for different irrigation treatments, while the subplots were used for foliar spray applications, following the assigned treatment layout.
A. Irrigation treatments (main plots): Three interventions were administered, encompassing the following:
  • Rainfed (I1) refers to agricultural practices that rely solely on rainfall (without irrigation).
  • The overall irrigation volume is 2000 m3 per hectare, supplemented by rainwater during the planting and flowering stages (I2).
  • The total amount of water used per hectare is 4000 m3, during the planting, blossoming, and seed-filling stages (I3).
B. Sodium silicate was sprayed on the leaves at three different concentrations (control, 200 ppm, and 400 ppm) one month after planting the seeds. This application was repeated after two weeks.
The quinoa seeds sourced from Egypt’s desert research center were manually sown into the hill in early December and gathered in early April for two consecutive seasons.
The plot of land had an area of 6 square meters, with a size of 2 m by 3 m. Each plot consisted of four ridges spaced 50 cm apart, with one plant per hill.

2.2. The Studied Characteristics

The study evaluated several growth and yield parameters, including leaf dry weight per plant (g), stem dry weight per plant (g), total plant dry weight (g), leaf area per plant (cm2), plant height (cm), biological yield (kg ha−1), seed yield (kg ha−1), straw yield (kg ha−1), harvest index percentage (HI), and 1000-seed weight (g). Additionally, seed flour samples were collected at harvest to analyze their nutritional content, specifically protein, nitrogen (N%), phosphorus (P mg/100 g), and potassium (K mg/100 g) concentrations [47,48,49,50].

2.3. Artificial Neural Networks (ANNs)

Artificial neural networks (ANNs) are advanced computational models composed of numerous interconnected units known as neurons, which are designed to simulate the behavior of biological neurons in the human brain [51]. In this research, a three-layer feed-forward multilayer perceptron (MLP) neural network was implemented to assess the impact of different treatments on quinoa seed yield. The MLP structure consisted of an input layer with two neurons, a hidden layer containing six neurons, and an output layer with a single neuron. The network was trained using the backpropagation algorithm, employing a Sigmoid activation function in the hidden layer and a linear activation function in the output layer. To evaluate the model’s effectiveness, the coefficient of determination (R2) and root mean square error (RMSE) were calculated. The dataset was split into 80% for training and 20% for testing the network’s performance. Following the training and testing phases, the final connection weights were analyzed to determine the relative significance of each treatment. Key training parameters included a learning rate of 0.01, a momentum factor of 0.9, and 350 epochs [52].

2.4. Molecular Evaluations

2.4.1. Quantitative Real-Time PCR (RT-PCR)

Total RNA was extracted from both control and treated plant tissues in triplicate using Trizol reagent, following the guidelines provided by the manufacturer. To remove any contaminating genomic DNA, the RNA samples were treated with RNase-free DNase (Promega, Madison, WI, USA). Complementary DNA (cDNA) was synthesized by reverse transcribing the RNA with M-MULV Reverse Transcriptase (200 units/µL, Biolabs, Hitchin, UK). The reverse transcription process involved incubating at 42 °C for one hour, followed by a heat-inactivation step at 95 °C for 5 min, using a thermocycler (MJ Research, Inc., PTC-100 TM Programmable Thermal Controller, Waltham, MA, USA). The resulting cDNA was then stored at −20 °C for future analyses.
In this study, two specific primers targeting defense genes were employed, and their sequences are detailed in Table 4. The real-time PCR reaction mixture consisted of 12.5 µL SYBR Green, 1 µL each of forward and reverse primers, and 1 µL of cDNA (50 ng) as the template, with sterile distilled water added to reach a final volume of 25 µL. The PCR conditions were as follows: an initial hot start at 95 °C for 15 min, followed by 45 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 15 s, and extension at 72 °C for 30 s, using the Rotor-Gene 6000 system (Qiagen, Hilden, Germany). β-actin was used as the reference gene [53]. The relative expression levels of the genes were calculated according to the method described in [54].

2.4.2. Differential Display (DD-PCR) Reaction

To identify genes that were upregulated or downregulated in control versus treated samples, three distinct RAPD primers (RAPD1, RAPD2, and RAPD3), as listed in Table 4, were utilized. The cDNA obtained through amplification served as the template for the differential display PCR reaction. The reaction mixture comprised 10 μL of master mix, 1 μL of cDNA (50 ng), 5 μL of RAPD primer (10 pmol/μL), and sterile distilled water to bring the total volume to 20 μL.
The PCR process was carried out with the following protocol: an initial denaturation at 95 °C for 3 min, followed by 40 cycles consisting of denaturation at 94 °C for 45 s, annealing at 30 °C for 45 s, and extension at 72 °C for 1 min. The reaction concluded with a final extension at 72 °C for 5 min. To analyze the PCR products, 5 μL of each was subjected to agarose gel electrophoresis using a 1.5% (w/v) gel. The sizes of the PCR fragments were estimated using a DNA molecular weight marker, and the resulting gel images were captured using a Gel Documentation System.

2.5. Statistical Analysis

The statistical analysis was conducted using STATISTICA 10, a software developed by StatSoft, Inc., Tulsa, OK, USA [55]. A one-way analysis of variance (ANOVA) was conducted to examine the soil parameters’ variability under irrigation effects. The categorical component used to assess the significant variation of each dataset acquired from irrigation treatments (I1, I2, and I3) was the sampling times (1st, 3rd, and 5th month).
Factor analysis is a statistical process that examines a set of complicated variables to determine the underlying dimensions that underlie their interactions. It also simplifies a correlation matrix, allowing you to better grasp the link between variables on a scale and the underlying reasons that the items may contain. For every dataset produced from irrigation treatments (I1, I2, and I3), three iterations of factor analysis were carried out, and the correlation between the two factor structures and their associated factor scores was given. All of the data gathered during the observed period were used for factor analysis, and the relationship between the first two factors and their associated factor scores was also shown.
The obtained variations resulting from the treatments were subjected to statistical analysis using one-way analysis of variance (ANOVA) to determine their significance level. The statistical methods employed in this study were based on the guidelines provided in [56], and the analysis and the least significant difference (LSD) calculations were conducted using the Costat software on the Windows platform. The provided data represent the average of three separate replicates, with the standard deviation shown.
The phylogenetic tree was built using the method from [57].
The Tukey test was employed to ascertain the statistical significance of different treatments (p < 0.05) [58]. The data underwent statistical analysis using the method from [57].
The combined analysis for both seasons was conducted after assessing the homogeneity of the error using Bartlett’s test. The means of the various treatments were compared using the least significant difference (LSD) test at a significance level of p < 0.05.

3. Results

3.1. Soil Response to Irrigation Treatments

The soil texture in the study area was classified as sandy clay loam, comprising 62.43% sand, 13.02% silt, and 24.55% clay. Soil salinity and alkalinity were moderate, with significant increases in salinity corresponding to higher levels of soluble cations such as K+, Ca2+, and Mg2+ across the irrigation treatments (Table 5 and Table 6). The application of increased irrigation volumes enhanced soil water retention, which positively influenced overall soil chemical properties, suggesting that regular irrigation intervals improve soil buffering capacity in the upper soil layers (Table 5 and Table 6).
As irrigation volumes increased, soil salinity decreased, and levels of organic carbon and nitrogen reflected heightened microbial activity due to changes in soil moisture content (Table 5 and Table 6). Significant variations were observed in soil moisture, electrical conductivity, organic carbon, nitrogen, and phosphorus, with the stoichiometric balance of carbon, nitrogen, and phosphorus indicating that nutrient limitations, particularly in nitrogen and phosphorus, persisted throughout the study (Table 2 and Table 3).
The N/P ratio increased significantly with higher irrigation levels, implying that nitrogen forms were more stable than phosphorus in this soil (Table 3). This balance, critical for maintaining soil fertility, was notably influenced by irrigation, with more frequent irrigation leading to improved nutrient dynamics (Table 3).
Moreover, carbon dioxide emissions from the soil, an indicator of carbon loss and microbial activity, increased with higher irrigation volumes, showing a strong correlation between soil carbon loss and the soil’s nitrogen and phosphorus content (Table 4). The increased irrigation also resulted in significant changes in soluble cations and anions, which in turn enhanced the soil’s cation exchange capacity, reflecting improved soil health with more frequent watering (Table 5 and Table 6).

3.2. Factor Analysis for Soil Response

Factor analysis of the soil data revealed that the first three factors accounted for 85% of the total variance (Table 2 and Table 3). The first factor, explaining 59% of the variance, showed strong positive loadings from available phosphorus, soluble bicarbonates, chlorine, sulfates, and calcium. This suggests that the I1_M3 and I2_M1 treatments enhanced the solubility of these nutrients, particularly under irrigation levels I1 and I2. On the other hand, negative loadings were associated with total nitrogen, molar C/P and N/P ratios, soil respiration (CO2), soluble sodium, and dissolved organic carbon, with I1_M5 and I3_M5 contributing most to these negative effects. This indicates that soil carbon, nitrogen, and phosphorus evolved differently under these treatments.
The second factor, explaining 15% of the variance, had high positive loadings from soil pH and effective sodium percentage, with the I2_M5 treatment showing the highest factor scores. Negative loadings were linked to electrical conductivity, soluble potassium, calcium, magnesium, and cation exchange capacity, with I1_M1 and I3_M1 treatments significantly influencing soil salinity early in the study (Table 5 and Table 6).
The third factor accounted for 11% of the variance, with negative loadings from soil organic carbon and positive loadings from soil pH and soluble anions. The I1 treatments in the 3rd and 5th months had high factor scores, suggesting that changes in soil alkalinity may affect soil organic carbon deposition.
Figure 1 illustrates the distribution of factor loadings and the contributions of each treatment to these factors. Overall, the analysis indicates that irrigation timing, which impacts soil moisture, plays a significant role in the dynamic changes in soil carbon conservation.
To analyze soil nutrient dynamics across different irrigation treatments over time, factor analysis was performed on the data collected from each irrigation treatment (I1, I2, and I3) at three different times (M1, M3, M5). The results are illustrated in Figure 1.
For the first irrigation treatment (I1), the first factor explained 65% of the variance, showing high positive loadings from soil salinity, calcium carbonate, soluble cations, and anions, and cation exchange capacity (Table 5 and Table 6). These factors were most pronounced in data from the first month (M1). Conversely, the highest negative loadings were from soil moisture, alkalinity, and organic carbon, with significant contributions from the third month (M3). The second factor, which accounted for 35% of the variance, displayed high negative loadings from soil respiration, dissolved organic carbon, total nitrogen, and related parameters, with contributions from the fifth month (M5). This pattern suggests that soil parameters developed from cations and anions in the first month, water and carbon retention in the third month, and nutrient balance by the fifth month.
For the second irrigation treatment (I2), the first factor explained 85% of the variance, with high positive loadings from calcium carbonate, soluble cations and anions, and cation exchange capacity, primarily from the first-month data (Table 5 and Table 6). The highest negative loadings were observed in soil moisture, respiration, and organic carbon, with significant contributions from the fifth month. The second factor, accounting for 15% of the variance, showed negative loadings from total nitrogen and organic carbon, with notable contributions from the fifth month. This indicates that salinity and ion concentrations were dominant in the first month, with a reduced focus on soil alkalinity by the third month, and an emphasis on organic carbon and nutrient balance by the fifth month.
For the third irrigation treatment (I3), the first factor explained 75% of the variance, showing positive loadings from cation exchange capacity, available phosphorus, soil salinity, and soluble minerals, with the highest contributions from the first month (Table 5 and Table 6). Negative loadings were associated with soil moisture, respiration, and various nutrient ratios, with contributions from the fifth month. The second factor, explaining 15% of the variance, revealed high negative loadings from soil salinity and organic carbon, with positive loadings from alkalinity and moisture, mainly from the fifth month. This suggests that soil cations and salinity were prominent in the first month, soluble anions and alkalinity in the third month, and soil moisture and nutrient balance by the fifth month.

3.3. Irrigation Effects on Plant Growth

For irrigation rates of 1000, 2000, and 4000 m3 per hectare, respectively, the irrigation water productivity (IWP) was 0.87, 0.45, and 0.34 kg m−3. With the same irrigation rate order, seed yield most likely increased by 871.79, 891.16, and 1374.07 kg ha−1.
The data in Table 7 show the influence of three irrigation treatments on quinoa cv. Chibaya leaf dry weight/plant (g), stem dry weight/plant (g), plant dry weight (g), and leaf area/plant (cm2). All irrigation treatments showed substantial changes. The findings demonstrated that irrigation had a substantial impact on dry weight/plant (g), stem dry weight/plant (g), plant dry weight (g), and leaf area/plant (cm2). I3 had the greatest influence on all evaluated features when comparing treatments.
Sodium silicate did not significantly influence the growth parameters described.
Interactions showed no meaningful influence on any growth variables tested.

3.4. Yield and Components of Yield

Table 8 shows the influence of three irrigation treatments on the plant height (cm), seed yield kg ha−1, straw yield kg ha−1, 1000-seed weight (g), and harvest index (%) of quinoa cv. Chibaya. Except for biological yield kg ha−1 and straw yield kg ha−1, there were no significant variations between irrigation treatments. Irrigation substantially affected seed yield, biological yield kg ha−1, and straw yield kg ha−1, according to the findings. I3 had the most significant impact on all the features studied between treatments. Furthermore, there was no statistically significant difference in biological yield (kg ha−1) between I3 and I2.
Except for straw yield (kg ha−1), sodium silicate had no noticeable effect on the yield variables stated. There were no significant differences when I3 and I2 were compared to the control. Interactions had no discernible effect on any of the yield attributes studied except for biological yield kg ha−1 and straw yield kg ha−1 (Table 8).
Figure 2 depicts the interaction of irrigation volume and sodium silicate on seed yield kg ha−1, biological yield kg ha−1, and straw yield kg ha−1. The data in Table 8 show that combining I3 with any sodium silicate increased biological yield kg ha−1 and straw yield kg ha−1 significantly more than the other irrigation volumes.
Table 8 shows the influence of three irrigation treatments on N (%), P (mg/100 g), K (mg/100 g), and protein (%) in quinoa cv. Chibaya. There were substantial variations across all irrigation treatments. The data demonstrated that I3 and I2 had the most significant impact on N (%), P (mg/100 g), and protein (%). I1 and I2, on the other hand, had the most significant influence on K (mg/100 g).
The data in Table 8 demonstrate that using a control or 200 ppm of sodium silicate with I1 or 200 ppm or 400 ppm of sodium silicate were among the treatments with the highest K (mg/100 g) compared to other treatments.
Figure 3 illustrated that neurons are organized into three layers: input, hidden, and output. The neurons in one layer are linked to those in the next layer but not those in the same layer. The relative importance of the inputs as a percentage is estimated using the strength of the connection weights between two neurons between layers (Ibrahim et al., 2022). Figure 4 shows that irrigation was the most crucial factor in yield (55.1%), followed by silicon (31.3%), with an 11.7% interaction (Table 9).

3.5. DD-PCR

Differential display was performed to examine the plant response toward silica treatment and the irrigation type. The differential display PCR presented in Figure 5 shows the induced and/or suppressed gene pattern affected by the treatment approach. The results presented in Figure 5 regarding RAPD1 primer revealed that the 800 + 0 S treatment was the only treatment that resembled the control with no up- or downregulated fragments. Moreover, 20 upregulated fragments were observed in all treatments, while 19 DNA fragments were downregulated. Furthermore, the results obtained in Figure 5 regarding RAPD2 primer exposed that 53 fragments were upregulated and 19 downregulated.
Additionally, Figure 5, concerning the RAPD3 primer, demonstrated that 40 DNA fragments were upregulated, whereas 18 downregulated DNA fragments were detected.
Furthermore, the dendrogram phylogenetic tree constructed using the results of DD-PCR of the up- and downregulated fragments (Figure 6) divided the genetic variation among the examined samples into two main clusters. Cluster one contains the treatment with silica 200, whereas the second cluster contains all the rest of the treatments, including the control. Cluster two was divided into two groups; group one contained the samples, control, and 0 silica, and the second group included the rest of the samples.

3.6. RT-PCR

Two drought-responsive genes were evaluated quantitatively using RT-PCR to study the response of quinoa to silica and irrigation treatment at the gene level. Figure 7 presents the relative gene expression (DRF 1 and CBF 3) of the quinoa plant under the treated and non-treated silica and water irrigation regimes. The results of Figure 7a revealed a highly significant increase in DRF1 gene relative expression in treatments 2 (200 silicon), 3 (400 silicon), 4 (rainfed+0 silicon), 6 (rainfed+400 silicon), 8 (2000 W+200 silicon), and with 4000 W+200 silicon compared to the control; the most pronounced gene enhancement was under treatments 4 and 8, where the increase percentage reached a 2.5-fold change. On the contrary, treatments 5, 7, 9, and 11 exhibited non-significant change compared to the control, while the most pronounced gene reduction was observed under treatment 10. Regarding CBF 3 gene relative expression, the data in Figure 7b revealed that all treatments under study increased the CBF3 gene significantly compared to the control except for treatment 5, as the gene expression decreased significantly relative to the control. The most pronounced increase was under treatments 8, 9, and 12, where the gene fold change reached 3.5-fold compared to the control.

4. Discussion

4.1. Soil

Soil balance can be achieved by reaching the 106:16:1 ratio for C:N:P, as primarily reported in marine ecosystems in [42,59]. This ratio was subsequently adapted to terrestrial ecosystems within an acceptable range due to the heterogeneity of soil biomass communities. Ref. [60] reported a stable and reproducible ratio of 186:13:1 for a wide range of soil ecosystems, while [61] reported this ratio in soil microbial biomass as 134:9:1. Our results showed that soil in the first irrigation treatment had a ratio of 37.93:2.40:1, 36.58:2.30:1 in the second irrigation, and 36.38:3.10:1 in the third irrigation, with an average of 37:3:1 for the stoichiometric balance of C, N, and P in these soil ecosystems. A slight decrease in molar C/P ratio with increasing irrigation revealed that organic carbon utilization was high with the increase in phosphorus despite the meager contents of both elements (Table 3). The N/P ratio increased significantly (F = 18.69, p = 0.000) in the third irrigation treatment compared to the other treatments, indicating that nitrogen forms were more stable in this soil than phosphorus forms, despite significant variation in C/P along the irrigation times (F = 35.77, p = 0.000). This may be attributed to the nature and diversity of microbial communities in soil. The C/P ratio significantly increased, with the N/P ratio emphasizing the same concept. Accordingly, it can be concluded that the soil–plant interaction mediated by soil microbes can be developed to enhance soil structure and soil fertility through biochemical cycles of soil carbon, nitrogen, and phosphorus [42,62]. This balance has recently been accepted as a reliable indicator of nutrient limitations in terrestrial ecosystems [42]. As a result, these soils can be classified as nitrogen- and phosphorus-limited, as ratios were lower than 106:16:1, causing an imbalance of nutrient dynamics which was highly affected by the scarcity of their contents [42].

4.2. Plant

4.2.1. Impact of Irrigation Rates and Sodium Silicate on Quinoa cv. Chibaya

Irrigation Water Productivity (IWP) and Seed Yield
This trend suggests that higher irrigation rates may lead to diminishing returns in terms of water use efficiency. However, the seed yield increased significantly with higher irrigation rates, showing increments of 871.79, 891.16, and 1374.07 kg ha−1, respectively. This demonstrates that although higher irrigation volumes may reduce water productivity, they substantially enhance seed yield, which is a crucial factor for agricultural productivity.
Several quinoa varieties [63] exhibited pollen sterility when subjected to temperatures over 35 °C, leading to inadequate seed production and reduced yield. Hot regions in Washington State have had diminished quinoa production, as documented by Peterson in 2013. Irrigation has the capacity to enhance seed yield while mitigating heat stress, as seen by the much higher seed production in the irrigated plots compared to the non-irrigated plots. Martínez et al. [64] reported that increasing irrigation treatments within each location in Chile resulted in increased seed yields. The sea-level quinoa types ‘QQ74’ and ‘17GR’ exhibited comparable reactions when cultivated at a temperature of 40/24 °C, as reported in [65]. Brakez et al. [66] has shown comparable results.

4.2.2. Effects of Sodium Silicate

The study found that sodium silicate did not significantly influence the growth parameters measured. This indicates that, under the conditions of this experiment, sodium silicate did not enhance the growth performance of quinoa cv. Chibaya. This lack of effect may be due to the specific soil and environmental conditions or the inherent characteristics of the quinoa variety used.
In the study conducted in [67], it was shown that there was no statistically significant correlation between the silicon concentration and grain yield in 10 different genotypes of durum wheat. As far as we know, there have been no studies that have established a connection between changes in silicon buildup and variations in stress tolerance.
When examining the influence of Si on certain landraces, a comparable outcome is obtained. Consequently, these discoveries contrast with other studies on wheat which demonstrated that Si enhances growth in the presence of osmotic and drought stress [68,69]. However, previous research conducted on wheat subjected to osmotic and drought stress did not observe a substantial rise in shoot dry weight biomass [70,71]. In addition, there have been reports indicating that numerous additional crop species do not exhibit a response to silicon. As an illustration, the study conducted in [72] found that the addition of Si did not enhance soybean growth under drought conditions, despite its ability to decrease membrane damage and increase peroxidase activity. Osmotic stress led to an increase in tissue silicon levels but did not have any impact on biomass in barley [73]. Similarly, tall fescue had a comparable outcome [21].

4.2.3. Yield and Yield Components

The significant impact of irrigation treatments on plant height, seed yield, biological yield, and straw yield underscores the critical role of water availability in quinoa production. The pronounced effect observed at the highest irrigation rate (I3) indicates that quinoa is highly responsive to increased water supply. This aligns with quinoa’s physiological need to optimize growth and yield, particularly in arid conditions where water is a limiting factor. The lack of significant differences in biological and straw yield between the highest (I3) and moderate (I2) irrigation rates suggests a saturation point beyond which additional water does not translate into proportional yield benefits. This plateau effect might be due to the plant’s maximum water uptake capacity or other limiting factors like nutrient availability or root system efficiency.
The absence of significant interaction effects between irrigation and sodium silicate treatments on growth and yield parameters suggests that sodium silicate might not be enhancing plant water use efficiency or stress tolerance under the conditions of this study. This could be due to several factors, such as the concentration of sodium silicate used, the timing of application, or the specific environmental conditions during the experiment. It is also possible that quinoa’s inherent tolerance to abiotic stress, including drought, reduces the potential benefits of sodium silicate application.
In terms of nutrient analysis, the substantial variations in nitrogen (N), phosphorus (P), and protein content across different irrigation treatments highlight the importance of adequate water supply for nutrient uptake and assimilation. The increased availability of water likely enhances nutrient mobility in the soil and promotes more efficient root absorption. Interestingly, the higher influence of the moderate (I2) and lowest (I1) irrigation rates on potassium (K) content suggests that potassium uptake might be regulated differently, potentially involving mechanisms less dependent on water availability, such as soil potassium reserves or plant-specific uptake pathways.
The limited impact of sodium silicate on nutrient content, except for K content in certain treatments, suggests that while sodium silicate might affect specific nutrient pathways, its overall effectiveness as a foliar amendment under the given experimental conditions is minimal. This could be due to quinoa’s ability to maintain nutrient uptake efficiency even under lower water availability, rendering sodium silicate less impactful in altering nutrient dynamics [74].

4.3. Implications and Future Research

The findings of this study emphasize the critical role of irrigation in optimizing the growth and yield of quinoa cv. Chibaya. While higher irrigation volumes improve seed yield and overall plant biomass, they also highlight the need for efficient water management practices to enhance irrigation water productivity. Future research should explore the long-term effects of irrigation and soil amendments like sodium silicate on quinoa growth under varying environmental conditions. Additionally, investigating the underlying mechanisms of nutrient uptake and assimilation in response to irrigation could provide valuable insights for developing sustainable agricultural practices.
The observed inconsistencies in the effect of silicon across different studies may be attributed, at least in part, to variations in methodology. For instance, several investigations employed Na or K silicate as the Si treatment but failed to consider the levels of cations in the control treatment. The observed Si response is most likely attributed to the use of extra Na or K fertilizers. Interpretational divergence can lead to misunderstandings. Numerous research studies indicate that Si has a favorable impact on tolerance to osmotic or drought stress. Indeed, the impact of Si is already evident in the control treatments and is therefore not exclusive to stress conditions.
An additional significant element may be the genotype-specific silicon responses. According to [32], the beneficial impact of silicon on poinsettia development was influenced by the specific cultivar under normal conditions. The response of different sugarcane cultivars to Si under water stress conditions varied, with only one out of the four studied cultivars demonstrating a statistically significant improvement in dry weight [75]. The study conducted in [76] found that when examining 12 different sunflower cultivars, they observed similar effects of Si on genotype-specific traits under drought stress. Ref. [77] observed variations in the physiological reaction to osmotic stress and silicon buildup among 10 different wheat varieties. The effects of silicon (Si) exhibit significant variety depending on the genotype. This variability may account for the absence of Si responses, as the accumulated positive and negative changes in stress tolerance within individual landraces counteract each other. The notion that Si corresponds with tissue Si contents was rejected due to the lack of impact of Si fertilization on stress tolerance. Nevertheless, intriguing correlations between stress and tissue silicon (Si) content were identified; shoot Si levels experienced a notable decrease under osmotic stress, whereas the converse was observed following drought exposure, with Si content exhibiting an increase [78]. The observed impacts were consistently present in the majority of landraces. Prior studies have indicated that Si buildup decreases in response to osmotic stress generated by PEG [73,79]. In addition, a study conducted in [68] and other research on many species have demonstrated that the buildup of silicon diminishes under conditions of drought stress. However, prior studies [80] have revealed an increase in Si levels during drought, which is also observed in this study. The physiological significance of these processes and their potential role in linking Si buildup and stress response remains uncertain. The physiological responses to osmotic and drought stress are similar, which may result in incorrect assumptions about the simultaneous changes in Si accumulation in response to both situations. However, it is important to note that this may vary according to the species.

4.4. Genetics

The present investigation focuses on understanding and explaining the processes of control and stress tolerance at the molecular level. The aim is to develop molecular strategies for enhancing the tolerance of plants. This research mostly revolves on analyzing the expression patterns (whether increased or decreased) of specific genes associated with stress response. Differential display reverse transcriptase polymerase chain reaction (DDRT-PCR) is a highly effective and reliable technology for analyzing gene expression. It offers various advantages over other methods of gene expression analysis [35]. Furthermore, the simplicity and wide-ranging applicability of this technique rendered it highly innovative. It has been effectively employed in several organisms, ranging from yeast to mammals. This strategy was devised and refined to expedite the identification of genes that are expressed differently, in order to address the limitations of previous methods that were prone to errors, unresponsive, and laborious.
The DD-PCR profiles of quinoa samples exhibited significant alterations in gene patterns when subjected to drought treatment under different water regimes. This observation aligns with the findings of [81] in their study on stressed maize. Furthermore, the expression of the aforementioned fragments may play a vital function in controlling the condition of plants in the presence of both living and non-living stress factors. A separate investigation utilizing DD-PCR was conducted on sunflowers to analyze gene expression in response to untreated conditions, salt stress, or drought stress. This study identified distinct genes that were either upregulated or downregulated [38]. Moreover, the induced and/or the suppressed gene pattern affected by the treatment approach compared to the untreated control may have a substantial role in the acclimation and tolerance of plants to stress, as mentioned in [82] for wheat under different stress factors.
Plants’ growth and efficiency are influenced by different non-living factors that trigger molecular systems in plants, enabling them to adapt to unfavorable situations. Real-time PCR is a reliable and efficient method for diagnosing climate changes in plants, providing accurate and exact assessments. This technology contributes to enhancing agricultural productivity. The geographical distribution of plants is constrained by drought, excessive salinity, and extreme temperatures due to their ability to induce dehydration and subsequent cellular demise [83]. The presence of drought stress hampers the growth of plants, reduces the concentration of pigments, and diminishes the mineral content by inducing osmotic stress and the generation of reactive oxygen species (ROS) [30].
Plants have evolved systems to adapt to or tolerate stress, such as tissue tolerance to osmotic stress and the regulation of mineral homeostasis [84]. These mechanisms are particularly important for plant development and yield [85]. A multitude of genes have been found and linked to increased stress tolerance in plant species through genetic methodologies. The genes in question encompass regulatory genes, such as transcription factors (specifically, the CBF/DRF family), which play a role in signaling pathways and regulate the expression of genes further downstream [86]. The expression of the dehydration-responsive factor (DRF1) gene was associated with the reaction to water deficit stress, as indicated in [87]. The qRT-PCR results depicted in Figure 3 demonstrate the expression pattern of the DRF1 gene under control and water stress conditions, with and without silica. These findings align with the research conducted in [88], which observed a significant increase in Hordeum vulgare (HvDRF1) expression under abiotic stress and suggested its involvement in ABA-mediated gene regulation.
Additionally, the CBF family genes have a crucial function in the signal transduction pathways of many stressors such as low temperature, drought, and salinity. They also contribute to the tolerance of plants to these stressors [89]. The expression of CBF3 genes is promptly stimulated by drought and salinity stress, and occasionally by low temperatures in several plant species [90]. Significantly, the overexpression of this gene in rice has been proven to improve resistance to drought stress [91].
The findings depicted in Figure 3, as unveiled by qRT-PCR, are consistent with previous studies conducted in [89]. These studies have demonstrated the significance of CBF genes, which encode C-repeat-binding factor (CBF) proteins, in the signaling pathways associated with drought and salinity stress. In addition, CBF proteins control the transcription of numerous target genes (such as rd29A, cor15A, and kin1) that play a role in the removal of reactive oxygen species (ROS) [91]. In addition, they demonstrated that the excessive production of Arabidopsis thaliana (AtCBF3) greatly improves the ability of salt-susceptible rice to withstand high salinity levels. Moreover, [92] discovered that HvCBF3 genes play a role in the ability of Tibetan barley to tolerate salinity. Hence, the increase in both DRF1 and CBF 3 under silica treatment of quinoa indicates their roles in increasing plant resistance/tolerance against drought stress.

5. Conclusions

The findings from this study underscore the critical role of irrigation regimes in influencing soil properties and plant growth. Enhanced irrigation intervals, particularly with the highest rate (I3), significantly improved soil chemical properties by enhancing buffering capacity and nutrient dynamics. Soil moisture, electrical conductivity, and organic carbon content varied markedly with irrigation treatments, reflecting their impact on soil fertility and nutrient cycling. Despite observed improvements in dry weight and leaf area with increased irrigation frequency, the stoichiometric balance of C, N, and P remained below optimal levels, indicating persistent limitations in N and P availability. The most substantial yield improvements in quinoa were achieved with the highest irrigation volume, affirming the importance of adequate water supply for maximizing yield. Sodium silicate treatments showed minimal impact on growth parameters, suggesting limited effectiveness under the current experimental conditions. Notably, significant gene expression changes related to drought response were observed with different irrigation and silica treatments, highlighting potential avenues for enhancing plant stress resilience. Overall, these results emphasize the need for optimizing irrigation schedules to balance soil moisture and nutrient availability, offering valuable insights for sustainable soil management and crop productivity in arid and semi-arid environments. Future research should build on these findings to refine irrigation strategies and further investigate the interactions between water management, soil health, and plant growth.

Author Contributions

Conceptualization, A.M.E.-T., M.E., A.M.W., S.E.S. and O.M.I.; methodology, A.M.E.-T., M.E., F.A.S., A.M.W., S.E.S. and O.M.I.; software, A.M.E.-T., M.E., F.A.S., A.M.W., S.E.S. and O.M.I.; validation, A.M.E.-T., M.E., F.A.S., A.M.W., S.E.S. and O.M.I.; formal analysis, A.M.E.-T., M.E., F.A.S., A.M.W., S.E.S. and O.M.I.; investigation, A.M.E.-T., M.E., F.A.S., A.M.W., S.E.S. and O.M.I.; resources, A.M.E.-T., M.E., F.A.S., A.M.W., S.E.S. and O.M.I.; data curation, A.M.E.-T., M.E., A.M.W., S.E.S. and O.M.I.; writing—original draft preparation, A.M.E.-T., M.E., A.M.W., S.E.S. and O.M.I.; writing—review and editing, A.M.E.-T., M.E., F.A.S., A.M.W., S.E.S. and O.M.I.; visualization, A.M.E.-T., M.E., F.A.S., A.M.W., S.E.S. and O.M.I.; supervision, A.M.E.-T., M.E., A.M.W., S.E.S. and O.M.I.; project administration, A.M.E.-T., M.E., F.A.S., A.M.W., S.E.S. and O.M.I.; funding acquisition, F.A.S. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2024R318), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Acknowledgments

This work was supported by Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2024R318), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ain, Q.T.; Siddique, K.; Bawazeer, S.; Ali, I.; Mazhar, M.; Rasool, R.; Mubeen, B.; Ullah, F.; Unar, A.; Jafar, T.H. Adaptive mechanisms in quinoa for coping in stressful environments: An update. PeerJ 2023, 11, e14832. [Google Scholar] [CrossRef]
  2. Taaime, N.; Rafik, S.; El Mejahed, K.; Oukarroum, A.; Choukr-Allah, R.; Bouabid, R.; El Gharous, M. Worldwide development of agronomic management practices for quinoa cultivation: A systematic review. Front. Agron. 2023, 5, 1215441. [Google Scholar] [CrossRef]
  3. El-Hakim, A.; Ahmed, F.; Mady, E.; Abou Tahoun, A.M.; Ghaly, M.S.; Eissa, M.A. Seed Quality and Protein Classification of Some Quinoa Varieties. J. Ecol. Eng. 2022, 23, 24–33. [Google Scholar] [CrossRef]
  4. Jacobsen, S.-E. The Worldwide Potential for Quinoa (Chenopodium quinoa Willd.). Food Rev. Int. 2003, 19, 167–177. [Google Scholar] [CrossRef]
  5. Jacobsen, S.-E.; Mujica, A.; Jensen, C.R. The Resistance of Quinoa (Chenopodium quinoa Willd.) to Adverse Abiotic Factors. Food Rev. Int. 2003, 19, 99–109. [Google Scholar] [CrossRef]
  6. Nolan, T.; Hands, R.E.; Bustin, S.A. Quantification of mRNA using real-time RT-PCR. Nat. Protoc. 2006, 1, 1559–1582. [Google Scholar] [CrossRef]
  7. Adetunji, C.O.; Michael, O.S.; Kadiri, O.; Varma, A.; Akram, M.; Oloke, J.K.; Shafique, H.; Adetunji, J.B.; Jain, A.; Bodunrinde, R.E. Quinoa: From farm to traditional healing, food application, and Phytopharmacology. In Biology and Biotechnology of Quinoa: Super Grain for Food Security; Springer: Singapore, 2021; pp. 439–466. [Google Scholar]
  8. Jacobsen, S.-E.; Sørensen, M.; Pedersen, S.M.; Weiner, J. Feeding the world: Genetically modified crops versus agricultural biodiversity. Agron. Sustain. Dev. 2013, 33, 651–662. [Google Scholar] [CrossRef]
  9. Thiam, E.; Allaoui, A.; Benlhabib, O. Quinoa Productivity and Stability Evaluation through Varietal and Environmental Interaction. Plants 2021, 10, 714. [Google Scholar] [CrossRef]
  10. Hassani, A.; Azapagic, A.; Shokri, N. Global predictions of primary soil salinization under changing climate in the 21st century. Nat. Commun. 2021, 12, 6663. [Google Scholar] [CrossRef]
  11. Okur, B.; Örçen, N. Chapter 12-Soil salinization and climate change. In Climate Change and Soil Interactions; Prasad, M.N.V., Pietrzykowski, M., Eds.; Elsevier: Amsterdam, The Netherlands, 2020; pp. 331–350. [Google Scholar]
  12. UNCCD. Drought in Numbers 2022-Restoration for Readiness and Resilience; UNCCD: Bonn, Germany, 2022. [Google Scholar]
  13. Seleiman, M.F.; Al-Suhaibani, N.; Ali, N.; Akmal, M.; Alotaibi, M.; Refay, Y.; Dindaroglu, T.; Abdul-Wajid, H.H.; Battaglia, M.L. Drought Stress Impacts on Plants and Different Approaches to Alleviate Its Adverse Effects. Plants 2021, 10, 259. [Google Scholar] [CrossRef]
  14. Zhao, B.; Kao, S.-C.; Zhao, G.; Gangrade, S.; Rastogi, D.; Ashfaq, M.; Gao, H. Evaluating Enhanced Reservoir Evaporation Losses From CMIP6-Based Future Projections in the Contiguous United States. Earth’s Future 2023, 11, e2022EF002961. [Google Scholar] [CrossRef]
  15. El-Nasharty, A.B.; SSEl-Nwehy, S.S.; Rezk, A.E.I.; Ibrahim, O.M. Improving seed and oil yield of sunflower grown in cal-careous soil under saline stress conditions. Asian J. Crop Sci. 2017, 9, 35–39. [Google Scholar] [CrossRef]
  16. Shabbir, R.; Singhal, R.K.; Mishra, U.N.; Chauhan, J.; Javed, T.; Hussain, S.; Kumar, S.; Anuragi, H.; Lal, D.; Chen, P. Combined Abiotic Stresses: Challenges and Potential for Crop Improvement. Agronomy 2022, 12, 2795. [Google Scholar] [CrossRef]
  17. Yang, A.; Akhtar, S.S.; Li, L.; Fu, Q.; Li, Q.; Naeem, M.A.; He, X.; Zhang, Z.; Jacobsen, S.-E. Biochar Mitigates Combined Effects of Drought and Salinity Stress in Quinoa. Agronomy 2020, 10, 912. [Google Scholar] [CrossRef]
  18. Bandurska, H. Drought Stress Responses: Coping Strategy and Resistance. Plants 2022, 11, 922. [Google Scholar] [CrossRef]
  19. Badr, E.A.E.; Ibrahim, O.M.; Tawfik, M.; Bahr, A. Management strategy for improving the productivity of wheat in newly reclaimed sandy soil. Int. J. ChemTech Res. 2015, 8, 1438–1445. [Google Scholar]
  20. El-Okkiah, S.A.F.; El-Afry, M.M.; Shehab Eldeen, S.A.; El-Tahan, A.M.; Ibrahim, O.M.; Negm, M.M.; Alnafissa, M.; El-Saadony, M.T.; Almazrouei, H.M.R.S.; AbuQamar, S.F.; et al. Foliar spray of silica improved water stress tolerance in rice (Oryza sativa L.) cultivars. Front. Plant Sci. 2022, 13, 935090. [Google Scholar] [CrossRef]
  21. Vandegeer, R.K.; Zhao, C.; Cibils-Stewart, X.; Wuhrer, R.; Hall, C.R.; Hartley, S.E.; Tissue, D.T.; Johnson, S.N. Silicon deposition on guard cells increases stomatal sensitivity as mediated by K+ efflux and consequently reduces stomatal conductance. Physiol. Plant. 2021, 171, 358–370. [Google Scholar] [CrossRef]
  22. Wang, M.; Wang, R.; Mur, L.A.J.; Ruan, J.; Shen, Q.; Guo, S. Functions of silicon in plant drought stress responses. Hortic. Res. 2021, 8, 254. [Google Scholar] [CrossRef]
  23. Islam, M.; Sandhi, A. Heavy Metal and Drought Stress in Plants: The Role of Microbes—A Review. Gesunde Pflanz. 2023, 75, 695–708. [Google Scholar] [CrossRef]
  24. Mir, R.A.; Bhat, B.A.; Yousuf, H.; Islam, S.T.; Raza, A.; Rizvi, M.A.; Charagh, S.; Albaqami, M.; Sofi, P.A.; Zargar, S.M. Multidimensional Role of Silicon to Activate Resilient Plant Growth and to Mitigate Abiotic Stress. Front. Plant Sci. 2022, 13, 819658. [Google Scholar] [CrossRef] [PubMed]
  25. Singh, P.; Kumar, V.; Sharma, A. Interaction of silicon with cell wall components in plants: A review. J. Appl. Nat. Sci. 2023, 15, 480–497. [Google Scholar] [CrossRef]
  26. Wang, Y.; Liu, S.; Wang, J.; Chang, S.X.; Luan, J.; Liu, Y.; Lu, H.; Liu, X. Microbe-mediated attenuation of soil respiration in response to soil warming in a temperate oak forest. Sci. Total Environ. 2020, 711, 134563. [Google Scholar] [CrossRef]
  27. Pooja, V.; Sharma, J.; Verma, S.; Sharma, A. Importance of silicon in combating a variety of stresses in plants: A re-view. J. Appl. Nat. Sci. 2022, 14, 607–630. [Google Scholar] [CrossRef]
  28. Lee, S.G.; Lee, H.; Lee, B.C.; Lee, H.; Moon, J.C.; Choi, C.; Chung, N. Effect of sodium silicate on early growth stages of wheat under drought stress. Appl. Biol. Chem. 2020, 63, 48. [Google Scholar] [CrossRef]
  29. Zargar, S.M.; Mahajan, R.; Bhat, J.A.; Nazir, M.; Deshmukh, R. Role of silicon in plant stress tolerance: Opportunities to achieve a sustainable cropping system. 3 Biotech 2019, 9, 73. [Google Scholar] [CrossRef]
  30. Saad, M.A.; Pawle, R.; Selfridge, S.; Contreras, L.; Xavierselvan, M.; Nguyen, C.D.; Mallidi, S.; Hasan, T. Optimizing Axial and Peripheral Substitutions in Si-Centered Naphthalocyanine Dyes for Enhancing Aqueous Solubility and Photoacoustic Signal Intensity. Int. J. Mol. Sci. 2023, 24, 2241. [Google Scholar] [CrossRef]
  31. Duangpan, S.; Tongchu, Y.; Hussain, T.; Eksomtramage, T.; Onthong, J. Beneficial Effects of Silicon Fertilizer on Growth and Physiological Responses in Oil Palm. Agronomy 2022, 12, 413. [Google Scholar] [CrossRef]
  32. Hu, J.; Cai, X.; Jeong, B.R. Silicon Affects Root Development, Tissue Mineral Content, and Expression of Silicon Transporter Genes in Poinsettia (Euphorbia pulcherrima Willd.) Cultivars. Plants 2019, 8, 180. [Google Scholar] [CrossRef]
  33. DalCorso, G.; Farinati, S.; Furini, A. Regulatory networks of cadmium stress in plants. Plant Signal Behav. 2010, 5, 663–667. [Google Scholar] [CrossRef]
  34. Rey, E.; Jarvis, D.E. Structural and functional genomics of Chenopodium quinoa. In The Quinoa Genome; Springer: Cham, Switzerland, 2021; pp. 81–105. [Google Scholar]
  35. Singh, V.; Ali, M.N. Analysis of Differential Gene Expression under Salinity through Differential Display Reverse Transcription Polymerase Chain Reaction (DDRTPCR) Technique: A Review. Electron. J. Biol. 2016, 12, 394–401. [Google Scholar]
  36. Sobhy, S.; Saad-Allah, K.; Kassem, E.; Hafez, E.; Sewelam, N. Seed priming in natural weed extracts represents a promising practice for alleviating lead stress toxicity. Egypt. J. Exp. Biol. 2019, 15, 453. [Google Scholar] [CrossRef]
  37. Rahman, H.; Vikram, P.; Hu, Y.; Asthana, S.; Tanaji, A.; Suryanarayanan, P.; Quadros, C.; Mehta, L.; Shahid, M.; Gkanogiannis, A.; et al. Mining genomic regions associated with agronomic and biochemical traits in quinoa through GWAS. Sci. Rep. 2024, 14, 9205. [Google Scholar] [CrossRef] [PubMed]
  38. Liu, D.; Shi, L.; Han, C.; Yu, J.; Li, D.; Zhang, Y. Validation of Reference Genes for Gene Expression Studies in Virus-Infected Nicotiana benthamiana Using Quantitative Real-Time PCR. PLoS ONE 2012, 7, e46451. [Google Scholar] [CrossRef]
  39. Page, A.; Miller, R.; Keeney, D. Methods of soil analysis, part 2. Chem. Microbiol. Prop. 1982, 2, 643–698. [Google Scholar]
  40. Ryan, J.; Estefan, G.; Rashid, A. Soil and Plant Analysis Laboratory Manual, 2nd ed.; International Center for agricultural Research in the dry Areas (ICARDA), National agricultural Research Center (NARC): Aleppo, Syria, 2001; pp. 46–48. [Google Scholar]
  41. Ibrahim, O.M.; El-Gamal, E.H.; Darwish, K.M.; Kianfar, N. Modeling Main and Interactional Effects of Some Physiochemical Properties of Egyptian Soils on Cation Exchange Capacity Via Artificial Neural Networks. Eurasian Soil Sci. 2022, 55, 1052–1063. [Google Scholar] [CrossRef]
  42. Emran, M.; Ibrahim, O.M.; Wali, A.M.; Darwish, K.M.; Badr Eldin, R.M.; Alomran, M.M.; El-Tahan, A.M. Assessing Soil Quality, Wheat Crop Yield, and Water Productivity under Condition of Deficit Irrigation. Plants 2024, 13, 1462. [Google Scholar] [CrossRef]
  43. Said-Pullicino, D.; Erriquens, F.G.; Gigliotti, G. Changes in the chemical characteristics of water-extractable organic matter during composting and their influence on compost stability and maturity. Bioresour. Technol. 2007, 98, 1822–1831. [Google Scholar] [CrossRef]
  44. Phillips, C.; Nickerson, N. Soil respiration. In Reference Module in Earth Systems and Environmental Sciences; Scott, A.E., Ed.; Elsevier: Amsterdam, The Netherlands, 2015. [Google Scholar] [CrossRef]
  45. Jensen, C.R.; Jacobsen, S.E.; Andersen, M.N.; Núñez, N.; Andersen, S.D.; Rasmussen, L.; Mogensen, V.O. Leaf gas exchange and water relation characteristics of field quinoa (Chenopodium quinoa Willd.) during soil drying. Eur. J. Agron. 2000, 13, 11–25. [Google Scholar] [CrossRef]
  46. Giriappa, S. Water Use Efficiency in Agriculture; Institute for Social and Economic Change: Bangalore, India, 1991; p. 97. [Google Scholar]
  47. Alandia, G.; Rodriguez, J.P.; Jacobsen, S.E.; Bazile, D.; Condori, B. Global expansion of quinoa and challenges for the Andean region. Glob. Food Secur. 2020, 26, 100429. [Google Scholar] [CrossRef]
  48. Cui, H.; Yao, Q.; Xing, B.; Zhou, B.; Shah, S.S.; Qin, P. The Performance of Agronomic and Quality Traits of Quinoa under Different Altitudes in Northwest of China. Agronomy 2024, 14, 1194. [Google Scholar] [CrossRef]
  49. Del Pozo, A.; Ruf, K.; Alfaro, C.; Zurita, A.; Guerra, F.; Sagredo, B. Traits associated with higher productivity and resilience to drought-prone Mediterranean environments of coastal-lowland quinoa (Chenopodium quinoa Willd.). Field Crops Res. 2023, 299, 108985. [Google Scholar] [CrossRef]
  50. Granado-Rodríguez, S.; Aparicio, N.; Matías, J.; Pérez-Romero, L.F.; Maestro, I.; Gracés, I.; Pedroche, J.J.; Haros, C.M.; Fernandez-Garcia, N.; Navarro del Hierro, J.; et al. Studying the Impact of Different Field Environmental Conditions on Seed Quality of Quinoa: The Case of Three Different Years Changing Seed Nutritional Traits in Southern Europe. Front. Plant Sci. 2021, 12, 854. [Google Scholar] [CrossRef] [PubMed]
  51. Zhang, Z. Parametric regression model for survival data: Weibull regression model as an example. Ann. Transl. Med. 2016, 4, 484. [Google Scholar] [CrossRef] [PubMed]
  52. Ashtiani, S.H.M.; Rohani, A.; Aghkhani, M.H. Soft computing-based method for estimation of almond kernel mass from its shell features. Sci. Hortic. 2020, 262, 109071. [Google Scholar] [CrossRef]
  53. Saleha, Y.M. Gene expression and histopathology alterations during rat mammary carcinogenesis induced by 7,12-dimethylbenz(a)anthracene and the protective role of Neem (Azadirachta indica) leaf extract. J. Am. Sci. 2010, 6, 843–859. [Google Scholar]
  54. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  55. StatSoft, Inc. STATISTICA (Data Analysis Software System), Version 10. StatSoft, Inc.: Tulsa, OK, USA, 2011. [Google Scholar]
  56. Bishop, O.N. Statistics for Biology: A Practical Guide for the Experimental Biologist; Microcomputer edition; Longman: London, UK, 1983. [Google Scholar]
  57. R_Core_Team. R: A Language and Environment for Statistical Computing; Foundation for Statistical Computing: Vienna, Austria, 2021. [Google Scholar]
  58. Cochran, W.G.; Snedecor, G.W. Statistical Methods, 7th ed.; Iowa State University Press: Ames, IA, USA, 1980. [Google Scholar]
  59. Redfield, A.C. The Biological Control of Chemical Factors in the Environment. Am. Sci. 1958, 46, 230A, 205–221. [Google Scholar]
  60. Cleveland, C.C.; Liptzin, D. C:N:P stoichiometry in soil: Is there a “Redfield ratio” for the microbial biomass? Biogeochemistry 2007, 85, 235–252. [Google Scholar] [CrossRef]
  61. Tian, T.; Wang, Y.; Wang, H.; Zhu, Z.; Xiao, Z. Visualizing of the cellular uptake and intracellular trafficking of exosomes by live-cell microscopy. J. Cell Biochem. 2010, 111, 488–496. [Google Scholar] [CrossRef]
  62. Jiang, Y.; Guo, X. Stoichiometric patterns of soil carbon, nitrogen, and phosphorus in farmland of the Poyang Lake region in Southern China. J. Soils Sediments 2019, 19, 3476–3488. [Google Scholar] [CrossRef]
  63. Haseeb, M.; Iqbal, S.; Hafeez, M.B.; Saddiq, M.S.; Zahra, N.; Raza, A.; Lbrahim, M.U.; Iqbal, J.; Kamran, M.; Ali, Q.; et al. Phytoremediation of nickel by quinoa: Morphological and physiological response. PLoS ONE 2022, 17, e0262309. [Google Scholar] [CrossRef] [PubMed]
  64. Martínez, E.A.; Veas, E.; Jorquera, C.; San Martín, R.; Jara, P. Re-Introduction of Quínoa into Arid Chile: Cultivation of Two Lowland Races under Extremely Low Irrigation. J. Agron. Crop Sci. 2009, 195, 1–10. [Google Scholar] [CrossRef]
  65. Hinojosa, L.; Matanguihan, J.B.; Murphy, K.M. Effect of high temperature on pollen morphology, plant growth and seed yield in quinoa (Chenopodium quinoa Willd.). J. Agron. Crop Sci. 2019, 205, 33–45. [Google Scholar] [CrossRef]
  66. Brakez, M.; Harrouni, C.; Tachbibi, N.; Daoud, S. Comparative effect of NaCl and seawater on germination of quinoa seed (Chenopodium quinoa willd). Emir. J. Food Agric. 2014, 26, 1091–1096. [Google Scholar] [CrossRef]
  67. Merah, O.; Deléens, E.; Monneveux, P. Grain yield, carbon isotope discrimination, mineral and silicon content in durum wheat under different precipitation regimes. Physiol. Plant. 1999, 107, 387–394. [Google Scholar] [CrossRef]
  68. Alzahrani, Y.; Kuşvuran, A.; Alharby, H.F.; Kuşvuran, S.; Rady, M.M. The defensive role of silicon in wheat against stress conditions induced by drought, salinity or cadmium. Ecotoxicol. Environ. Saf. 2018, 154, 187–196. [Google Scholar] [CrossRef]
  69. Othmani, A.; Ayed, S.; Bezzin, O.; Farooq, M.; Ayed-Slama, O.; Slim-Amara, H.; Ben Younes, M. Effect of Silicon Supply Methods on Durum Wheat (Triticum durum Desf.) Response to Drought Stress. Silicon 2021, 13, 3047–3057. [Google Scholar] [CrossRef]
  70. Sattar, A.; Cheema, M.A.; Sher, A.; Ijaz, M.; Ul-Allah, S.; Nawaz, A.; Abbas, T.; Ali, Q. Physiological and biochemical attributes of bread wheat (Triticum aestivum L.) seedlings are influenced by foliar application of silicon and selenium under water deficit. Acta Physiol. Plant. 2019, 41, 146. [Google Scholar] [CrossRef]
  71. Xu, D.; Gao, T.; Fang, X.; Bu, H.; Li, Q.; Wang, X.; Zhang, R. Silicon addition improves plant productivity and soil nutrient availability without changing the grass:legume ratio response to N fertilization. Sci. Rep. 2020, 10, 10295. [Google Scholar] [CrossRef]
  72. Ruppenthal, V.; Zoz, T.; Steiner, F.; do Carmo Lana, M.; Castagnara, D.D. Silicon does not alleviate the adverse effects of drought stress in soybean plants. Semin. Ciências Agrárias 2016, 37, 3941. [Google Scholar] [CrossRef][Green Version]
  73. Maillard, A.; Ali, N.; Schwarzenberg, A.; Jamois, F.; Yvin, J.-C.; Hosseini, S.A. Silicon transcriptionally regulates sulfur and ABA metabolism and delays leaf senescence in barley under combined sulfur deficiency and osmotic stress. Environ. Exp. Bot. 2018, 155, 394–410. [Google Scholar] [CrossRef]
  74. Thorne, S.J.; Hartley, S.E.; Maathuis, F.J.M. The Effect of Silicon on Osmotic and Drought Stress Tolerance in Wheat Landraces. Plants 2021, 10, 814. [Google Scholar] [CrossRef]
  75. Camargo, M.S.; Baltieri, G.J.; Santos, H.L.; Carnietto MR, A.; dos Reis, A.R.; Pacheco, A.C.; de Almeida Silva, M. Silicon Fertilization Enhances Photosynthetic Activity and Sugar Metabolism in Sugarcane Cultivars under Water Deficit at the Ripening Phase. Silicon 2023, 15, 3021–3033. [Google Scholar] [CrossRef]
  76. Gunes, A.; Pilbeam, D.J.; Inal, A.; Coban, S. Influence of Silicon on Sunflower Cultivars under Drought Stress, I: Growth, Antioxidant Mechanisms, and Lipid Peroxidation. Commun. Soil Sci. Plant Anal. 2008, 39, 1885–1903. [Google Scholar] [CrossRef]
  77. Angeli, V.; Miguel Silva, P.; Crispim Massuela, D.; Khan, M.W.; Hamar, A.; Khajehei, F.; Graeff-Hönninger, S.; Piatti, C. Quinoa (Chenopodium quinoa Willd.): An Overview of the Potentials of the “Golden Grain” and Socio-Economic and Environmental Aspects of Its Cultivation and Marketization. Foods 2020, 9, 216. [Google Scholar] [CrossRef]
  78. Tang, P.; Ren, A.; Jiang, Z.; Wang, R.; Cui, K.; Wu, X.; Sun, M.; Gao, Z.; Anwar, S. Evaluation of Quinoa Varieties for Adaptability and Yield Potential in Low Altitudes and Correlation with Agronomic Traits. Agronomy 2024, 14, 852. [Google Scholar] [CrossRef]
  79. Peršić, V.; Ament, A.; Antunović Dunić, J.; Drezner, G.; Cesar, V. PEG-induced physiological drought for screening winter wheat genotypes sensitivity–integrated biochemical and chlorophyll a fluorescence analysis. Front. Plant Sci. 2022, 13, 987702. [Google Scholar] [CrossRef]
  80. Chen, W.; Yao, X.; Cai, K.; Chen, J. Silicon Alleviates Drought Stress of Rice Plants by Improving Plant Water Status, Photosynthesis and Mineral Nutrient Absorption. Biol. Trace Elem. Res. 2011, 142, 67–76. [Google Scholar] [CrossRef]
  81. Hu, D.; Li, R.; Dong, S.; Zhang, J.; Zhao, B.; Ren, B.; Ren, H.; Yao, H.; Wang, Z.; Liu, P. Maize (Zea mays L.) responses to salt stress in terms of root anatomy, respiration and antioxidative enzyme activity. BMC Plant Biol. 2022, 22, 602. [Google Scholar] [CrossRef]
  82. Sobhy, S.E.; Aseel, D.G.; Abo-Kassem, E.M.; Sewelam, N.A.; Saad-Allah, K.A.; Samy, M.A.; Hafez, E.E. Priming of wheat plant with weed extracts, calcium and salicylic acid for contribution to alleviating the oxidative stress imposed by Fusarium graminearum and lead toxicity. Nov. Res. Microbiol. J. 2023, 7, 1932–1965. [Google Scholar] [CrossRef]
  83. Manna, M.; Thakur, T.; Chirom, O.; Mandlik, R.; Deshmukh, R.; Salvi, P. Transcription factors as key molecular target to strengthen the drought stress tolerance in plants. Physiol. Plant. 2021, 172, 847–868. [Google Scholar] [CrossRef] [PubMed]
  84. Munns, R.; James, R.A.; Läuchli, A. Approaches to increasing the salt tolerance of wheat and other cereals. J. Exp. Bot. 2006, 57, 1025–1043. [Google Scholar] [CrossRef]
  85. Munns, R.; Husain, S.; Rivelli, A.R.; James, R.A.; Condon, A.G.; Lindsay, M.P.; Lagudah, E.S.; Schachtman, D.P.; Hare, R.A. Avenues for increasing salt tolerance of crops, and the role of physiologically based selection traits. Plant Soil 2002, 247, 93–105. [Google Scholar] [CrossRef]
  86. Morran, S.; Eini, O.; Pyvovarenko, T.; Parent, B.; Singh, R.; Ismagul, A.; Eliby, S.; Shirley, N.; Langridge, P.; Lopato, S. Improvement of stress tolerance of wheat and barley by modulation of expression of DREB/CBF factors. Plant Biotechnol. J. 2011, 9, 230–249. [Google Scholar] [CrossRef]
  87. Latini, A.; Sperandei, M.; Cantale, C.; Arcangeli, C.; Ammar, K.; Galeffi, P. Variability and expression profile of the DRF1 gene in four cultivars of durum wheat and one triticale under moderate water stress conditions. Planta 2013, 237, 967–978. [Google Scholar] [CrossRef]
  88. Trono, D.; Pecchioni, N. Candidate Genes Associated with Abiotic Stress Response in Plants as Tools to Engineer Tolerance to Drought, Salinity and Extreme Temperatures in Wheat: An Overview. Plants 2022, 11, 3358. [Google Scholar] [CrossRef]
  89. Hosseinifard, M.; Stefaniak, S.; Ghorbani Javid, M.; Soltani, E.; Wojtyla, Ł.; Garnczarska, M. Contribution of Exogenous Proline to Abiotic Stresses Tolerance in Plants: A Review. Int. J. Mol. Sci. 2022, 23, 5186. [Google Scholar] [CrossRef]
  90. Liang, X.; Luo, G.; Li, W.; Yao, A.; Liu, W.; Xie, L.; Han, M.; Li, X.; Han, D. Overexpression of a Malus baccata CBF transcription factor gene, MbCBF1, Increases cold and salinity tolerance in Arabidopsis thaliana. Plant Physiol. Biochem. 2022, 192, 230–242. [Google Scholar] [CrossRef]
  91. El-Esawi, M.A.; Alayafi, A.A. Overexpression of Rice Rab7 Gene Improves Drought and Heat Tolerance and Increases Grain Yield in Rice (Oryza sativa L.). Genes 2019, 10, 56. [Google Scholar] [CrossRef]
  92. Wu, D.; Qiu, L.; Xu, L.; Ye, L.; Chen, M.; Sun, D.; Chen, Z.; Zhang, H.; Jin, X.; Dai, F.; et al. Genetic variation of HvCBF genes and their association with salinity tolerance in Tibetan annual wild barley. PLoS ONE 2011, 6, e22938. [Google Scholar] [CrossRef][Green Version]
Figure 1. Relation between the first two factor structures obtained by running factor analysis using soil data of irrigation treatments (I1, I2, and I3 in the first three graphs, respectively) and the overall soil data over the observed period (fourth graph).
Figure 1. Relation between the first two factor structures obtained by running factor analysis using soil data of irrigation treatments (I1, I2, and I3 in the first three graphs, respectively) and the overall soil data over the observed period (fourth graph).
Agronomy 14 02088 g001
Figure 2. Seed yield, biological yield, and straw yield of quinoa (kg ha−1) as affected by the interaction between irrigation and silicon. Different lowercase letters indicate significant differences among the treatments based on the interaction between irrigation and silicon. Treatments followed by the same letter are not significantly different from each other at the 0.05 significance level.
Figure 2. Seed yield, biological yield, and straw yield of quinoa (kg ha−1) as affected by the interaction between irrigation and silicon. Different lowercase letters indicate significant differences among the treatments based on the interaction between irrigation and silicon. Treatments followed by the same letter are not significantly different from each other at the 0.05 significance level.
Agronomy 14 02088 g002
Figure 3. The structure of the used artificial neural network using inputs (irrigation and silicon), bias (B1 and B2), hidden layer neurons (H1–H6), and output (seed yield).
Figure 3. The structure of the used artificial neural network using inputs (irrigation and silicon), bias (B1 and B2), hidden layer neurons (H1–H6), and output (seed yield).
Agronomy 14 02088 g003
Figure 4. Relative importance of the studied traits to the yield.
Figure 4. Relative importance of the studied traits to the yield.
Agronomy 14 02088 g004
Figure 5. Gene expression of dd-PCR using different arbitrary RAPD primers (RAPD 1, 2, and 3), where M (DNA marker), 1 (control), 2 (100 silicon), 3 (200 silicon), 4 (800+0 silicon), 5 (800+100 silicon), 6 (800+200 silicon), 7 (1200+0 silicon), 8 (1200+100 silicon), 9 (1200+200 silicon), 10 (1600+0 silicon), 11 (1600+100 silicon), and 12 (1600+200 silicon).
Figure 5. Gene expression of dd-PCR using different arbitrary RAPD primers (RAPD 1, 2, and 3), where M (DNA marker), 1 (control), 2 (100 silicon), 3 (200 silicon), 4 (800+0 silicon), 5 (800+100 silicon), 6 (800+200 silicon), 7 (1200+0 silicon), 8 (1200+100 silicon), 9 (1200+200 silicon), 10 (1600+0 silicon), 11 (1600+100 silicon), and 12 (1600+200 silicon).
Agronomy 14 02088 g005
Figure 6. Cluster dendrogram of treated and untreated quinoa based on molecular data generated from three RAPD primers.
Figure 6. Cluster dendrogram of treated and untreated quinoa based on molecular data generated from three RAPD primers.
Agronomy 14 02088 g006
Figure 7. Effect of irrigation and silicon on the expression level of DRF1 (a) and CBF3 (b) genes in quinoa. Different letters indicate statistically significant differences (p < 0.05).
Figure 7. Effect of irrigation and silicon on the expression level of DRF1 (a) and CBF3 (b) genes in quinoa. Different letters indicate statistically significant differences (p < 0.05).
Agronomy 14 02088 g007
Table 1. Physical and chemical properties of the experimental soil before sowing at a depth of 0–30 cm in the two seasons.
Table 1. Physical and chemical properties of the experimental soil before sowing at a depth of 0–30 cm in the two seasons.
Mechanical PropertiesTexturepH
(1:2.5)
EC
dS m−1
OM
%
Total CaCO3
%
Available Macronutrients, ppm
Clay (%)Sand (%)Silt (%)Sandy clay loam NPK
20.663.116.38.61.080.832.51195.1420
Table 2. General soil chemical characteristics and soil carbon loss.
Table 2. General soil chemical characteristics and soil carbon loss.
TreatmentsSM
(%)
pHEC
(dS m−1)
SOC
(%)
DOC
(mg L−1)
Initial soil conditions12.53 ± 0.318.55 ± 0.012.59 ± 0.111.17 ± 0.2115.25 ± 1.22
1st MonthI120.41 ± 0.31 g8.14 ± 0.10 d2.50 ± 0.10 a1.31 ± 0.12 bc18.41 ± 1.22 e
I222.65 ± 0.43 e8.28 ± 0.12 c1.69 ± 0.12 c1.35 ± 0.13 bc18.00 ± 1.24 f
I323.52 ± 0.32 d8.26 ± 0.14 c2.34 ± 0.13 b1.37 ± 0.18 bc18.56 ± 1.32 e
3rd MonthI121.31 ± 0.51 f8.20 ± 0.13 cd1.05 ± 0.13 f1.67 ± 0.23 a18.61 ± 1.44 e
I223.50 ± 0.34 d8.54 ± 0.21 a0.46 ± 0.11 i1.28 ± 0.14 c21.67 ± 1.02 c
I327.05 ± 0.25 b8.59 ± 0.12 a0.74 ± 0.11 h1.35 ± 0.22 bc20.33 ± 1.32 d
5th MonthI120.64 ± 0.23 g8.20 ± 0.13 cd1.53 ± 0.12 d1.51 ± 0.24 a b22.09 ± 1.23 b
I225.43 ± 0.34 c8.41 ± 0.12 b0.88 ± 0.20 g1.39 ± 0.34 bc22.17 ± 1.47 b
I327.98 ± 0.44 a8.40 ± 0.15 b1.25 ± 0.21 e1.44 ± 0.13 bc23.65 ± 1.24 a
I1: 1st irrigation treatment; I2: 2nd irrigation treatment; I3: 3rd irrigation treatment; SM: soil moisture; EC: electrical conductivity; SOC: soil organic carbon; DOC: dissolved organic carbon Different letters in columns indicate significant data variability at α < 0.05, checked by Tukey’s HSD test. The same letters indicate no significance.
Table 3. General soil chemical characteristics and soil carbon loss.
Table 3. General soil chemical characteristics and soil carbon loss.
TreatmentsTN
(%)
PAV
(%)
Molar
C/P Ratio
Molar
N/P Ratio
CO2 Emission
(g kg−1)
C-CO2
Loss
(g kg−1)
Initial soil conditions0.09 ± 0.010.07 ± 0.0141.72 ± 2.212.60 ± 0.320.02 ± 0.000.01 ± 0.00
1st MonthI10.09 ± 0.01 cd0.12 ± 0.01 a28.75 ± 2.32 f1.66 ± 0.14 e0.11 ± 0.01 d0.030 ± 0.00 d
I20.06 ± 0.02 e0.11 ± 0.01 a30.55 ± 2.53 e1.16 ± 0.21 f0.10 ± 0.01 d0.030 ± 0.00 d
I30.07 ± 0.01 de0.12 ± 0.02 a29.22 ± 1.83 ef1.21 ± 0.20 f0.11 ± 0.01 d0.030 ± 0.00 d
3rd MonthI10.11 ± 0.02 bc0.12 ± 0.01 a36.46 ± 2.35 c1.97 ± 0.22 d0.17 ± 0.01 c0.047 ± 0.00 c
I20.11 ± 0.02 bc0.11 ± 0.01 a30.62 ± 2.37 e2.17 ± 0.21 d0.17 ± 0.01 c0.047 ± 0.00 c
I30.17 ± 0.03 a0.11 ± 0.01 a33.01 ± 1.32 d3.61 ± 0.23 c0.18 ± 0.01 c0.050 ± 0.00 bc
5th MonthI10.18 ± 0.01 a0.08 ± 0.01 b48.80 ± 2.36 a4.85 ± 0.32 a0.24 ± 0.02 a0.060 ± 0.00 a
I20.12 ± 0.02 b0.07 ± 0.01 b48.59 ± 2.34 a3.58 ± 0.35 c0.22 ± 0.01 b0.063 ± 0.00 ab
I30.16 ± 0.03 a0.08 ± 0.01 b46.93 ± 2.55 b4.47 ± 0.31 b0.24 ± 0.01 a0.067 ± 0.00 a
I1: 1st irrigation treatment; I2: 2nd irrigation treatment; I3: 3rd irrigation treatment; TN: total nitrogen; PAV: available phosphorus; CO2: carbon dioxide emitted from soil as soil respiration; C-CO2: carbon loss as the molecular mass of C in carbon dioxide. Different letters in columns indicate significant data variability at α < 0.05, checked by Tukey’s HSD test. The same letters indicate no significance.
Table 4. Primers used in this study.
Table 4. Primers used in this study.
No.Primer NameCategorySequence
5 ⎯⎯⎯⎯⎯⎯⎯⎯ 3
1RAPD 1DD-PCRTGCCGAGCTG
2RAPD 2ATGCCCCTGT
3RAPD 3AGCCACCGAA
4HvDRF1Specific RT-PCRFTGGAGCAGAGGAAAGTACCC
5RCATCTCCCTTGGGGTTTTG
6HvCBF3FCGAACGACGCTGCCATGCTC
7RGGACCCAGACGACGGAGATA
Table 5. Soluble cations and anions and their effective percentage estimated during the experiment.
Table 5. Soluble cations and anions and their effective percentage estimated during the experiment.
TreatmentsNa+K+Ca2+Mg2+HCO3ClSO42−
(mg kg−1)
Initial Soil Conditions8.8 ± 1.850.70 ± 2.324.5 ± 1.210.5 ± 1.9455.9 ± 3.7196.16 ± 2.3379.3 ± 3.0
1st MonthI18.8 ± 1.4 d50.5 ± 2.3 b24.5 ± 1.3 b10.5 ± 1.5 a466.6 ± 6.4 a207.2 ± 2.4 a455.2 ± 3.6 a
I25.3 ± 1.2 g44.0 ± 3.2 c23.3 ± 1.3 c9.1 ± 1.4 b467.2 ± 5.3 a207.6 ± 2.2 a454.2 ± 3.6 a
I37.2 ± 1.3 f53.1 ± 2.3 a26.6 ± 1.4 a11.0 ± 1.4 a406.2 ± 6.1 d168.1 ± 2.7 d281.5 ± 3.7 d
3rd MonthI18.1 ± 1.2 e35.9 ± 2.2 d20.7 ± 1.2 e7.5 ± 1.6 c405.8 ± 6.3 d167.9 ± 2.6 d281.2 ± 2.8 d
I28.1 ± 1.3 e35.9 ± 2.2 d20.7 ± 1.3 e7.6 ± 1.3 c434.9 ± 4.9 c172.9 ± 2.8 c292.5 ± 3.5 c
I310.7 ± 1.3 b c43.2 ± 2.2 c22.3 ± 1.4 d9.0 ± 1.5 b444.9 ± 6.4 b185.7 ± 2.7 b332.2 ± 3.5 b
5th MonthI110.7 ± 1.4 c43.7 ± 2.3 c22.3 ± 1.3 d9.1 ± 1.2 b378.7 ± 5.7 g146.2 ± 2.5 f243.2 ± 3.3 g
I212.9 ± 1.3 a23.8 ± 2.2 e18.3 ± 1.2 g5.0 ± 1.1 d391.6 ± 5.5 f162.7 ± 2.8 e260.6 ± 3.8 f
I310.9 ± 1.2 b35.3 ± 2.1 d19.4 ± 1.4 f7.3 ± 1.3 c400.7 ± 5.9 e172.2 ± 2.9 c274.7 ± 3.9 e
I1: 1st irrigation treatment; I2: 2nd irrigation treatment; I3: 3rd irrigation treatment; Different letters in columns indicate significant data variability at α < 0.05, checked by Tukey’s HSD test; the same letters indicate no significance.
Table 6. Soluble cations and anions and their effective percentage estimated during the experiment.
Table 6. Soluble cations and anions and their effective percentage estimated during the experiment.
TreatmentsCEC Na+ EffectiveK+ EffectiveCa+2 EffectiveMg+2 Effective
(cmol kg−1)%
Initial Soil Conditions4.2 ± 0.118.5 ± 2.331.3 ± 2.829.5 ± 1.120.8 ± 0.6
1st MonthI14.2 ± 0.2 a18.5 ± 2.2 e31.2 ± 2.1 a29.5 ± 1.2 cd20.8 ± 1.3 b
I23.5 ± 0.3 b13.1 ± 1.8 g32.2 ± 2.4 a33.2 ± 2.2 a21.5 ± 1.2 a
I34.2 ± 0.2 a14.8 ± 1.9 f32.2 ± 2.3 a31.5 ± 1.2 b21.5 ± 1.7 a
3rd MonthI13.3 ± 0.3 bc21.5 ± 2.4 d28.1 ± 3.1 b31.7 ± 2.1 b18.7 ± 1.7 c
I23.3 ± 0.3 bc21.5 ± 2.3 d28.1 ± 2.6 b31.7 ± 2.1 b18.8 ± 1.5 c
I33.9 ± 0.4 a23.9 ± 2.6 c28.5 ± 1.9 b28.7 ± 1.2 de19.0 ± 1.5 c
5th MonthI13.9 ± 0.4 a23.7 ± 2.1 c28.6 ± 2.6 b28.5 ± 2.1 e19.1 ± 1.5 c
I23.1 ± 0.5 c36.8 ± 2.1 a20.0 ± 2.5 d29.9 ± 2.2 c13.3 ± 1.7 e
I33.4 ± 0.4 b27.7 ± 2.5 b26.4 ± 2.4 c28.3 ± 1.2 e17.6 ± 1.7 d
I1: 1st irrigation treatment; I2: 2nd irrigation treatment; I3: 3rd irrigation treatment; CEC: cation exchange capacity. Different letters in columns indicate significant data variability at α < 0.05, checked by Tukey’s HSD test; the same letters indicate no significance.
Table 7. Plant height (cm), leaf dry weight/plant (g), stem dry weight/plant (g), plant dry weight (g) and leaf area/plant (cm2), and 100-seed weight (g), of quinoa cv. Chibaya as affected by irrigation and sodium silicate.
Table 7. Plant height (cm), leaf dry weight/plant (g), stem dry weight/plant (g), plant dry weight (g) and leaf area/plant (cm2), and 100-seed weight (g), of quinoa cv. Chibaya as affected by irrigation and sodium silicate.
TRTPlant Height (cm)Leaf DW, g/plantStem DW, g/plantPlant DW,
G
LA,
cm2/plant
100-Seed Weight,
g
Irrigation (I)I151.00 a2.97 ab3.86 b6.84 b273.60 a0.29 a
I253.00 a2.75 b3.93 b6.69 b271.65 a0.32 a
I360.03 a4.22 a6.15 a10.37 a377.09 a0.34 a
Significancens******ns
Effect size η 2 0.350.500.790.740.410.65
η p 2 0.820.700.880.880.610.91
ω 2 0.330.450.770.720.360.64
ω p 2 0.670.490.760.770.380.82
ε 2 0.330.460.780.720.370.64
Silicon (Si), ppmControl55.44 a3.26 a4.43 a7.70 a308.50 a0.31 a
20055.29 a3.06 a4.64 a7.71 a277.49 a0.32 a
40053.29 a3.62 a4.86 a8.49 a336.34 a0.32 a
Significancensnsnsnsnsns
Effect size η 2 0.020.060.020.040.100.01
η p 2 0.230.230.160.260.270.18
ω 2 0.010.030.000.020.050.00
ω p 2 0.060.050.010.080.080.02
ε 2 0.010.030.000.020.060.00
Interactionnsnsnsnsnsns
Effect size η 2 0.010.090.030.050.100.02
η p 2 0.150.290.220.330.270.21
ω 2 0.000.010.000.020.010.00
ω p 2 0.000.030.000.070.010.00
ε 2 0.000.010.000.020.010.00
I1 = 1000 m3/hectare, I2 = 2000 m3/hectare, I3 = 4000 m3/hectare. Means followed by the same letter are not significant at 0.05. *: significant difference at 0.05 level of probability; NS: no significant difference at the 0.05 level of probability. * and ** indicate p < 0.05, p < 0.01 and ns not significant, respectively.
Table 8. Biological yield (kg ha−1), straw yield (kg ha−1), seed yield (kg ha−1), harvest index, seed nitrogen (%), seed phosphorus (ppm), and seed potassium (ppm) of quinoa cv. Chibaya as affected by irrigation and sodium silicate.
Table 8. Biological yield (kg ha−1), straw yield (kg ha−1), seed yield (kg ha−1), harvest index, seed nitrogen (%), seed phosphorus (ppm), and seed potassium (ppm) of quinoa cv. Chibaya as affected by irrigation and sodium silicate.
TRTBiological Yield,
kg ha−1
Straw Yield, kg ha−1Seed Yield, kg ha−1HISeed N,
%
Seed P,
ppm
Seed K,
ppm
Irrigation (I)I11456.64 c584.84 c871.79 b0.59 a1.93 b125.9 b205.02 a
I21688.66 b797.49 b891.16 b0.52 a2.18 a141.7 a195.57 a
I32421.46 a1047.38 a1374.07 a0.57 a2.05 ab140.6 a168.52 a
Significance********ns***ns
Effect size η 2 0.850.890.770.520.220.150.34
η p 2 0.980.980.960.790.350.290.68
ω 2 0.840.890.760.490.150.090.31
ω p 2 0.950.950.920.620.140.100.47
ε 2 0.840.890.770.500.150.090.32
Silicon (Si), ppmControl1712.05 b774.89 b937.16 b0.54 b2.03 a129.67 a186.66 a
2001871.14 a809.24 ab1061.89 a0.57 ab1.94 a145.45 a194.43 a
4001983.56 a845.59 a1137.97 a0.57 a2.19 a133.18 a188.04 a
Significance********nsnsns
Effect size η 2 0.060.020.100.100.220.140.02
η p 2 0.760.480.760.420.350.270.09
ω 2 0.060.020.090.080.150.070.00
ω p 2 0.570.250.570.200.140.080.00
ε 2 0.060.020.090.080.150.080.00
Interaction******nsnsns*
Effect size η 2 0.060.050.060.040.030.270.21
η p 2 0.740.700.650.210.070.420.57
ω 2 0.050.040.050.000.000.140.15
ω p 2 0.530.470.400.000.000.150.31
ε 2 0.050.040.050.000.000.140.16
I1 = 1000 m3/hectare, I2 = 2000 m3/hectare, I3 = 4000 m3/hectare. Means followed by the same letter are not significant at 0.05. *, ** and *** indicate p < 0.05, p < 0.01, p < 0.001 and ns not significant, respectively.
Table 9. Relative importance of irrigation and silicon using modified generalized method.
Table 9. Relative importance of irrigation and silicon using modified generalized method.
IrrigationSiliconIrrigation×SiliconTotal Main EffectsTotal Interaction Effects
Relative Importance (sum to R2 0.981)0.550.310.120.860.12
Relative Importance (sum to 1)0.560.320.120.880.12
Variance of MGW1.580.230.301.810.30
Sum of MGW71.5240.84−15.39112.36−15.39
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

El-Tahan, A.M.; Emran, M.; Safhi, F.A.; Wali, A.M.; Sobhy, S.E.; Ibrahim, O.M. Modeling the Effects of Irrigation and Its Interaction with Silicon on Quinoa Seed Yield and Water Use Efficiency in Arid Regions. Agronomy 2024, 14, 2088. https://doi.org/10.3390/agronomy14092088

AMA Style

El-Tahan AM, Emran M, Safhi FA, Wali AM, Sobhy SE, Ibrahim OM. Modeling the Effects of Irrigation and Its Interaction with Silicon on Quinoa Seed Yield and Water Use Efficiency in Arid Regions. Agronomy. 2024; 14(9):2088. https://doi.org/10.3390/agronomy14092088

Chicago/Turabian Style

El-Tahan, Amira M., Mohamed Emran, Fatmah A. Safhi, Asal M. Wali, Sherien E. Sobhy, and Omar M. Ibrahim. 2024. "Modeling the Effects of Irrigation and Its Interaction with Silicon on Quinoa Seed Yield and Water Use Efficiency in Arid Regions" Agronomy 14, no. 9: 2088. https://doi.org/10.3390/agronomy14092088

APA Style

El-Tahan, A. M., Emran, M., Safhi, F. A., Wali, A. M., Sobhy, S. E., & Ibrahim, O. M. (2024). Modeling the Effects of Irrigation and Its Interaction with Silicon on Quinoa Seed Yield and Water Use Efficiency in Arid Regions. Agronomy, 14(9), 2088. https://doi.org/10.3390/agronomy14092088

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop