Next Article in Journal
Soil Microbial Biomass and Bacterial Diversity Enhanced through Fallow Cover Cropping in Rice–Fish Coculture
Next Article in Special Issue
In-Depth Characterization of Crown Gall Disease of Tobacco in Serbia
Previous Article in Journal
Onion Peel as a Potential Source of Antioxidants and Antimicrobial Agents
Previous Article in Special Issue
Isolation, Characterization and Phylogenetic Analysis of Stagonospora tainanensis, the Pathogen Causing Sugarcane Leaf Blight in China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 14
Issue 3
10.3390/agronomy14030454
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Diversity and Evolution of the Avirulence Gene AvrPi54 in Yunnan Rice Fields

by
Jinbin Li
1,2,†,
Chengxing He
1,†,
Chao Dong
3,4,5,6,7,
Lin Lu
8,
Chi He
1,2,
Yunqing Bi
1,
Zhufeng Shi
1,
Huacai Fan
1,2,
Junyi Shi
1,
Kaibo Wang
9,
Zhen Zeng
1,
Hengming Luo
1 and
Qun Wang
1,2,*
1
Agricultural Environment and Resource Research Institute, Yunnan Academy of Agricultural Sciences, Kunming 650205, China
2
Key Laboratory of Green Prevention and Control of Agricultural Transboundary Pests of Yunnan Province, Kunming 650205, China
3
Biotechnology and Germplasm Resources Institute, Yunnan Academy of Agricultural Sciences (YAAS), Kunming 650205, China
4
Yunnan Seed Laboratory, Kunming 650205, China
5
Yunnan Provincial Key Lab of Agricultural Biotechnology, Kunming 650205, China
6
Key Laboratory of Southwestern Crop Gene Resources and Germplasm Innovation, Ministry of Agriculture, Kunming 650205, China
7
Scientific Observation Station for Rice Germplasm Resources of Yunnan, Ministry of Agriculture and Rural Affairs, Kunming 650205, China
8
Flower Research Institute, Yunnan Academy of Agricultural Sciences, Kunming 650205, China
9
Institute of Tea Science, Yunnan Academy of Agricultural Sciences, Kunming 650205, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2024, 14(3), 454; https://doi.org/10.3390/agronomy14030454
Submission received: 28 January 2024 / Revised: 18 February 2024 / Accepted: 19 February 2024 / Published: 25 February 2024
(This article belongs to the Special Issue Diseases of Herbaceous Plants)
Browse Figures
Versions Notes

Abstract

:
Variance or complete loss of the avirulence gene (Avr) enables the pathogen to escape resistance protein (R) recognition. The field resistance effectiveness of the R gene is determined by its corresponding Avr gene in field isolates. To effectively deploy the rice blast R gene Pi54, the distribution, variation and evolution of the corresponding Avr gene, AvrPi54, were determined through PCR amplification, pathogenicity assay, gene sequences and evolutionary analysis. Among 451 Pyricularia isolates from rice and non-rice hosts, including Oryza rufipogon, Digitaria sanguinalis, Eleusine coracana, E. indica and Musa sp. in Yunnan province, the PCR amplification result showed that AvrPi54 alleles existed among 218 (48.3%) isolates including rice isolates, O. rufipogon isolates and E. coracana isolates. Pathogenicity assay showed that 336 (74.5%) isolates were avirulent to Tetep (holding Pi54). Five AvrPi54 haplotypes were identified among 142 isolates through the gene sequence. These haplotypes were determined to be avirulent to Pi54 through pathogenicity assay. Four novel haplotypes (H2 to H5) of the AvrPi54 gene would provide new target sites for rice blast control. Haplotype diversity analysis indicated that there existed a lower genetic diversity of AvrPi54 for P. oryzae populations (five haplotypes, Hd = 0.127, π = 2.9 × 10−4) in this study. Neutrality tests showed that AvrPi54’s genetic variation was affected by purified selection. Haplotype network and phylogeny analysis showed that H1 was an ancestral haplotype and was widely distributed in rice isolates and O. rufipogon isolates, while H5 diverged early and evolved independently. These results indicate that the gene evolves slowly and stably and is a comparatively conserved Avr gene.

1. Introduction

Rice is a staple cereal crop for more than one-third of people all over the world [1]. Nevertheless, rice production and global food security are threatened by catastrophic diseases engendered by pathogens and pests. Pyricularia oryzae (Syn. Magnaporthe oryzae), a filamentous ascomycete fungus, can cause rice blast disease and infect the leaves, nodes, collars, panicles and roots of rice at all growth periods [2]. More than 50 species of poaceous plants, including important crops such as rice, wheat, barley, millet, oat and other species of the Poaceae, can be infected by the fungus [3,4,5,6,7]. The yield loss caused by rice blast disease is sufficient to nourish more than 60 million people each year [8,9]. The application of rice resources containing the major resistance gene (R) is the most economic, effective and ecological method to manage rice blasts. The avirulence gene (Avr) may encode pathogen molecules that are directly or indirectly perceived by the corresponding R gene product [10], and then host resistance responses are triggered by pathogen recognition and infection is stopped. Race-specific R genes of plants have evolved to detect the products of the corresponding Avr genes and trigger effective resistance to plant pathogens [11].
Currently, there are two principal hypotheses for the co-evolution of R and Avr genes in plants: “arms race” and “trench warfare”. In an arms race, both R and Avr genes are under-diversified selections or positive selections, whereas in trench warfare, either R or Avr is an under-balanced selection or a purified selection, and the other is an under-diversified selection or a positive selection [11,12,13]. Based on diversity analysis, phylogeny and neutrality test of Avr/R pairs, an arms race or trench warfare could be derived between the gene pair interaction during the co-evolutionary process. It is valuable for the better application of the resistance gene. The most prominent example of an arms race in plant and pathogen interactions is the case study of flax and flax rust interactions. The L locus, harboring 12 allelic variants with extensive sequence diversity in flax, is responsible for the resistance to flax rust caused by Melampsora. lini [14]. AvrL567 in M. lini is recognized by the L5, L6 and L7 alleles of the flax L gene. There are also 12 allelic variants in six isolates and a high diversity level in the non-synonymous DNA sequence polymorphisms in AvrL567 [15]. Physical interactions were observed in yeast two-hybrid analysis between the L protein and AvrL567 protein. Interaction specificity was also observed in planta [16]. AvrL567 interacts with L driven by arms race dynamics [16,17,18]. Another case of Avr gene and R gene interaction by an arms race is AvrPik of P. oryzae and the Pik locus of rice. There are high diversity levels in AVR-Pik and the cognate Pik with multiple alleles in which DNA replacements cause amino acid changes. AVR-Pik alleles are specially recognized by the various Pik alleles in a yeast two-hybrid assay and in an in planta co-immunoprecipitation assay. Thus, direct physical interactions between AVR-Pik and Pik are driven by arms races [18]. Some cases have indicated that the interaction between plants and the pathogen is driven by trench warfare. Under long-term balancing selection, the interaction between the protein RPM1 of Arabidopsis and two unrelated effector proteins of Pseudomonas syringae (AvrRpm1 and AvrB) was suggested to be caused by the trench warfare [19]. In trench warfare, the pathogen alternates with the host based on host resistance frequency, causing the pair-interaction organisms to advance and retreat. Co-evolution between Avr-Pita and Pita was suggested to be driven by trench warfare because of the diversified haplotypes and positive selection for Avr-Pita and the single haplotype and balanced selection for Pita [11,12]. The trench warfare interaction between Avr-Pita and Pita was also testified based on nucleotide diversity, neutrality statistics and phylogenetic analyses [13]. Disease epidemics take turns with periods of high host resistance, resulting in endless advances and retreats for the host and pathogen in the trench warfare model. Temporal variation in host and pathogen interactions comes up because disease spread is more likely when the frequency of resistance is low [19]. This frequency-dependent selection can result in the periodic recurrence of severe epidemics, causing the frequency of resistance to cycle. Transient benefits may be brought by arms races; durable resistance might be generated by a non-arms race in some molecular evolutionary examples [20].
The rice blast model is a classical gene-for-gene model [21] in which Avr genes in the pathogen have a functional relationship with specific R genes in rice [22,23]. Currently, there are more than 100 mapped blast R genes in rice and 26 mapped Avr genes in P. oryzae. Among the mapped R and Avr genes, 38 and 14 genes have been cloned, respectively [24]. Most cloned R genes encode NLR proteins, except for Pid2, pi21, and Ptr. While Avr genes in P. oryzae mostly encode small secreted proteins without distinct sequence homology. The cloned Avr genes play a critical role in revealing its variance and the interaction with corresponding R genes in the Rice–Pyricularia pathosystem [25]. Among cloned R genes, nine corresponding Avr genes have also been cloned. These R/Avr pairs include Pi-ta/AVR-Pita, Piz-t/AvrPiz-t, Pik/AVR-Pik, Pia/AVR-Pia, Pi-CO39/AVR1-CO39, Pi54/Avr-Pi54, Pii/AVR-Pii, Pi9/AvrPi9, and Pib/AvrPib. Based on the interaction advances of seven R/Avr pairs, five of them interact directly, namely Pi-ta/AVR-Pita, Pik/AVR-Pik, Pia/AVR-Pia, Pi-CO39/AVR1-CO39, and Pi54/AvrPi54, whereas Piz-t/AvrPiz-t and Pii/AVR-Pii interact indirectly [24,25]. Except for the one-to-one interactions, another two interaction types were also found. One is two-to-one interactions, such as when Pik-1 and Pik-2 interact with AVR-Pik [26], the recently cloned two Avr proteins (MoHTR1 and MoHTR2) with the same target protein [27]. Another type is the interaction between two different Avr proteins and a single R protein complex, such as AVR1-CO39 or AVR-Pia, which could discern the heterodimer produced by RGA4 and RGA5.
Among the cloned Avr genes of P. oryzae, AvrPi54 is the first one that has been used to apply genome-wide in silico analysis, protein modeling, and in silico docking to clone the candidate gene [28]. It was cloned from the avirulent isolate RML-29 (Mo-nwi-55) and is located at chromosome 4. A single exon of 462 bps encodes the AvrPi54 protein with 153 amino acids, and it is predicted to be a secreted protein with a 19-amino-acid signal peptide (SP) at the N-terminal region. There exist six β-sheets and no α-helices in the mature SP truncated protein. A low genetic diversity (three haplotypes, π = 0.00048, Hd = 0.088) at the AvrPi54 locus of 45 isolates was found in India [13]. It activates immunity to rice mediated by the Pi54 gene. Pi54, which was formerly named Pikh, a counterpart resistance gene of AvrPi54, is a durable and broad-spectrum resistance gene [29,30]. It is cloned from an indica rice variety, Tetep. A functional complementation assay showed that Pi54 conferred resistance to diversified P. oryzae isolates [30,31,32]. The transgenic TP309 lines with Pi54 were verified to stimulate the rice defense system including the activation of defense response genes and transcription factors, resulting in hypersensitive response and disease resistance [33]. The sub-cellular localization of Pi54 with Green Fluorescent Protein (GFP) showed that the GFP signal was found in some leaf tissue structures, such as the stomata, upper epidermal and mesophyll cells, vascular bundle, and walls of bundle sheath and bulliform cells [34]. The results were further verified by immunocytochemical studies. Pi54rh and Pi54of, which belong to two orthology genes of Pi54, have also been cloned and functionally validated from wild rice O. rhzomatis and O. officinalis [35,36].
Because of its durable and broad-spectrum resistance to P. oryzae [30], the variance of Pi54 has been widely studied. The abundant sequence variation in the Pi54 gene is found to be responsible for its broad spectrum resistance among different rice landraces and wild relatives [37,38,39,40,41]. Allele mining of Pi54 among eight wild rice species and six cultivated rice lines revealed its structural variation and impact on the phenotypes [37]. In total, 50 new haplotypes of the Pi54 gene were identified among 92 rice lines, and the sequence variation in two consensus regions (163 and 144 bps) was used to design the specific DNA markers of the allele [38]. The allelic diversity of the Pi54 gene among 885 Indian rice genotypes was explored. Nine new alleles were identified based on the DNA sequences [39]. Sixteen Pi54 alleles were sequenced from landraces and wild Oryza species which have genomes ranging from AA to EE [40]. Among the 16 Pi54 alleles, Pi54ab and Pi54btj have potential application value in a breeding program of rice blast resistance and identified SNPs and Indel can be used to develop allele-specific DNA markers. Two divergent structures of the Pi54 gene and its locus in two O. sativa ssp. japonica cultivars Nipponbare and Sasanishiki were reported [41]. And the Pi54 gene was also widely applied to rice breeding and production for blast control. The gene was introduced into the rice cultivar ‘Improved Pusa Basmati 1′ [42], an Indian rice cultivar MRU1010 [43], four sterile lines for improving blast resistance [44], an India popular susceptible variety ‘Tellahamsa’ [45], and two elite restorer lines (CB 174 R and CB 87 R) in India [46]. A relatively higher distribution frequency (>15%) of the Pi54 gene was detected among 277 parental lines in China [47]. In total, 26 out of 48 rice varieties in the Huang-huai japonica rice region of China were detected to hold the Pi54 gene through the molecular marker [48]. In total, 41 of 80 key parent resources of rice were identified to hold the Pi54 gene [49].
Variance or complete loss of the Avr genes enables the pathogen to escape R protein recognition for its growth and reproduction [50,51]. So, field efficacy of the R gene is determined by its corresponding Avr gene of field isolates. Further study of the Avr gene of the pathogen isolates in the natural field may provide beneficial knowledge on how to apply the R gene to control rice blast disease in field crops [52]. Yunnan province of South China is famous on a mountainous region with an extremely diverse topography and climate, and is extremely rich in species and vegetation types, and the landscape varies [53]. Due to its abundant biodiversity, Yunnan is listed as one of the top conservation priorities in the world [54]. Using a large panel of accessions containing 446 O. rufipogon accessions and 1083 O. sativa varieties, the domestication sweeps and GWAS analyses indicated that O. sativa japonica rice was first domesticated from a specific O. rufipogon population around the middle area of the Pearl River in southern China [55]. And that O. sativa indica rice was subsequently derived from hybrids between japonica rice and local wild rice when the initial japonica rice cultivars spread into South East and South Asia [55]. And Yunnan is one of three genetic diversity centers of cultivated rice in China [56]. South China (Yunnan)–Laos–North Thailand region was revealed as the diversity center and the putative origin center of P. oryzae populations [57]. It is of great scientific value to study the variation and evolution of Avr genes in Yunnan, the diversity center of rice and P. oryzae. Compared to Pi54, little is known about the variance, distribution and evolution of its corresponding gene AvrPi54. In order to make better use of the Pi54 gene, here, we report the molecular mechanisms of diversification, evolution and selection pressure of AvrPi54 among the field isolates in Yunnan province, China. The study would provide useful information on resistance breeding and varieties layout for rice blast control.

2. Materials and Methods

2.1. Fungal Isolates, Rice Cultivars, Culture, and Pathogenicity Assay

Blast isolates were collected from rice and non-rice host in rice-growing regions of Yunnan Province, China. A paper bag was used to seal five samples from each block. In the previous study, it was described how to store isolates, produce spores, culture rice seedlings, and conduct pathogenicity assay [58]. Each sample was moistly incubated on a sterile filter paper in a 9 cm Petri dish at 25 °C for 24 h. Through the tip of a glass pin, single spores were isolated under a stereomicroscope and cultured in PDA medium (potato at 200 g/L, dextrose at 20 g/L, and agar at 15 g/L). Single-spored isolates were grown on filter papers in OMA medium (oatmeal at 40 g/L, dextrose at 20 g/L, and agar at 15 g/L) for long-term storage at −20 °C. The isolate was cultured in OMA medium (20 g/L oatmeal, 15 g/L agar, 10 g/L sucrose) for 7 days in a dark incubator at 25 °C, and then aerial mycelia were gently washed off with a paintbrush and distilled water. Then, the colonies were light up at 25 °C for 3 days under fluorescent light to produce sporulation. Conidia suspension was gained by softly brushing and flooding the medium surface with distilled water containing 0.01% Tween 20 detergent. The concentration of the suspension was checked to 4 × 104 conidia/mL for inoculation. In this study, 424 rice blast isolates were obtained from 14 prefectures of 7 regions in Yunnan province (Table 1). The seven regions included Central (Kunming, KM; Yuxi, YX; Chuxiong, CX and Qujing, QJ), West (Dali, DL; Baoshan, BS and Dehong, DH), Northwest (Lijiang, LJ), Northeast (Zhaotong, ZT), South (Honghe, HH and Xishuangbanna, BN), Southwest (Lincang, LC and Puer, PE) and Southeast (Wenshan, WS). According to the production area, these isolates of rice group were divided into a GJ group from Geng/Japonica rice area or XI group from Xian/Indica rice area. In order to understand the pathogenicity and distribution of the AvrPi54 gene among isolates from other hosts, 27 isolates from non-rice host were included in this study. Isolates of the non-rice group were, respectively, collected from O. rufipogon (18 isolates), Digitaria sanguinalis (1 isolates), Eleusine coracana (1 isolate), E. indica (1 isolate), and Musa sp. (6 isolates) in Yunnan province. Methods of non-rice isolate storage, spore production, the pathogenicity assay were same as above.
Rice resistance cultivar Tetep containing Pi54 (friendly shared by Professor Yang Sihai in Nanjing University) and susceptible control variety LTH without Pi54 were used for pathogenicity assay. Ten rice seedlings per cultivar were planted in a plastic tray for spray inoculation. At leaf stage 3.5, 20 mL conidial suspension was sprayed and inoculated for rice seedlings. The inoculated rice plants were placed for 24 h in a controlled dark incubator at 25 °C with 95% relative humidity. Finally, these plants moved back to the greenhouse. Seven days after inoculation, the disease reactions were evaluated using a modified standard pathogenicity assay [59]. Based on the visual number and size of lesions, the disease reactions were determined at the second youngest leaf using a 5-scale rating system (0–2: resistance; 3–5: susceptible). Each experiment was repeated threefold. The pathogenicity of an isolate was evaluated by comparing the disease reaction to the resistant and susceptible varieties.

2.2. DNA Preparation, PCR Amplification, and DNA Sequencing

Fungal mycelia were quietly grown in a complete liquid medium (LB; NaCl at 10 g/L, yeast extract at 5 g/L, and tryptone at 10 g/L.) for 6 to 8 days at 25 °C under dark conditions. DNA was extracted from mycelia using the CTAB method [60]. Forward primer AvrPi54-F (5′-GGTGATAGGCTGACCAACACAAC-3′) and reverse primer AvrPi54-R (5′-GCATGGCGTGGCATGTATAGC-3′) were designed in this study according to sequences of gene accession number HF545677 (isolate Mo-nwi-55 AvrPi54 gene) and CP050923 (Pyricularia oryzae strain LpKY97 chromosome 4) and specifically applied to amplify complete gene including non-CDS and CDS. PCR reaction consisted of the following components: 1 µL of fungal genomic DNA, 0.5 µL of each 10 µM primer, 12.5 µL of 2 × Pfu PCR Master Mix (Tiangen Biotech Co. LTD, Beijing, China), and 10.5 µL sterile water. PCR program was performed in a BIO-RAD Thermal Cycler (C1000, Bio-Rad Laboratories, Life Science Research, Hercules, CA, USA) with 1 cycle at 95 °C for 3 min for initial denaturation, followed by 35 cycles at 95 °C for 30 s, 65 °C for 45 s, 72 °C for 45 s, and a final extension of 72 °C for 7 min. All PCR reactions were amplified thrice. The size of the amplified fragment was estimated by DL2000 DNA Ladder (Tiangen Biotech Co. LTD, Beijing, China). AvrPi54-F, AvrPi54midF (5′-CATCGTCGGCACCGTCAC-3′), AvrPi54midF2 (5′-GATCCTCACCTATGGCTG-3′) and AvrPi54midR (5′-ACATTAGCCATTGCGTGC-3′) were used as sequencing primers. PCR products were sequenced three times by Shanghai Life Technologies Biotechnology Co., Ltd. (Shanghai, China).
The criteria for selecting sequencing isolates were as follows: (1) randomly selected isolates may cover the sampled region as far as possible in order to know the genetic variation of the gene as a whole; (2) it was ensured that no less than 3 isolates were sequenced in every sampled prefecture; (3) if isolates with the AvrPi54 gene were very few in a prefecture, all would be sequenced.

2.3. Data Analysis

Sequences were assembled with Seqman software in lasergen7.0 [61]. Assembled sequences were aligned with ClustalW 1.81 [62]. The number of DNA haplotypes and polymorphic sites and the amount of nucleotide diversity (π) and haplotype diversity (Hd) [63,64] were calculated with the program DnaSP 5.10.01 [65]. Haplotype was determined by variable sites. Neutrality tests of Tajima’s D [66] were also conducted using this program. The haplotype distribution map was constructed using ArcGIS 10.2 (Redlands, CA, USA), in which prefecture coordinates were the same as in our previous study represented by the capital coordinates of the prefecture [67]. Haplotype network analysis was performed using TCS 1.21 [68]. A phylogenetic tree was constructed using the Neighbor-Joining method in Mega 7.0 software [69]. The evolutionary distances were computed using the Maximum Composite Likelihood method. The bootstrap test (1000 replicates) was performed to obtain confidence estimates.

3. Results

3.1. The Distribution and Pathogenicity Assay of Avirulence Gene AvrPi54 in Yunnan Province

By AvrPi54-specific amplification, 218 (48.3%) out of 451 isolates were found to hold the AvrPi54 alleles (Table 1). Among the 27 non-rice isolates, 7 Ofound rufipogon isolates and 1 E. coracana isolate were found to hold the AvrPi54 alleles. Musa isolates, D. sanguinalis isolates, and E.indica isolates were found not to hold the AvrPi54 alleles. Among the 424 rice isolates, 210 (49.5%) were detected to hold AvrPi54 alleles. The detection frequency of AvrPi54 was, respectively, 66.1, 54.3, 48.7, 42.3, 40.4, 37.5, and 28.1% in central, southeast, west, northwest, northeast, southwest and south. The frequency of AvrPi54 was varied from 23.5 to 80% among the fourteen prefectures, and, respectively, 50.7 and 47.3% in GJ and XI regions.
According to the pathogenicity assay, 336 (74.5%) out of the 451 tested isolates were avirulent to Tetep (containing Pi54), while the 115 isolates (25.5%) were virulent (Table 1). All the non-rice isolates were avirulent to Tetep. Among the rice isolates, the frequency of avirulence isolates to Pi54 was, respectively, 86.5, 80.6, 77.1, 75.0, 70.7, 59.5, and 57.7% in northeast, central, southwest, southeast, west, south, northwest. The frequency of avirulence isolates was varied from 57.1 to 89.3% among the fourteen prefectures, and, respectively, 72.5 and 74.3% in the GJ and XI regions.

3.2. Variance, Distribution of AvrPi54 Haplotypes

Amplification products of 142 isolates, including 136 rice isolates and six non-rice isolates, were sequenced. Published AvrPi54 gene sequence HF545677 acted as reference sequence which is 1258 bp in length. After assembled and aligned analysis, 13 variable sites were detected (Table 2), of which 11 sites were located in non-coding regions (non-CDS) and 2 sites were located in the coding region (CDS). These variable sites included one indel, nine transitions and three transversions. In total, five haplotypes (H1 to H5) based on 142 AvrPi54 sequences were identified (Genbank accession No. OR545387-545391). Compared to 93 published AvrPi54 gene sequences from GenBank, four novel haplotypes were identified, including H2, H3, H4 and H5.
Amino acid sequences were translated according to the AvrPi54 coding region of five haplotypes. CCN97897 as the referring protein, variable sites and three AvrPi54 protein types (P1 to P3) were gained (Table 3). P1, the same as CCN97897, was encoded and shared by H1, H2 and H3. P2 and P3 were encoded by H4 and H5, respectively. Compared to CCN97897, the 137th amino acid Valine was changed into Isoleucine in P2, and the 5th amino acid Alanine was changed into Threonine in P3. Compared to 93 published CDS sequences of AvrPi54 in GenBank, P2 was a novel encoded protein type. The five haplotype isolates were pathogenic to LTH, but not to Tetep (Figure 1). The result indicated that these haplotypes in Yunnan province still hold avirulance function.
H1 was identical to HF545677 and widely distributed in 14 prefectures in Yunnnan province including 127 rice isolates and 5 O. rufipogon isolates (Table 4, Figure 2). H2 was distributed in LJ and YX prefectures including five rice isolates. H3 was only distributed in the BN prefecture including one rice isolate. H4 was only distributed in the PE prefecture including one rice isolate. H5, including three isolates, was only distributed in the BS prefecture and E. coracana isolates. And H1 was a shared haplotype in the GJ and XI regions, H2 and H5 only in the GJ region, H3 and H4 only in the XI region.

3.3. AvrPi54 Haplotypes Diversity and Network

AvrPi54 genetic diversity of Pyricularia isolates in Yunnan province was estimated in the program DnaSP 5.10.01 (Table 4). Due to the limited number of non-rice isolates, their diversity analysis was not completed. The AvrPi54 gene diversity was low in Yunnan province (five haplotypes, Hd = 0.127, π = 2.9 × 10−4). The diversity of the GJ region (three haplotypes, Hd = 0.156, π = 4.3 × 10−4) was higher than that of the XI region (three haplotypes, Hd = 0.078, π = 0.6 × 10−4). There were only five regions with AvrPi54 haplotype diversity in Yunnan rice regions, with the exception of the northeast and southeast. The value of Hd was ranked from high to low in the northwest, south, southwest, central and west of Yunnan. The value of π was arranged from high to low in the west, northwest, south, southwest, and central of Yunnan. These results indicated that there existed lower genetic diversity for AvrPi54 in Yunnan P. oryzae populations.
Using DnaSP 5.10.01 software, neutrality tests were performed to determine if the genetic variation of AvrPi54 was affected by natural selection. A negative and significant value (Tajiama’s D = −2.1254 *, p < 0.05) was detected in the neutrality test (Table 5). The test suggested that AvrPi54 genetic variation was mainly affected by purified selection and did not follow the neutral theory. Maybe the gene experienced the events of population expansion after the bottleneck effect.
To understand the evolutionary relationship of AvrPi54 haplotypes in P. oryzae, the network of the haplotypes was constructed (Figure 3). Five haplotypes were divided into two clades. One clade consisted of haplotypes H1, H2, H3, and H4. Another clade only had one haplotype H5. H1, with a high frequency, was the ancestral haplotype, from which H2, H3 and H4 were directly derived. Ten sites including nine substitutions and one indel varied between H1 and H5. The network also indicated that H1 and H5 separated earlier.

3.4. Phylogenetic Analysis of AvrPi54

Based on the AvrPi54 gene sequences of 142 P. oryzae isolates, the evolutionary history was inferred using the Neighbor-Joining method in Mega 7.0 software. NJ tree was constructed under 1000 bootstrap replications (Figure 4). Isolates marked in a red circle belonged to haplotype H1 and gathered in a clade. Isolates marked in a yellow circle (belonging to H3) and marked purple circle (belonging to H4) were mixed in the clade. Isolates marked in a green circle were clustered into a clade belonging to haplotype H2. And isolates marked in a blue circle were formed into another clade belonging to haplotype H5. According to the NJ tree, H1 was more closely related to H2, H3 and H4 than to H5. The results were consistent with the haplotype network.

4. Discussion

Understanding the distribution and pathogenicity of the Avr gene is useful for the efficient application of the corresponding R gene. In this study, the distribution of AvrPi54 was identified through specific primer amplification. The results indicated that 48.3% of isolates of Yunnan province hold the AvrPi54 alleles. Except for rice isolates, non-rice isolates including O. rufipogon and E. coracana also hold the AvrPi54 alleles. It is well known that O. rufipogon is the ancestral progenitor of rice (O. sativa). The fact that the AvrPi54 gene was detected among isolates from O. rufipogon indicated that it has existed during the co-evolutionary history between O. rufipogon and P. oryzae, and it originated earlier. In the previous studies [7,70,71], P. oryzae is divided into several subgroups according to its restricted range of host species. Major subgroups included the Oryza pathotype, Setaria pathotype, Panicum pathotype, Eleusine pathotype and Digitaria pathotype. According to our result, the AvrPi54 gene was shared between the Oryza pathotype and Eleusine pathotype. It indicated there existed some gene flow between the Oryza pathotype and Eleusine pathotype. E. coracana would be a potential host resource for rice blasts.
In this study, the Pi54 gene still has some applicable value in central, southeast, west, and northeast of Yunnan province according to the distribution of AvrPi54 and the pathogenicity assay (Table 1). According to the pathogenicity assay, 74.5% of isolates were avirulent to the resistant variety Tetep. There were two reasons for the difference between the frequency of AvrPi54 PCR amplification and that of avirulent isolates by pathogenicity assay. One reason was that other Avr/R pairs played a role in resistance, and the other was that the primer binding site variation lead to amplification failure.
Mutations (point mutation, deletion, TE and frameshift) of the Avr gene may result in the loss of its avirulent functionality. These cases in P. oryzae have been reviewed in our previous study [67]. The sequence analysis is beneficial to understand Avr gene distribution, the characteristics of variation and the mining of new alleles. In this study, five haplotypes were obtained by sequencing analysis of the AvrPi54 gene among 136 rice isolates and 6 non-rice isolates. And they were avirulent to Tetep through pathogenicity assay. The results suggested that the variance of AvrPi54 in Yunnan did not alter its virulence. The existence of the avirulent function of AvrPi54 is one of the causes that Pi54 plays the role of a durable broad-spectrum resistance gene. Among the five AvrPi54 haplotypes, H1, identical to HF545677, was not only detected among 5 O. rufipogon isolates but also widely distributed in 14 prefectures of seven regions in Yunnan Province including 127 rice isolates (GJ and XI rice isolates). The network of AvrPi54 haplotypes also indicated that H2, H3 and H4 were originated from H1 (Figure 3). A similar result was found in the NJ tree (Figure 4). These results indicated that H1 was an ancestral haplotype. Four novel haplotypes (H2 to H5) of the AvrPi54 gene detected in this study would provide some new target sites for rice blast control.
In a previous study [13], balancing selection at the AvrPi54 locus and positive selection at Pi54 locus were, respectively, detected in P. oryzae and O. sativa populations. Pi54 is diversified with higher nucleotide diversity and haplotype diversity (π = 0.03164, Hd = 0.929, 40 haplotypes) among 72 rice landraces, while their counterparts, AvrPi54, are conserved with lower nucleotide diversity and haplotype diversity (π = 4.8 × 10−4, Hd = 0.088, three haplotypes) among 45 avirulent isolates. Trench warfare co-evolution between Pi54 and AvrPi54 was speculated [13]. Even though more than three times the isolates from the previous paper [13] were used in this study, a low diversity level of nucleotides and haplotypes for AvrPi54 was still detected (π = 2.9 × 10−4, Hd = 0.127, five haplotypes). These results mean that AvrPi54 evolves slowly and stably, and is a comparatively conserved Avr gene, similar to the previous study [13]. The neutrality test indicated that AvrPi54 was affected by purified selection. Maybe P. oryzae population in Yunnan experienced different evolutionary events, compared to the balanced selection in a previous paper [13]. It perhaps experienced population expansion after the bottleneck effect in this study. In the network of AvrPi54 haplotypes (Figure 3), H5 is a separated haplotype without a link to other haplotypes. A similar result was found in the NJ tree (Figure 4). The independent position of the H5 haplotype may be a relic of the bottleneck effect. Whether trench warfare is suited for co-evolution between Pi54 and AvrPi54 in Yunnan would be further to study the variation and evolutionary of Pi54.

5. Conclusions

Through our study, the distribution, variation, pathogenicity and evolution of the AvrPi54 gene were well understood among P. oryzae populations in Yunnan province. In summary, AvrPi54 is a conserved avirulent gene with a low diversity level of haplotypes in the Yunnan rice production regions. The gene’s variance did not alter its avirulent function and was affected by purified selection. Four novel haplotypes (H2 to H5) of the AvrPi54 gene detected in this study would offer new target sites for disease monitoring. These results provide useful information on Pi54 resistance gene breeding and variety layout for rice blast control.

Author Contributions

Conceptualization, J.L. and Q.W.; Data curation, K.W., Z.Z., H.L., Y.B. and Z.S.; Formal analysis, C.H. (Chengxing He), Q.W., H.F. and J.S.; Funding acquisition, Q.W.; Investigation, Y.B., Z.S., H.F. and J.S.; Methodology, C.H. (Chengxing He), C.D. and L.L.; Project administration, J.L. and Q.W.; Resources, J.L. and C.D.; Software, C.H. (Chi He) and Q.W.; Supervision, Q.W.; Validation, C.H. (Chengxing He), C.D., L.L. and C.H. (Chi He); Visualization, C.H. (Chi He) and Q.W.; Writing—original draft, C.H. (Chengxing He) and Q.W.; Writing—review and editing, Q.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (No. 32060588).

Data Availability Statement

The data of this study are presented in charts and tables.

Acknowledgments

Thanks to Sihai Yang and Long Wang of Nanjing University for providing rice resistance cultivar as control.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zeng, D.; Tian, Z.; Rao, Y.; Dong, G.; Yang, Y.; Huang, L.; Leng, Y.; Xu, J.; Sun, C.; Zhang, G.; et al. Rational design of high-yield and superior-quality rice. Nat. Plants 2017, 3, 17031. [Google Scholar] [CrossRef]
  2. Dean, R.A.; Talbot, N.J.; Ebbole, D.J.; Farman, M.L.; Mitchell, T.K.; Orbach, M.J.; Thon, M.; Kulkarni, R.; Xu, J.R.; Pan, H.; et al. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 2005, 434, 980–986. [Google Scholar] [CrossRef] [PubMed]
  3. Ou, S.H. Rice Disease, 2nd ed.; Commonwealth Mycological Institute: Kew, UK, 1985. [Google Scholar]
  4. Couch, B.C.; Kohn, L.M. A multilocus gene genealogy concordant with host preference indicates segregation of a new species, Magnaporthe oryzae, from M. grisea. Mycologia 2002, 94, 683–693. [Google Scholar] [CrossRef] [PubMed]
  5. Takabayashi, N.; Tosa, Y.; Oh, H.S.; Mayama, S. A gene-for-gene relationship underlying the species-specific parasitism of Avena/Triticum isolates of Magnaporthe grisea on wheat cultivars. Phytopathology 2002, 92, 1182–1188. [Google Scholar] [CrossRef] [PubMed]
  6. Murakami, J.; Tomita, R.; Kataoka, T.; Nakayashiki, H.; Tosa, Y.; Mayama, S. Analysis of host species specificity of Magnaporthe grisea toward foxtail millet using a genetic cross between isolates from wheat and foxtail millet. Phytopathology 2003, 93, 42–45. [Google Scholar] [CrossRef] [PubMed]
  7. Couch, B.C.; Fudal, I.; Lebrun, M.H.; Tharreau, D.; Valent, B.; van Kim, P.; Nottéghem, J.L.; Kohn, L.M. Origins of host-specific populations of the blast pathogen Magnaporthe oryzae in crop domestication with subsequent expansion of pandemic clones on rice and weeds of rice. Genetics 2005, 170, 613–630. [Google Scholar] [CrossRef] [PubMed]
  8. Cook, D.C.; Fraser, R.W.; Paini, D.R.; Warden, A.C.; Lonsdale, W.M.; De Barro, P.J. Biosecurity and yield improvement technologies are strategic complements in the fight against food insecurity. PLoS ONE 2011, 6, e26084. [Google Scholar] [CrossRef] [PubMed]
  9. Choi, J.; Park, S.Y.; Kim, B.R.; Roh, J.H.; Oh, I.S.; Han, S.S.; Lee, Y.H. Comparative analysis of pathogenicity and phylogenetic relationship in Magnaporthe grisea species complex. PLoS ONE 2013, 8, e57196. [Google Scholar] [CrossRef] [PubMed]
  10. Orbach, M.J.; Farrall, L.; Sweigard, J.A.; Chumley, F.G.; Valent, B. A telomeric avirulence gene determines efficacy for the rice blast resistance gene Pi-ta. Plant Cell 2000, 12, 2019–2032. [Google Scholar] [CrossRef]
  11. Dai, Y.; Jia, Y.; Correll, J.; Wang, X.; Wang, Y. Diversification and evolution of the avirulence gene AVR-Pita1 in field isolates of Magnaporthe oryzae. Fungal Genet. Biol. 2010, 47, 973–980. [Google Scholar] [CrossRef]
  12. Jia, Y.; Zhou, E.; Lee, S.; Bianco, T. Coevolutionary dynamics of rice blast resistance gene Pi-ta and Magnaporthe oryzae avirulence gene AVR-Pita1. Phytopathology 2016, 106, 676–683. [Google Scholar] [CrossRef]
  13. Singh, P.K.; Ray, S.; Thakur, S.; Rathour, R.; Sharma, V.; Sharma, T.R. Co-evolutionary interactions between host resistance and pathogen avirulence genes in rice-Magnaporthe oryzae pathosystem. Fungal Genet. Biol. 2018, 115, 9–19. [Google Scholar] [CrossRef] [PubMed]
  14. Ellis, J.G.; Lawrence, G.J.; Luck, J.E.; Dodds, P.N. Identification of regions in alleles of the flax rust resistance gene L that determine differences in gene-for-gene specificity. Plant Cell 1999, 11, 495–506. [Google Scholar] [CrossRef] [PubMed]
  15. Dodds, P.N.; Lawrence, G.J.; Catanzariti, A.M.; Ayliffe, M.A.; Ellis, J.G. The Melampsora lini AvrL567 avirulence genes are expressed in haustoria and their products are recognized inside plant cells. Plant Cell 2004, 16, 755–768. [Google Scholar] [CrossRef] [PubMed]
  16. Dodds, P.N.; Lawrence, G.J.; Catanzariti, A.M.; Teh, T.; Wang, C.I.; Ayliffe, M.A.; Kobe, B.; Ellis, J.G. Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes. Proc. Natl. Acad. Sci. USA 2006, 103, 8888–8893. [Google Scholar] [CrossRef] [PubMed]
  17. Dangl, J.L.; McDowell, J.M. Two modes of pathogen recognition by plants. Proc. Natl. Acad. Sci. USA 2006, 103, 8575–8576. [Google Scholar] [CrossRef] [PubMed]
  18. Kanzaki, H.; Yoshida, K.; Saitoh, H.; Fujisaki, K.; Hirabuchi, A.; Alaux, L.; Fournier, E.; Tharreau, D.; Terauchi, R. Arms race co-evolution of Magnaporthe oryzae AVR-Pik and rice Pik genes driven by their physical interactions. Plant J. 2012, 72, 894–907. [Google Scholar] [CrossRef] [PubMed]
  19. Stahl, E.A.; Dwyer, G.; Mauricio, R.; Kreitman, M.; Bergelson, J. Dynamics of disease resistance polymorphism at the Rpm1 locus of Arabidopsis. Nature 1999, 400, 667–671. [Google Scholar] [CrossRef] [PubMed]
  20. Stahl, E.A.; Bishop, J.G. Plant-pathogen arms races at the molecular level. Curr. Opin. Plant Biol. 2000, 3, 299–304. [Google Scholar] [CrossRef]
  21. Flor, H.H. Current status of the gene-for-gene concept. Annu. Rev. Phytopathol. 1971, 9, 275–296. [Google Scholar] [CrossRef]
  22. Zeigler, R.S.; Leong, S.A.; Teng, P.S. Rice Blast Disease; Commonwealth Agricultural Bureau International: Wallingford, UK, 1994. [Google Scholar]
  23. Silué, D.; Notteghem, J.L.; Tharreau, D. Evidence of a gene for gene relationship in the Oryza sativa-Magnaporthe grisea pathosystem. Phytopathology 1992, 82, 577–580. [Google Scholar] [CrossRef]
  24. Devanna, B.N.; Jain, P.; Solanke, A.U.; Das, A.; Thakur, S.; Singh, P.K.; Kumari, M.; Dubey, H.; Jaswal, R.; Pawar, D.; et al. Understanding the dynamics of blast resistance in rice-Magnaporthe oryzae interactions. J. Fungi 2022, 8, 584. [Google Scholar] [CrossRef] [PubMed]
  25. Wang, B.H.; Ebbole, D.J.; Wang, Z.H. The arms race between Magnaporthe oryzae and rice: Diversity and interaction of Avr and R genes. J. Integr. Agric. 2017, 16, 2746–2760. [Google Scholar] [CrossRef]
  26. Wu, W.; Wang, L.; Zhang, S.; Li, Z.; Zhang, Y.; Lin, F.; Pan, Q. Stepwise arms race between AvrPik and Pik alleles in the rice blast pathosystem. Mol. Plant. Microbe Interact. 2014, 27, 759–769. [Google Scholar] [CrossRef] [PubMed]
  27. Kim, S.; Kim, C.Y.; Park, S.Y.; Kim, K.T.; Jeon, J.; Chung, H.; Choi, G.; Kwon, S.; Choi, J.; Jeon, J.; et al. Two nuclear effectors of the rice blast fungus modulate host immunity via transcriptional reprogramming. Nat. Commun. 2020, 11, 5845. [Google Scholar] [CrossRef] [PubMed]
  28. Ray, S.; Singh, P.K.; Gupta, D.K.; Mahato, A.K.; Sarkar, C.; Rathour, R.; Singh, N.K.; Sharma, T.R. Analysis of Magnaporthe oryzae genome reveals a fungal effector, which is able to induce resistance response in transgenic rice line containing resistance gene, Pi54. Front. Plant Sci. 2016, 7, 1140. [Google Scholar] [CrossRef] [PubMed]
  29. Sharma, T.R.; Madhav, M.S.; Singh, B.K.; Shanker, P.; Jana, T.K.; Dalal, V.; Pandit, A.; Singh, A.; Gaikwad, K.; Upreti, H.C. High-resolution mapping, cloning and molecular characterization of the Pi-kh gene of rice, which confers resistance to Magnaporthe grisea. Mol. Genet. Genom. 2005, 274, 569–578. [Google Scholar] [CrossRef] [PubMed]
  30. Rai, A.K.; Kumar, S.P.; Gupta, S.K.; Gautam, N.; Singh, N.K.; Sharma, T.R. Functional complementation of rice blast resistance gene Pi-kh (Pi54) conferring resistance to diverse strains of Magnaporthe oryzae. J. Plant Biochem. Biotechnol. 2011, 20, 55–65. [Google Scholar] [CrossRef]
  31. Kumari, M.; Devanna, B.N.; Singh, P.K.; Rajashekara, H.; Sharma, V.; Sharma, T.R. Stacking of blast resistance orthologue genes in susceptible indica rice line improves resistance against Magnaporthe oryzae. 3 Biotech 2017, 8, 37. [Google Scholar] [CrossRef]
  32. Kumari, M.; Rai, A.K.; Devanna, B.N.; Singh, P.K.; Kapoor, R.; Rajashekara, H.; Prakash, G.; Sharma, V.; Sharma, T.R. Co-transformation mediated stacking of blast resistance genes Pi54 and Pi54rh in rice provides broad spectrum resistance against Magnaporthe oryzae. Plant Cell Rep. 2017, 36, 1747–1755. [Google Scholar] [CrossRef]
  33. Gupta, S.K.; Rai, A.K.; Kanwar, S.S.; Chand, D.; Singh, N.K.; Sharma, T.R. The single functional blast resistance gene Pi54 activates a complex defence mechanism in rice. J. Exp. Bot. 2012, 63, 757–772. [Google Scholar] [CrossRef]
  34. Singh, J.; Gupta, S.K.; Devanna, B.N.; Singh, S.; Upadhyay, A.; Sharma, T.R. Blast resistance gene Pi54 over-expressed in rice to understand its cellular and sub-cellular localization and response to different pathogens. Sci. Rep. 2020, 10, 5243. [Google Scholar] [CrossRef]
  35. Das, A.; Soubam, D.; Singh, P.K.; Thakur, S.; Singh, N.K.; Sharma, T.R. A novel blast resistance gene, Pi54rh cloned from wild species of rice, Oryza rhizomatis confers broad spectrum resistance to Magnaporthe oryzae. Funct. Integr. Genom. 2012, 12, 215–228. [Google Scholar] [CrossRef]
  36. Devanna, N.B.; Vijayan, J.; Sharma, T.R. The blast resistance gene Pi54of cloned from Oryza officinalis interacts with Avr-Pi54 through its novel non-LRR domains. PLoS ONE 2014, 9, e104840. [Google Scholar] [CrossRef] [PubMed]
  37. Kumari, A.; Das, A.; Devanna, B.N.; Thakur, S.; Singh, P.K.; Singh, N.K.; Sharma, T.R. Mining of rice blast resistance gene Pi54 shows effect of single nucleotide polymorphisms on phenotypic expression of the alleles. Eur. J. Plant Pathol. 2013, 137, 55–65. [Google Scholar] [CrossRef]
  38. Thakur, S.; Singh, P.K.; Das, A.; Rathour, R.; Sharma, T.R. Extensive sequence variation in rice blast resistance gene Pi54 makes it broad spectrum in nature. Front. Plant Sci. 2015, 6, 345. [Google Scholar] [CrossRef] [PubMed]
  39. Vasudevan, K.; Gruissem, W.; Bhullar, N.K. Identification of novel alleles of the rice blast resistance gene Pi54. Sci. Rep. 2015, 5, 15678. [Google Scholar] [CrossRef] [PubMed]
  40. Ramkumar, G.; Madhav, M.S.; Rama Devi, S.J.S.; Umakanth, B.; Pandey, M.K.; Prasad, M.S.; Sundaram, R.M.; Viraktamath, B.C.; Ravindra Babu, V. Identification and validation of novel alleles of rice blast resistant gene Pi54, and analysis of their nucleotide diversity in landraces and wild Oryza species. Euphytica 2016, 209, 725–737. [Google Scholar] [CrossRef]
  41. Zhang, L.; Nakagomi, Y.; Endo, T.; Teranishi, M.; Hidema, J.; Sato, S.; Higashitani, A. Divergent evolution of rice blast resistance Pi54 locus in the genus Oryza. Rice 2018, 11, 63. [Google Scholar] [CrossRef] [PubMed]
  42. Singh, A.; Singh, V.K.; Singh, S.P.; Pandian, R.T.; Ellur, R.K.; Singh, D.; Bhowmick, P.K.; Gopala Krishnan, S.; Nagarajan, M.; Vinod, K.K.; et al. Molecular breeding for the development of multiple disease resistance in Basmati rice. AoB Plants 2012, 2012, pls029. [Google Scholar] [CrossRef] [PubMed]
  43. Arunakumari, K.; Durgarani, C.V.; Satturu, V.; Sarikonda, K.R.; Chittoor, P.D.R.; Vutukuri, B.; Laha, G.S.; Nelli, A.P.K.; Gattu, S.; Jamal, M.; et al. Marker-assisted pyramiding of genes conferring resistance against bacterial blight and blast diseases into indian rice variety MTU1010. Rice Sci. 2016, 23, 306–316. [Google Scholar] [CrossRef]
  44. Jiang, H.; Li, Z.; Liu, J.; Shen, Z.; Gao, G.; Zhang, Q.; He, Y. Development and evaluation of improved lines with broad-spectrum resistance to rice blast using nine resistance genes. Rice 2019, 12, 29. [Google Scholar] [CrossRef]
  45. Jamaloddin, M.; Durga Rani, C.V.; Swathi, G.; Anuradha, C.; Vanisri, S.; Rajan, C.P.D.; Krishnam Raju, S.; Bhuvaneshwari, V.; Jagadeeswar, R.; Laha, G.S.; et al. Marker Assisted Gene Pyramiding (MAGP) for bacterial blight and blast resistance into mega rice variety “Tellahamsa”. PLoS ONE 2020, 15, e0234088. [Google Scholar] [CrossRef]
  46. Ramalingam, J.; Palanisamy, S.; Alagarasan, G.; Renganathan, V.G.; Ramanathan, A.; Saraswathi, R. Improvement of stable restorer lines for blast resistance through functional marker in rice (Oryza sativa L.). Genes 2020, 11, 1266. [Google Scholar] [CrossRef]
  47. Wu, Y.; Xiao, N.; Yu, L.; Pan, C.; Li, Y.; Zhang, X.; Liu, G.; Dai, Z.; Pan, X.; Li, A. Combination patterns of major R genes determine the level of resistance to the M. oryzae in rice (Oryza sativa L.). PLoS ONE 2015, 10, e0126130. [Google Scholar]
  48. Chen, F.; Xu, J.D.; Jiang, M.S.; Liang, S.M.; Zhang, Q.F.; Wang, W.L.; Li, G.X.; Yang, L.Q.; Zhu, W.Y.; Zhou, X.B. Molecular detection of rice blast resistance genes Pi-ta, Pi-b, Pi54 and Pikm in japonica rice of Huang-huai region. Curr. Biotechnol. 2018, 8, 46–54. [Google Scholar]
  49. Wan, B.; Liu, K.; Zhao, S.; Zhu, J.; Liu, Y.; Zhang, G.; Zhu, G.; Wang, A.; Tang, H.; Sun, M.; et al. Distribution of rice blast resistance genes Pi-ta, Pi-b, Pigm and Pi54 in backbone parent and their relationships with neck blast resistance. Southwest China J. Agric. Sci. 2020, 33, 1–6. [Google Scholar]
  50. Singh, R.P.; Hodson, D.P.; Huerta-Espino, J.; Jin, Y.; Bhavani, S.; Njau, P.; Herrera-Foessel, S.; Singh, P.K.; Singh, S.; Govindan, V. The emergence of Ug99 races of the stem rust fungus is a threat to world wheat production. Annu. Rev. Phytopathol. 2011, 49, 465–481. [Google Scholar] [CrossRef] [PubMed]
  51. McDonald, B.A.; Linde, C. Pathogen population genetics, evolutionary potential, and durable resistance. Annu. Rev. Phytopathol. 2002, 40, 349–379. [Google Scholar] [CrossRef] [PubMed]
  52. Stukenbrock, E.H.; McDonald, B.A. Population genetics of fungal and oomycete effectors involved in gene-for-gene interactions. Mol. Plant. Microbe Interact. 2009, 22, 371–380. [Google Scholar] [CrossRef]
  53. Zhu, H. Biogeographical divergence of the flora of Yunnan, southwestern China initiated by the uplift of Himalaya and extrusion of Indochina block. PLoS ONE 2012, 7, e45601. [Google Scholar]
  54. Myers, N.; Mittermeier, R.A.; Mittermeier, C.G.; da Fonseca, G.A.; Kent, J. Biodiversity hotspots for conservation priorities. Nature 2000, 403, 853–858. [Google Scholar] [CrossRef]
  55. Huang, X.; Kurata, N.; Wei, X.; Wang, Z.X.; Wang, A.; Zhao, Q.; Zhao, Y.; Liu, K.; Lu, H.; Li, W.; et al. A map of rice genome variation reveals the origin of cultivated rice. Nature 2012, 490, 497–501. [Google Scholar] [CrossRef]
  56. Huang, Y.; Sun, X.; Wang, X. Study on the center of genetic diversity and its origin of cultivated rice in China. J. Plant Genet. Resour. 2005, 6, 125–129. [Google Scholar]
  57. Saleh, D.; Milazzo, J.; Adreit, H.; Fournier, E.; Tharreau, D. South-East Asia is the center of origin, diversity and dispersion of the rice blast fungus, Magnaporthe oryzae. New Phytol. 2014, 201, 1440–1456. [Google Scholar] [CrossRef] [PubMed]
  58. Li, J.; Lu, L.; Jia, Y.; Li, C. Effectiveness and durability of the rice Pi-ta gene in Yunnan province of China. Phytopathology 2014, 104, 762–768. [Google Scholar] [CrossRef] [PubMed]
  59. Jia, Y.; Valent, B.; Lee, F.N. Determination of host responses to Magnaporthe grisea on detached rice leaves using a spot inoculation method. Plant Dis. 2003, 87, 129–133. [Google Scholar] [CrossRef]
  60. Tai, T.H.; Tanksley, S.D. A rapid and inexpensive method for isolation of total DNA from dehydrated plant tissue. Plant Mol. Biol. Report. 1990, 8, 297–303. [Google Scholar] [CrossRef]
  61. Burland, T.G. DNASTAR’s Lasergene sequence analysis software. In Bioinformatics Methods and Protocols. Methods in Molecular BiologyTM.; Misener, S., Krawetz, S.A., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 71–91. [Google Scholar]
  62. Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The ClustalX windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef]
  63. Nei, M. Molecular Evolutionary Genetics; Columbia University Press: New York, NY, USA, 1987. [Google Scholar]
  64. Nei, M.; Miller, J.C. A simple method for estimating average number of nucleotide substitutions within and between populations from restriction data. Genetics 1990, 125, 873–879. [Google Scholar] [CrossRef]
  65. Rozas, J.; Sanchez-DelBarrio, J.C.; Messeguer, X.; Rozas, R. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 2003, 19, 2496–2497. [Google Scholar] [CrossRef] [PubMed]
  66. Tajima, F. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 1989, 123, 585–595. [Google Scholar] [CrossRef] [PubMed]
  67. Wang, Q.; Li, J.; Lu, L.; He, C.; Li, C. Novel variation and evolution of AvrPiz-t of Magnaporthe oryzae in field isolates. Front. Genet. 2020, 11, 746. [Google Scholar] [CrossRef] [PubMed]
  68. Clement, M.; Posada, D.; Crandall, K.A. TCS: A computer program to estimate gene genealogies. Mol. Ecol. 2000, 9, 1657–1659. [Google Scholar] [CrossRef]
  69. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger dataset. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  70. Kato, H.; Yamamoto, M.; Yamaguchi-Ozaki, T.; Kadouchi, H.; Iwamoto, Y.; Nakayashiki, H. Pathogenicity, mating ability and DNA restriction fragment length polymorphisms of Pyricularia populations isolated from Gramineae, Bambusideae and Zingiberaceae plants. J. Gen. Plant Pathol. 2000, 66, 30–47. [Google Scholar] [CrossRef]
  71. Farman, M.L. Pyricularia grisea isolates causing gray leaf spot on perennial ryegrass (Lolium perenne) in the United States: Relationship to P. grisea isolates from other host plants. Phytopathology 2002, 92, 245–254. [Google Scholar]
Agronomy 14 00454 g001
Figure 1. Disease reaction of representative isolates among 5 haplotypes to Tetep and LTH. Note: Tetep, a resistant variety to Pi54 gene; LTH, a susceptible variety to Pi54 gene; 11-59-1a, 94-184-1a, 08-36-2a, 95-60-1a and 96-22(L)-1a were, respectively, representative isolates of haplotypes H1 to H5.
Figure 1. Disease reaction of representative isolates among 5 haplotypes to Tetep and LTH. Note: Tetep, a resistant variety to Pi54 gene; LTH, a susceptible variety to Pi54 gene; 11-59-1a, 94-184-1a, 08-36-2a, 95-60-1a and 96-22(L)-1a were, respectively, representative isolates of haplotypes H1 to H5.
Agronomy 14 00454 g001
Agronomy 14 00454 g002
Figure 2. Distribution of AvrPi54 haplotypes in Yunnan Province.
Figure 2. Distribution of AvrPi54 haplotypes in Yunnan Province.
Agronomy 14 00454 g002
Agronomy 14 00454 g003
Figure 3. Network of 5 AvrPi54 haplotypes based on 142 Pyricularia isolates in Yunnan province. Note: Every haplotype was separated by mutational events. Alphabet and numbers in circles indicate haplotype identity. All haplotypes are displayed as rectangles or circles. The size of the rectangles or circles corresponds to the haplotype frequency. Rectangle indicated ancestral haplotype. H1 haplotype was identical to AvrPi54 obtained from GenBank (accession no. HF545677).
Figure 3. Network of 5 AvrPi54 haplotypes based on 142 Pyricularia isolates in Yunnan province. Note: Every haplotype was separated by mutational events. Alphabet and numbers in circles indicate haplotype identity. All haplotypes are displayed as rectangles or circles. The size of the rectangles or circles corresponds to the haplotype frequency. Rectangle indicated ancestral haplotype. H1 haplotype was identical to AvrPi54 obtained from GenBank (accession no. HF545677).
Agronomy 14 00454 g003
Agronomy 14 00454 g004
Figure 4. NJ tree for AvrPi54 gene based on 142 Pyricularia oryzae isolates. Note: Numbers above branches indicate bootstrap support above 50%; Different color circles indicate different haplotypes.
Figure 4. NJ tree for AvrPi54 gene based on 142 Pyricularia oryzae isolates. Note: Numbers above branches indicate bootstrap support above 50%; Different color circles indicate different haplotypes.
Agronomy 14 00454 g004
Table 1. AvrPi54 gene amplification and pathogenicity assay to Tetep among Pyricularia isolates in Yunnan province of China.
Table 1. AvrPi54 gene amplification and pathogenicity assay to Tetep among Pyricularia isolates in Yunnan province of China.
Isolates GroupsNo.PCR Amplification of AvrPi54No. SeqPathogenicity Assay to Tetep
+ (%)- (%)A (%)V (%)
Central6241 (66.1)21 (33.9)2250 (80.6)12 (19.4)
KM2820 (71.4)8 (28.6)1025 (89.3)3 (11.7)
YX54 (80.0)1 (20.0)44 (80)1 (20)
CX168 (50.0)8 (50.0)311 (68.8)5 (31.2)
QJ139 (69.2)4 (30.8)510 (76.9)3 (23.1)
West19193 (48.7)98 (51.3)51135 (70.7)56 (29.3)
BS10259 (57.8)43 (42.2)2970 (68.6)32 (31.4)
DL348 (23.5)26 (76.5)719 (55.9)15 (44.1)
DH5526 (47.3)29 (52.7)1546 (83.6)9 (16.4)
Northwest2611 (42.3)15 (57.7)1015 (57.7)11 (42.3)
LJ2611 (42.3)15 (57.7)1015 (57.7)11 (42.3)
Southwest3519 (54.3)16 (45.7)1827 (77.1)8 (22.9)
LC2213 (59.1)9 (40.9)1219 (86.4)3 (13.6)
PE136 (46.2)7 (53.8)68 (61.5)5 (38.5)
Southeast166 (37.5)10 (62.5)412 (75)4 (25)
WS166 (37.5)10 (62.5)412 (75)4 (25)
South4219 (45.2)23 (54.8)1425 (59.5)17 (40.5)
BN219 (42.9)12 (57.1)512 (57.1)9 (42.9)
HH2110 (47.6)11 (52.4)913 (61.9)8 (38.1)
Northeast5221 (40.4)31 (59.6)1745 (86.5)7 (13.5)
ZT5221 (40.4)31 (59.6)1745 (86.5)7 (13.5)
Rice host424210 (49.5)214 (50.5)136309 (72.9)115 (27.1)
GJ276140 (50.7)136 (49.3)85200 (72.5)76 (27.5)
XI14870 (47.3)78 (52.7)51109 (74.3)39 (25.7)
Non-rice host278 (29.6)19 (70.4)627 (100)0 (0)
Oryza rufipogon187 (38.9)11 (61.1)518 (100)0 (0)
Eleusine coracana11 (100.0)0 (0.0)11 (100)0 (0)
E. indica10 (0.0)1 (100.0)01 (100)0 (0)
Digitaria sanguinalis10 (0.0)1 (100.0)01 (100)0 (0)
Musa sp. 60 (0.0)6 (100.0)06 (100)0 (0)
Total451218 (48.3)233 (51.7)142336 (74.5)115 (25.5)
No.: isolate numbers in pathogenicity assay and PCR detection of Avr54 gene; +: numbers of isolates with PCR product of AvrPi54 gene, percentage in parentheses; -: numbers of isolates without PCR product of AvrPi54 gene, percentage in parentheses; No. seq: numbers of sequenced isolates for AvrPi54 gene; A: avirulent isolate numbers in pathogenicity assay, percentage in parentheses; V: virulent isolate numbers in pathogenicity assay, percentage in parentheses; GJ and XI indicate isolates from Geng/Japonica and Xian/Indica rice production area, respectively.
Table 2. Frequency and variable sites of AvrPi54 haplotypes in this study.
Table 2. Frequency and variable sites of AvrPi54 haplotypes in this study.
HaplotypeFrequencyNon-CDSCDSNon-CDS
140141223619683732795841918–9351151115911711180
HF545677 CCGGTTGCTGTAGATGGAGTGGTTGAGGGA
H1132CCGGTTGCTGTAGATGGAGTGGTTGAGGGA
H25CCGGTTGCTGTAGATGGAGTGGTTGAGGAA
H31CCGGTTGCTGTAGATGGAGTGGTTGAGCGA
H41CCGATTGCTGTAGATGGAGTGGTTGAGGGA
H53TTAGCCAA------------------AGGC
Table 3. Protein type encoded by AvrPi54 gene CDS in Yunnan Province.
Table 3. Protein type encoded by AvrPi54 gene CDS in Yunnan Province.
Protein TypeFrequencyAmino Acid Sites
5137
CCN97897-AV
P1140AV
P21AI
P31TV
Table 4. Distribution of Pyricularia oryzae AvrPi54 haplotype.
Table 4. Distribution of Pyricularia oryzae AvrPi54 haplotype.
GroupsH1H2H3H4H5No. SamplesNo. Variable Sites
Central211000221
KM100000100
YX3100041
QJ5000050
CX3000030
West490002519
DL7000070
BS270002299
DH150000150
Northwest64000101
LJ64000101
Northeast170000170
ZT170000170
South130100141
HH9000090
BN4010051
Southwest170010181
LC120000120
PE5001061
Southeast4000040
WS4000040
Rice host127511213612
GJ7850028510
XI490110512
Non-rice host5000169
Oryza rufipogon5000050
Eleusine coracana0000110
Total132511314212
No. samples: isolate numbers in haplotype analysis; No. variable sites: mumbers of variable sites.
Table 5. Diversity and the neutrality test of Tajima’s D of Pyricularia oryzae isolates in Yunnan rice region.
Table 5. Diversity and the neutrality test of Tajima’s D of Pyricularia oryzae isolates in Yunnan rice region.
GroupsTotalNo. HapHdπ × 10−4Tajima’s D
Rice host13650.1272.9−2.1254 *
GJ8530.1564.3−1.92196 *
XI5130.0780.6−1.46227
Central2220.0910.7−1.1624
West5120.0775.6−1.8244 *
Northwest1020.5334.21.30268
Northeast17100-
South1420.1431.1−1.1552
Southwest1820.1110.9−1.1647
Southeast4100-
No. hap: numbers of haplotypes; Hd: haplotype diversity; π: Nucleotide diversity; -: not analyzed. *: significant, p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, J.; He, C.; Dong, C.; Lu, L.; He, C.; Bi, Y.; Shi, Z.; Fan, H.; Shi, J.; Wang, K.; et al. Diversity and Evolution of the Avirulence Gene AvrPi54 in Yunnan Rice Fields. Agronomy 2024, 14, 454. https://doi.org/10.3390/agronomy14030454

AMA Style

Li J, He C, Dong C, Lu L, He C, Bi Y, Shi Z, Fan H, Shi J, Wang K, et al. Diversity and Evolution of the Avirulence Gene AvrPi54 in Yunnan Rice Fields. Agronomy. 2024; 14(3):454. https://doi.org/10.3390/agronomy14030454

Chicago/Turabian Style

Li, Jinbin, Chengxing He, Chao Dong, Lin Lu, Chi He, Yunqing Bi, Zhufeng Shi, Huacai Fan, Junyi Shi, Kaibo Wang, and et al. 2024. "Diversity and Evolution of the Avirulence Gene AvrPi54 in Yunnan Rice Fields" Agronomy 14, no. 3: 454. https://doi.org/10.3390/agronomy14030454

APA Style

Li, J., He, C., Dong, C., Lu, L., He, C., Bi, Y., Shi, Z., Fan, H., Shi, J., Wang, K., Zeng, Z., Luo, H., & Wang, Q. (2024). Diversity and Evolution of the Avirulence Gene AvrPi54 in Yunnan Rice Fields. Agronomy, 14(3), 454. https://doi.org/10.3390/agronomy14030454

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop