Next Article in Journal
Sowing Rates and Methods Affect Yield and Forage Quality of American Jointvetch in the Southwestern Area of Japan
Previous Article in Journal
Endophytic Bacterial Communities in Wild Rice (Oryza eichingeri) and Their Effects on Cultivated Rice Growth
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Mating Type of Native Aspergillus flavus Strains Causing Corn Ear Rot in Argentina

by
Agustina María Ruiz Posse
1,*,
Ada Karina Torrico Ramallo
1,
Javier Miguel Barontini
2 and
Boris Xavier Camiletti
3
1
Unidad de Fitopatología y Modelización Agrícola (UFyMA), Instituto Nacional de Tecnología Agropecuaria (INTA)—Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Av. 11 de Septiembre 4755, Cordoba X5014MGO, Argentina
2
Cátedra de Fitopatología, Facultad de Ciencias Agrarias, Universidad Nacional de Cuyo, Almirante Brown 500, Chacras de Coria, Mendoza M5528AHB, Argentina
3
Department of Crop Sciences, University of Illinois Urbana-Champaign, Urbana, IL 61801, USA
*
Author to whom correspondence should be addressed.
Agronomy 2024, 14(12), 2962; https://doi.org/10.3390/agronomy14122962 (registering DOI)
Submission received: 21 October 2024 / Revised: 3 December 2024 / Accepted: 10 December 2024 / Published: 12 December 2024
(This article belongs to the Section Pest and Disease Management)

Abstract

Fungi of the Aspergillus genus, particularly A. flavus, pose a significant threat to maize crops as they can produce toxic and carcinogenic aflatoxin compounds. This study focused on identifying the sexual mating types, MAT1-1 and MAT1-2, through PCR in A. flavus strains isolated from maize ears in two agricultural regions of Argentina—one subtropical and the other temperate—from the 2012/13 to the 2020/21 growing season. A total of 81 strains were analyzed, revealing a higher frequency of the MAT1-1 type in both regions (69%) and in the seasons with the highest number of strains collected. The MAT1-1 strains included 63% non-aflatoxigenic and 37% aflatoxin producers, predominantly lacking sclerotia production (69%), while MAT1-2 strains were mostly aflatoxin producers (82%) and S-sclerotia producers (48%). Additionally, more vegetative compatibility groups were identified as MAT1-1 (4 out of 6) than MAT1-2. These findings suggest that the use of MAT1-1 strains as biocontrol agents could maintain the stability of natural populations and reduce aflatoxin production, minimizing risks to crops. This underscores the importance of evaluating the genetic structure of A. flavus populations to implement effective biological control strategies.

1. Introduction

Fungi of the genus Aspergillus P. Micheli ex Haller, especially A. flavus, are known for their ability to produce type B aflatoxins (B1 and B2), toxic compounds that pose a significant risk to human and animal health [1,2]. Aflatoxin B1 (AFB1) is classified as a Group 1 carcinogen by the International Agency for Research on Cancer [3]. The identification and use of atoxigenic strains of A. flavus has, therefore, become a key strategy for the biological control of these mycotoxins.
Aspergillus flavus has various propagative structures that allow it to survive and spread under different environmental conditions. The mycelium, a network of branched hyphae, represents the vegetative form of the fungus, absorbing nutrients and generating conidia, asexual spores that disperse by wind or insects, thus facilitating long-distance infection [4]. Under adverse conditions, it can form resistance structures called sclerotia. These hardened masses of hyphae that act as survival mechanisms [5] enable the fungus to be classified into three morphotypes: S (sclerotia with a diameter of less than 400 μm), L (sclerotia with a diameter greater than 400 μm), and NP (does not produce sclerotia under laboratory conditions) [6,7,8].
In terms of reproduction, in addition to its asexual cycle, this species possesses a sexual cycle and is heterothallic. As such, sexual mating occurs between individuals of opposite mating types, determining compatibility between different strains [9]. The mating types in these fungi are controlled by a locus with two idiomorphs, MAT1-1 and MAT1-2 [10,11]. These mating genes encode transcription factors that regulate pheromone genes and their receptors [9]. These genes have the potential to delineate species boundaries, making them valuable in evolutionary and phylogenetic studies [12]. In natural populations, the frequency and distribution of MAT genes indicate the prevalence of sexual reproduction. Since they are controlled by a single Mendelian locus, mating types are expected to appear in a 1:1 ratio [9,12], a finding confirmed by Gell et al. [13].
Sexual crossing in A. flavus has been successfully achieved under controlled laboratory conditions, with the development of ascospores when the product is kept in the laboratory or immediately transferred to the field [13,14,15,16]. However, natural sexual reproduction has not been documented to date. Additionally, it has been observed that the proportion of mating types in A. flavus populations varies depending on soil ecology and exposure to different environmental conditions, suggesting that these factors influence the genetic structure and reproductive dynamics of populations [10].
In the sexual reproduction process, A. flavus sclerotia act as female organisms, while hyphae from conidia act as male organisms [16]. This process can lead to the formation of sexual structures called ascocarps, which contain 1 to 8 ascospores. Fertility varies between strains and depends on the role they assume in the cross [17]. Although reciprocal crossing studies have shown that A. flavus is hermaphrodite, playing both sexual roles [17,18], it is self-incompatible, a genetic barrier that ensures cross-breeding and promotes genetic diversity in populations.
Sexual reproduction generates recombinant progeny through independent chromosome segregation and recombination events, both in the aflatoxin gene cluster and in other genomic regions [19]. This recombination would provide high genetic variation, promoting the formation of new vegetative compatibility groups (VCGs) and genetic diversity within populations [20]. This genetic variability would also explain the wide range of aflatoxin production observed in field populations, ranging from non-aflatoxigenic strains to those producing high concentrations [7,21,22,23,24,25,26].
The existence of sexual reproduction raises questions about the long-term effects of using A. flavus strains in biocontrol of the same species, as it could alter the genetic composition of biocontrol strains, and the persistence of mycotoxins in crops [11]. Therefore, it is crucial to understand this trait in the population and in the candidate strains to be used as biocontrol agents [18]. No global temporal or spatial pattern has yet been identified regarding the distribution of and variability in mating types [10,15,26,27,28,29,30,31].
In this context, A. flavus strains present in the temperate and subtropical maize-growing regions of Argentina may be expected to exhibit differences in mating types and sclerotia production based on their ability or inability to produce aflatoxins. These characteristics need to be leveraged to develop biocontrol strategies tailored to local agricultural conditions. The aim of this study was to determine the presence, proportion, and distribution of the sexual compatibility types, MAT1-1 and MAT1-2, in A. flavus strains from corn ears in pre-harvest crops from two regions of Argentina from 2012/2013 to 2020/2021, and their relationship with their characteristics of toxicity, sclerotia production, and vegetative compatibility groups (VCGs).

2. Materials and Methods

2.1. Fungal Isolates

For this study, 81 single-spore isolates of A. flavus were randomly selected from a total of 273 isolates collected annually since the 2012/2013 season. These isolates are stored in the Culture Collection of the Institute of Plant Pathology (IPAVE) in Córdoba, Argentina. They were obtained from individual ears of commercial corn crops in two distinct agroclimatic regions of Argentina. In total, 42 of the 81 strains were previously characterized for toxicity, sclerotia production, and VCGs by Camiletti et al. [32] and Barontini et al. [21]. Twenty isolates were characterized for these parameters for the first time in this work, while the rest remain uncharacterized. The mating type, the primary focus of this study, was characterized for all isolates for the first time, as explained below. Detailed information is provided in Table S1. The set of isolates exhibited a diverse range of characteristics relevant to this study. This included both aflatoxigenic and non-aflatoxigenic isolates, producers of L-type or S-type sclerotia, and non-sclerotia producers (Table S1). Additionally, they span eight agricultural seasons and six vegetative compatibility groups (VCGs) (Table S2). Strains from the 2019/20 season were not available due to pandemic-related restrictions.

2.2. Sclerotia Production

Isolates were grown in the center of Petri dishes with Czapeck dox medium, inoculated with 10 µL of spore suspension, and incubated at 30 °C for 14 days [33]. Sclerotia were collected, measured microscopically (Nikon eclipse Cs1 spectral), and classified following the criteria used by Cotty [34] into L or S morphotypes or non-producers (NPs) [35]. Non-producing isolates were further incubated on 5/2 medium at 31 °C for 5–7 days to induce sclerotia formation [6].

2.3. Aflatoxin Production

Aflatoxin production was determined following the methodology described by Camiletti et al. [32]. Briefly, Erlenmeyer flasks (250 mL) were prepared with 10 g of healthy maize grain and autoclaved at 121 °C for 60 min. The moisture was adjusted to 25% with sterile water containing 106 conidia per flask. Maize kernels were incubated at 31 °C for 7 days. After the incubation period, 50 mL of methanol/water (70/30) (Cicarelli®, Santa Fe, Argentina) was added to each flask and homogenized for 60 s in a grain blender. The samples were evaluated by high-performance liquid chromatography (HPLC) in an HP 1050 series system.

2.4. VCG Determination

Mutants were generated following the method described by Mauro et al. (2013) [36], with minor adjustments. Briefly, increased concentrations of KClO3 (Biopack®, Buenos Aires, Argentina) facilitated mutant production. The mutants were classified based on their phenotypes (NirA, NiaD, and cnx) and tested for self-compatibility and complementation using testers obtained by Camiletti et al. [32].

2.5. DNA Isolation

The strains were cultured on potato dextrose agar (PDA) (Britania SA, CABA, Buenos Aires, Argentina) plates for 5 days at 25 °C. Spore dilutions were prepared in water (1 × 105 conidia/mL), and 100 mL of liquid culture medium (20% potato leachate, 2% sucrose, pH 4.5) (Anedra, Research Ag, Buenos Aires, Argentina) was inoculated in 250 mL flasks. The flasks were placed on a shaker at 250 rpm and incubated at 25 °C for 48 h. Mycelia were collected by filtration (Whatman No. 1), rinsed three times with sterile water, and dried in a laminar flow hood for preservation and storage at −20 °C. There were two methodologies for DNA extraction:
Methodology A: The mycelium was brought to 25 °C and DNA was extracted using the FastDNA kit and the FastPrep instrument (MP Biomedicals, Santa Ana, CA, USA) following the manufacturer’s instructions.
Methodology B: the mycelium was pulverized in liquid nitrogen using a mortar. Subsequently, 500 µL of 2% CTAB buffer solution (100 mM Tris-Cl, 20 mM EDTA, and 1.4 M NaCl) (Cicarelli®, Arg.) was added. To each sample, 1 µL of 0.2% β-mercaptoethanol (Sigma, St Louis, CA, USA) was introduced, and the mixture was vortexed for 30 s. The tubes were then incubated in a water bath at 65 °C for 30 min. Following this, 25 µL of a chloroform–isoamyl alcohol mixture (24:1) (Cicarelli®, Santa Fe, Argentina) was added to each sample, vortexed for 1 min, and centrifuged at 10,000 rpm for 10 min (TA 16 °C). The supernatant was recovered from each sample and transferred to a new 1.5 mL tube. The addition of the chloroform–isoamyl alcohol mixture (24/1) was repeated, followed by centrifugation at 10,000 rpm for 10 min under the same conditions. The supernatant was again recovered and transferred to a fresh 1.5 mL tube, where 0.66 volumes of cold isopropanol were added. The tubes were gently inverted to mix, and the samples were left to precipitate for 1 h. The precipitated samples were centrifuged at 12,000 rpm for 20 min. The supernatant was discarded by inverting the tubes, ensuring the pellet was retained. The tubes containing the pellets were air-dried upside down on absorbent paper for 10 to 15 min. The pellet was then washed with 1 mL of 70% ethanol, gently vortexed, and kept at −20 °C for 20 min before being centrifuged at 10,000 rpm for 10 min. The supernatant was discarded, and the tubes were left inverted to remove residual ethanol. Once dry, the pellets were resuspended in 30 µL of DEPC–water.
The DNA obtained from both methods was quantified by spectrophotometry (NanoDrop, Thermo Fisher Scientific, Waltham, MA, USA) and subjected to 1.5% agarose gel electrophoresis in 1X TAE buffer. DNA concentration and purity were determined using a transilluminator spectrophotometer after staining with GelRedTM Biotium (2.5 ng.µL⁻1). DNA concentration was estimated visually by comparing the band intensity to that of the “qLadder 100 bp precision” marker (PB-L®, Buenos Aires, Argentina) and compared to the values obtained by NanoDrop.

2.6. MAT Locus Amplification Patterns

With the above procedure, DNA was obtained from potential biocontrol agents and mycotoxin-producing isolates. Multiplex PCR chain reactions were carried out using the technique described by Ramirez-Prado et al. [37] with some modifications. The PCR conditions were as follows: 5 min at 94 °C, followed by 40 cycles of 30 s at 94 °C, 60 s at 58 °C and 30 s at 72 °C, ending with an extension of 5 min at 72 °C. PCR products were separated by electrophoresis on 1.5% agarose gels stained with GelRed in 1X TAE buffer solution. The gels were run at a constant voltage of 100 V for 30 min, using a 100 bp molecular weight marker (PB-L®, Buenos Aires, Argentina) as the size standard. The specific primers were as follows: for MAT1-1, which amplifies a 396 bp fragment, M1F (ATTGCCCATTTGGCCTTGAA) and M1R (TTGATGACCATGCCACCAGA); and for MAT1-2, which amplifies a 270 bp fragment, M2F (GCATTCATCCTTTATCGTCAGC) and M2R (GCTTCTTTTCGGATGGCTTGCGGGGG) [37].

2.7. Statistical Analysis

Data were analyzed using InfoStat software version 2022 [38]. The χ2 test was applied to compare proportions in multiple categories: mating types across all strains and regions, strain distribution by idiomorph across seasons, sclerotia types by idiomorph and region, and the distribution of aflatoxigenic versus non-aflatoxigenic strains by MAT genotype.

3. Results

When comparing the two DNA isolation methods, Method A produced less nucleic acid but yielded cleaner samples than Method B. However, both methods were effective as they produced comparable results in PCR amplification, confirming the reliability of either method for this application.
Among the 81 isolates, 56 strains were MAT1-1, while 25 strains were MAT1-2 (Table 1). All strains showed a single amplification band. Amplifications at 396 bp indicate MAT1-1, while amplifications at 270 bp indicate MAT1-2 (Figure 1). Regarding toxigenicity, 24 were classified as non-aflatoxigenic, 22 as aflatoxigenic, and 35 remained undetermined. For sclerotia production, 11 isolates had S sclerotia, 16 had L sclerotia, 35 did not produce (NP), and 19 were not determined (ND). Twenty isolates were classified into vegetative compatibility groups (VCGs): eight in AM1, two in AM2, one in AM3, one in AM4, six in AM5, and two in AM6 (Table S1).
In region I, 17 of 25 strains (68%) displayed MAT1-1, while eight strains (32%) displayed MAT1-2 (X2 = 3.31, df = 1, p = 0.0687), and in region IV, 39 of 56 strains (70%) exhibited MAT1-1, with 17 strains (30%) showing MAT1-2 (X2 = 8.64, df = 1, p = 0.003) (Figure 2). Although no significant difference was observed in region I, a clear trend favoring MAT1-1 was noted in both regions, with the overall population showing a strong predominance of MAT1-1 (X2 = 11.86, df = 1, p < 0.001) (Table 1).
During the eight agricultural seasons, the years 2012/13 and 2020/21 stand out as showing the highest number of recorded strains, with 31 and 21 strains, respectively. In both seasons, most strains were of the MAT1-1 type, accounting for 71% (22) in 2012/13 (p = 0.019) and 90% (19) in 2020/21 (p < 0.001) (Table 1). This indicates a clear trend towards the dominance of this idiomorph. Throughout the intervening years, apparent fluctuations were observed in the prevalence of idiomorphs, with some years showing a predominance of MAT1-1 and others MAT1-2. However, these fluctuations were not significant and may not accurately reflect the actual trends in the strain population due to the small sample sizes.
Both MAT1-1 and MAT1-2 idiomorphs included strains with varying aflatoxigenic potential. Among the MAT1-1 isolates, 63% were non-aflatoxigenic, while 37% produced aflatoxins. While no significant differences were detected (p = 0.128) within this group, the data suggest a tendency toward a higher frequency of non-aflatoxigenic strains. In contrast, MAT1-2 strains displayed a marked dominance of aflatoxin producers, with 82% being toxigenic and 18% non-aflatoxigenic (p = 0.035) (Figure 3). Previous results were not changed when the statistical analysis included strains with unknown aflatoxin-producing ability.
Regarding sclerotia characteristics, 69% of the MAT1-1 strains were non-producers, 31% produced L-type sclerotia, and none produced S-type sclerotia (p = 0.043). In contrast, the MAT1-2 idiomorph consisted mostly of S strains (48%), followed by 35% non-producers, and 17% L-type sclerotia producers (p = 0.041) (Table 2). Including isolates for which this characteristic was unknown (19 out of 81) did not affect the overall results.
All isolates in groups AM1, AM4, AM5, and AM6 were MAT1-1. The single isolate in AM3 was MAT1-2, while the two isolates in AM2 represented both idiomorphs (one MAT1-1 and one MAT1-2). A significant association was observed between vegetative compatibility groups and mating type idiomorphs (p = 0.013), with notable alignment patterns across groups (Figure 4).

4. Discussion

4.1. Regions

In both regions I and IV [39], around 70% of the strains of Aspergillus flavus were of the MAT1-1 type. These findings are consistent with previous studies of A. flavus in Córdoba (region IV), such as that of Moore et al. [10], which reported a high presence of MAT1-1 in peanut fields, and that of Alaniz Zanon et al. [40], who registered 100% MAT1-1 in non-aflatoxigenic strains collected from soil and maize kernels. These studies reported the stability of A. flavus asexual reproduction in the two regions studied, one subtropical and the other temperate. Likewise, a predominance of MAT1-1 has been observed in other parts of the world, as in India and Benin [10], and in the United States (Arizona and Texas) [27].
Conversely, several regions have shown a predominance of MAT1-2 strains, as in Australia [10], and in Kenya, where a higher frequency was found in Nandi (75%) than in Makueni (54.17%) [28].
In contrast, some regions have a balanced ratio of MAT1-1 and MAT1-2 strains, as in Iran [15], or in the United States, in California, Louisiana, Georgia, and South Carolina [26,29,30].
In heterothallic fungi like A. flavus, if the ratio deviates from the typical 1:1 of sexual reproduction, it suggests a preponderance of asexual reproduction [9,13,37]. Due to the remarkable prevalence of MAT1-1 over MAT1-2 in Argentina, and agreeing with Moore et al. [10] from a biological control perspective, using MAT1-1 strains could maintain population stability and prevent the generation of new profiles [20].

4.2. Season

Regarding the stability of mating type ratios over time, MAT1-1 predominated in both the 2012/13 and 2020/21 seasons, separated by 8 years. This pattern underscores the strong and persistent presence of MAT1-1. Apparent variations in the prevalence of MAT1-1 and MAT1-2 were observed in other seasons, likely due to the limited sample sizes rather than to true shifts in population dynamics. Similarly, Lewis et al. [29] found MAT1-1 to be the most frequent mating type over two consecutive seasons in Georgia and South Carolina, and Grubisha and Cotty [27] found no evidence of gene flow or sexual recombination among A. flavus strains studied in Arizona and Texas over a four-year period, suggesting stability in the mating type proportions in these regions.
In contrast, Ortega-Beltran et al. [41] detected variations in the population structure of A. flavus, indicating that the proportion of mating types may fluctuate over time. Notable cases were recorded in Alabama, where Lewis et al. [29] revealed that MAT1-1 predominated in 2012 but was replaced by MAT1-2 in 2013, and in Guatemala, where the 90% predominance of MAT1-2 in 2021 was reduced to 50% in 2023 [31], demonstrating the possibility of significant changes in the proportion of mating types in a short period.
These findings emphasize the importance of considering the temporal stability or fluctuations in A. flavus mating types, as this knowledge and understanding the causes can be useful in developing and improving biocontrol strategies. Variations in MAT ratios can influence genetic diversity, recombination, and aflatoxin production, which affects the long-term success of these strategies. Monitoring these dynamics aids in selecting appropriate strains and refining management tactics for more effective control.

4.3. Toxicity

There is no clear pattern in how aflatoxigenicity relates to the mating type in A. flavus. In Argentina, Alaniz Zanon et al. [40] analyzed non-aflatoxigenic strains from soil and maize grains during the 2015/16 season, finding that all belonged to MAT1-1. Our findings extend this observation by including isolates from maize ears, showing that both MAT types contain aflatoxigenic and non-aflatoxigenic individuals. This suggests that the ability to produce aflatoxins and the potential for selecting biocontrol agents are not limited to a single mating type.
Weaver et al. [23] documented that, in maize highly contaminated with aflatoxins, MAT1-1 strains were associated with increased contamination, although MAT1-2 strains made up 55% of the isolates in their study. They suggested that, while most maize samples in the U.S. might consist primarily of MAT1-2 strains, aflatoxin contamination tends to increase the frequency of MAT1-1 genotypes. In contrast, our study shows the opposite trend: most strains were MAT1-1, of which 92% were non-aflatoxigenic, while a higher proportion of MAT1-2 strains were aflatoxigenic.
Biocontrol strains developed in various regions of the world belong to different idiomorphs. For instance, the commercial Italian strain A2085 and the U.S. strains NRRL21882, K49, and AF36 are MAT1-2, supporting the potential of this mating type in managing A. flavus [17,42,43,44]. On the other hand, the Aflasafe product developed in Nigeria includes four strains, two of each mating type [45]. This suggests that management strategies of A. flavus have been adapted to specific agricultural conditions.
Our study expands the potential for identifying native biocontrol agents with MAT1-2, should it be necessary to develop a product containing this mating type. However, it is important to note that most identified strains are MAT1-1, with many being non-aflatoxigenic. This highlights their great potential for biocontrol and suggests that these strains could play a key role in managing A. flavus in Argentina.

4.4. Sclerotia

Generally, S morphotypes are associated with high aflatoxin production, while L morphotypes present variability in their toxigenic capacity [46,47,48]. In this study, type S sclerotia showed a strong relationship with MAT1-2 idiomorphs, which aligns with global reports, as most of our MAT1-2 strains were aflatoxigenic.
In biocontrol strategies, A. flavus conidia have been widely used for their mass production capacity and their efficacy in competing with toxigenic strains in the field [49,50]. Recent studies suggest that non-aflatoxigenic strains with fertile sclerotia could contribute to the reduction in aflatoxin levels in crops through sexual recombination with native populations [16,17]. In this context, most strains isolated from maize ears in this study, particularly MAT1-1 strains, did not produce sclerotia, limiting the chances of finding competitors with this trait. It is important to consider that the genetic structure of local populations of A. flavus in the soil influences the effectiveness of biocontrol [51]. However, significant differences have been highlighted between A. flavus populations in soil and on the cob [30,52] suggesting that the effectiveness of biocontrol strategies could vary depending on the specific agricultural environment.
In contrast to MAT1-1 strains, most MAT1-2 strains produced sclerotia, and all S strains were restricted to this type of mating. This differs from the reports of Hua et al. [26] and Chang [45], who reported that strains with this sclerotium size can present either of the two idiomorphs. This difference is relevant to understanding the dynamics of reproduction and its impact on biocontrol strategies.
The use of MAT1-2 atoxigenic strains for biocontrol represents a promising strategy to prevent undesired sexual crosses. These strains are incapable of mating with other MAT1-2 strains, which, in our population, are linked to S-type sclerotia and high aflatoxin production, thus reducing the risk of progeny with unfavorable traits. However, their application may increase the likelihood of crossing with MAT1-1 strains, where aflatoxigenic isolates can also be found. On the other hand, MAT1-1 atoxigenic strains, which do not produce sclerotia, have conidia production, which has a high dispersal capacity. Since these are abundant in natural populations, their application would not alter their predominance and would thus preserve the natural structure of the population, making them strong candidates for biological control.

4.5. Vegetative Compatibility Groups

In this study, a predominance of the MAT1-1 mating type was identified among the vegetative compatibility groups (VCGs) analyzed. Only one group corresponded to the MAT1-2 mating type (AM3). This finding aligns with the higher frequency of MAT1-1 reported in A. flavus strains collected in Arizona and Texas, which belonged to three VCGs [27]. On the other hand, Grubisha and Cotty [42] reported that the commercial strains K49 and AF36, as well as all the strains of their VCGs, were exclusively MAT1-2. Similarly, Hua et al. [26] found that all the strains within each of their 26 VCGs belonged to the same type of mating. These studies reinforce the notion that, within the same VCG, all strains share the same type of mating, which is consistent with five of the six vegetative compatibility groups analyzed in our study.
The identification of strains with opposite mating types belonging to the same VCG has been previously reported by Sweany et al. [30], who identified this situation in 1 of their 15 VCGs. Likewise, Ortega-Beltran et al. [41] discovered, when analyzing the genetic diversity of a VCG, that it contained two groups of strains with opposite mating types, concluding that mating types do not function as vegetative compatibility genes in the same way as in other fungi. They suggested that sexual reproduction between the strains of this VCG may have been lost or strongly restricted.

5. Conclusions

The relationship of the two mating types with the characteristics of toxicity, sclerotia, and VCGs has important implications for the management and control of A. flavus in each environment. In regions where a specific type of MAT predominates, the use of biocontrol strains of the same idiomorph may be an effective strategy to reduce aflatoxin production [10]. This baseline study on the mating type of A. flavus in Argentina is a key step in understanding the behavior of this fungus in local contexts. The predominance of MAT1-1 strains suggests the potential of this mating type for biocontrol to maintain population stability and minimize the generation of new toxigenic profiles. The monitoring of A. flavus population structure in future crop seasons will enhance the robustness of the results, allowing for a more detailed examination of strain dynamics over time. Additional research is required to broaden the applicability of these findings, considering not only agricultural fields but also the transport and storage of agricultural products. This will help identify the implications and risks related to both biological control and the biological management of the problem, as A. flavus directly impacts aflatoxin production, which, in turn, affects food safety. Moreover, the phenotypic and genetic stability of the strains used in biological control need to be studied under different environmental conditions and post-harvest practices to ensure their long-term effectiveness.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy14122962/s1, Table S1: Phenotypic and genotypic characterization of Aspergillus flavus isolates in maize ears from regions I and IV during the 2012/13 to 2020/21 seasons; Table S2: Mating type (MAT) distribution by vegetative compatibility groups (VCGs).

Author Contributions

Conceptualization: B.X.C. and A.K.T.R.; methodology: A.M.R.P.; software: A.M.R.P.; validation: B.X.C., A.K.T.R. and J.M.B.; formal analysis: A.M.R.P.; investigation: A.M.R.P.; resources: A.M.R.P.; data curation: A.M.R.P.; writing—original draft preparation: A.M.R.P.; writing—review and editing: A.K.T.R.; supervision: B.X.C. and A.K.T.R.; funding acquisition: B.X.C. and A.K.T.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by CONICET: Consejo Nacional de Investigaciones Científicas y Técnicas and INTA: Instituto Nacional de Tecnología Agropecuaria, Projects INTA I120 and I073.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Materials, further inquiries can be directed to the corresponding author.

Acknowledgments

We thank Maria de la Paz Gimenez Pecci and Ricardo Comerio for their comments on this manuscript. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Abrehame, S.; Manoj, V.R.; Hailu, M.; Chen, Y.Y.; Lin, Y.C.; Chen, Y.P. Aflatoxins: Source, Detection, Clinical Features and Prevention. Processes 2023, 11, 204. [Google Scholar] [CrossRef]
  2. Abdeta, D.; Milki, S. Public Health Impact of Aflatoxin. J. Bacteriol. Mycol. Open Access 2023, 11, 34–39. [Google Scholar] [CrossRef]
  3. International Agency for Research on Cancer. International Agency for Research on Cancer Iarc Monographs on the Evaluation of Carcinogenic Risks to Humans. Iarc Monogr. Eval. Carcinog. Risks Hum. 2002, 82, 171–300. [Google Scholar]
  4. Ojiambo, P.S.; Battilani, P.; Cary, J.W.; Blum, B.H.; Carbone, I. Cultural and Genetic Approaches to Manage Aflatoxin Contamination: Recent Insights Provide Opportunities for Improved Control. Phytopathology 2018, 108, 1024–1037. [Google Scholar] [CrossRef] [PubMed]
  5. Klich, M.A. Environmental and Developmental Factors Influencing Aflatoxin Production by Aspergillus flavus and Aspergillus Parasiticus. Mycoscience 2007, 48, 71–80. [Google Scholar] [CrossRef]
  6. Giorni, P. Impact of Environmental and Plant Factors on Aspergillus Section Flavi Isolated from Maize in Italy. Ph.D. Thesis, Cranfield University, Bedford, UK, December 2007. [Google Scholar]
  7. Barros, G.G.; Torres, A.M.; Rodriguez, M.I.; Chulze, S.N. Genetic Diversity within Aspergillus flavus Strains Isolated from Peanut-Cropped Soils in Argentina. Soil Biol. Biochem. 2006, 38, 145–152. [Google Scholar] [CrossRef]
  8. Pildain, M.B. Caracterización Fenotípica y Molecular de Aspergillus Sección Flavi. Estudio de La. Genética Poblacional y Capacidad Toxigénica de Aspergillus flavus En. Maní. Master’s Thesis, Universidad de Buenos Aires, Autónoma de Buenos Aires, Argentina, 2006. [Google Scholar]
  9. Leslie, J.F.; Klein, K. Female Fertility and Mating Type Effects on Effective Population Size and Evolution in Filamentous Fungi. Genet. Soc. Am. 1996, 144, 557–567. [Google Scholar] [CrossRef]
  10. Moore, G.G.; Elliott, J.L.; Singh, R.; Horn, B.W.; Dorner, J.W.; Stone, E.A.; Chulze, S.N.; Barros, G.G.; Naik, M.K.; Wright, G.C.; et al. Sexuality Generates Diversity in the Aflatoxin Gene Cluster: Evidence on a Global Scale. PLoS Pathog. 2013, 9, e1003574. [Google Scholar] [CrossRef]
  11. Olarte, R.A.; Horn, B.W.; Dorner, J.W.; Monacell, J.T.; Singh, R.; Stone, E.A.; Carbone, I. Effect of Sexual Recombination on Population Diversity in Aflatoxin Production by Aspergillus flavus and Evidence for Cryptic Heterokaryosis. Mol. Ecol. 2012, 21, 1453–1476. [Google Scholar] [CrossRef]
  12. Conde-Ferráez, L. El Locus MAT (Mating-Type) de Los Ascomicetos: Su Evolución, Estructura y Regulación The Ascomycetes MAT Locus: Its Evolution, Structure. Rev. Iberoam. Micol. 2007, 24, 95–99. [Google Scholar] [CrossRef]
  13. Gell, R.M.; Horn, B.W.; Carbone, I. Genetic Map and Heritability of Aspergillus flavus. Fungal Genet. Biol. 2020, 144, 103478. [Google Scholar] [CrossRef] [PubMed]
  14. Moore, G.G.; Mack, B.M.; Wendt, K.L.; Anderson, V.M.; Cichewicz, R.H. Genomic and Metabolomic Diversity within a Familial Population of Aspergillus flavus. Mol. Microbiol. 2024, 121, 927–939. [Google Scholar] [CrossRef] [PubMed]
  15. Asgarivessal, M.; Mirzaei, S.; Soltani, J. Heterothallism and Sexual Reproduction in the Iranian Isolates of Aspergillus flavus. Mycol. Iran. 2023, 10, 33–44. [Google Scholar]
  16. Horn, B.W.; Gell, R.M.; Singh, R.; Sorensen, R.B.; Carbone, I. Sexual Reproduction in Aspergillus flavus Sclerotia: Acquisition of Novel Alleles from Soil Populations and Uniparental Mitochondrial Inheritance. PLoS ONE 2016, 11, e0146169. [Google Scholar] [CrossRef]
  17. Luis, J.M.; Carbone, I.; Payne, G.A.; Bhatnagar, D.; Cary, J.W.; Moore, G.G.; Lebar, M.D.; Wei, Q.; Mack, B.; Ojiambo, P.S. Characterization of Morphological Changes within Stromata during Sexual Reproduction in Aspergillus flavus. Mycologia 2020, 112, 908–920. [Google Scholar] [CrossRef]
  18. Moore, G.G. Practical Considerations Will Ensure the Continued Success of Pre-Harvest Biocontrol Using Non-Aflatoxigenic Aspergillus flavus Strains. Crit. Rev. Food Sci. Nutr. 2022, 62, 4208–4225. [Google Scholar] [CrossRef] [PubMed]
  19. Horn, B.W.; Sorensen, R.B.; Lamb, M.C.; Sobolev, V.S.; Olarte, R.A.; Worthington, C.J.; Carbone, I. Sexual Reproduction in Aspergillus flavus Sclerotia Naturally Produced in Corn. Phytopathology 2014, 104, 75–85. [Google Scholar] [CrossRef]
  20. Moore, G.G.; Singh, R.; Horn, B.W.; Carbone, I. Recombination and Lineage-Specific Gene Loss in the Aflatoxin Gene Cluster of Aspergillus flavus. Mol. Ecol. 2009, 18, 4870–4887. [Google Scholar] [CrossRef]
  21. Barontini, J.M.; Torrico, A.K.; Druetta, M.; Ruiz Posse, A.; Chulze, S.N.; de la Paz Giménez Pecci, M. A Polyphasic Study of Non-Aflatoxigenic Aspergillus flavus Link, Isolates from Maize in the Chaco Semi-Arid Region of Argentina. Rev. Fac. Ciencias Agrar. UNCuyo 2024, 56, 58–73. [Google Scholar] [CrossRef]
  22. Singh, P.; Mehl, H.L.; Orbach, M.J.; Callicott, K.; Cotty, P.J. Genetic Diversity of Aspergillus flavus Associated with Chili in Nigeria and Identification of Haplotypes with Potential in Aflatoxin Mitigation. Plant Dis. 2022, 106, 1818–1825. [Google Scholar] [CrossRef]
  23. Weaver, M.A.; Callicott, K.A.; Mehl, H.L.; Opoku, J.; Park, L.C.; Fields, K.S.; Mandel, J.R. Characterization of the Aspergillus flavus Population from Highly Aflatoxin-Contaminated Corn in the United States. Toxins 2022, 14, 755. [Google Scholar] [CrossRef] [PubMed]
  24. Camiletti, B.X.; Torrico, A.K.; Fernanda Maurino, M.; Cristos, D.; Magnoli, C.; Lucini, E.I.; de la Paz Giménez Pecci, M. Fungal Screening and Aflatoxin Production by Aspergillus Section flavi Isolated from Pre-Harvest Maize Ears Grown in Two Argentine Regions. Crop. Prot. 2017, 92, 41–48. [Google Scholar] [CrossRef]
  25. Atehnkeng, J.; Donner, M.; Peter, S.; Ikotun, B.; Augusto, J.; Cotty, P.J.; Bandyopadhyay, R. Environmental Distribution and Genetic Diversity of Vegetative Compatibility Groups Determine Biocontrol Strategies to Mitigate Aflatoxin Contamination of Maize by Aspergillus flavus. Microb. Biotechnol. 2015, 9, 75–88. [Google Scholar] [CrossRef] [PubMed]
  26. Hua, S.S.T.; McAlpin, C.E.; Chang, P.K.; Sarreal, S.B.L. Characterization of Aflatoxigenic and Non-Aflatoxigenic Aspergillus flavus Isolates from Pistachio. Mycotoxin Res. 2012, 28, 67–75. [Google Scholar] [CrossRef]
  27. Grubisha, L.C.; Cotty, P.J. Genetic Isolation among Sympatric Vegetative Compatibility Groups of the Aflatoxin-Producing Fungus Aspergillus flavus. Mol. Ecol. 2010, 19, 269–280. [Google Scholar] [CrossRef]
  28. Abigael, O.; Sheila, O.; Nelson, A.; Joutsjoki, V. Characterization of Mating Type Genes in Aspergillus flavus Populations from Two Locations in Kenya. Adv. Agric. 2018, 2018, 7–9. [Google Scholar] [CrossRef]
  29. Lewis, M.H.; Carbone, I.; Luis, J.M.; Payne, G.A.; Bowen, K.L.; Hagan, A.K.; Kemerait, R.; Heiniger, R.; Ojiambo, P.S. Biocontrol Strains Differentially Shift the Genetic Structure of Indigenous Soil Populations of Aspergillus flavus. Front. Microbiol. 2019, 10, 1738. [Google Scholar] [CrossRef]
  30. Sweany, R.R.; Damann, K.E.; Kaller, M.D. Comparison of Soil and Corn Kernel Aspergillus flavus Populations: Evidence for Niche Specialization. Phytopathology 2011, 101, 952–959. [Google Scholar] [CrossRef]
  31. Weaver, M.A.; Bowen, C.; Park, L.C.; Bastidas, A.; Drewry, S.G.; Mandel, J.R. Genetic Diversity of Aspergillus flavus on Maize in Guatemala. Foods 2023, 12, 3864. [Google Scholar] [CrossRef]
  32. Camiletti, B.X.; Moral, J.; Asensio, C.M.; Torrico, A.K.; Lucini, E.I.; de la Paz Giménez Pecci, M.; Michailides, T.J. Characterization of Argentinian Endemic Aspergillus flavus Isolates and Their Potential Use as Biocontrol Agents for Mycotoxins in Maize. Phytopathology 2018, 108, 818–828. [Google Scholar] [CrossRef]
  33. Pildain, M.B.; Cabral, D.; Vaamonde, G. Poblaciones de Aspergillus flavus En Maní Cultivado En Diferentes Zonas Agroecológicas de La Argentina, Caracterización Morfológica y Toxigénica. Rev. Investig. Agropecu. 2005, 34, 3–19. [Google Scholar]
  34. Cotty, P.J. Virulence and Cultural Characteristics of Two Aspergillus flavus Strains Pathogenic on Cotton. Phytopathology 1989, 79, 808–814. [Google Scholar] [CrossRef]
  35. Moreno, J. Estudio Comparativo de Aspergillus flavus y Aspergillus Parasiticus En La Producción de Aflatoxinas Bajo Diferentes Condiciones de Humedad y Temperatura, UNAM. Master’s Thesis, Facultad de Estudios Superiores de Postgrado, Cuautitlán Izcali, Mexico, 2004. [Google Scholar]
  36. Mauro, A.; Battilani, P.; Callicott, K.A.; Giorni, P.; Pietri, A.; Cotty, P.J. Structure of an Aspergillus Flavus Population from Maize Kernels in Northern Italy. Int. J. Food Microbiol. 2013, 162, 1–7. [Google Scholar] [CrossRef]
  37. Ramirez-Prado, J.H.; Moore, G.G.; Horn, B.W.; Carbone, I. Characterization and Population Analysis of the Mating-Type Genes in Aspergillus flavus and Aspergillus Parasiticus. Fungal Genet. Biol. 2008, 45, 1292–1299. [Google Scholar] [CrossRef]
  38. Di Rienzo, J.A.; Casanoves, F.; Balzarini, M.G.; Gonzalez, L.; Tablada, M.; Robledo, C.W. InfoStat, version 2022; Centro de Transferencia InfoStat, FCA, Universidad Nacional de Córdoba: Córdoba, Argentina, 2012; Available online: http://www.infostat.com.ar (accessed on 1 July 2024).
  39. INTA. Guía Practica Para el Cultivo de Maíz; Instituto Nacional de Tecnología Agropecuaria: Buenos Aires, Argentina, 1997; p. 189. [Google Scholar]
  40. Alaniz Zanon, M.S.; Clemente, M.P.; Chulze, S.N. Characterization and Competitive Ability of Non-Aflatoxigenic Aspergillus flavus Isolated from the Maize Agro-Ecosystem in Argentina as Potential Aflatoxin Biocontrol Agents. Int. J. Food Microbiol. 2018, 277, 58–63. [Google Scholar] [CrossRef]
  41. Ortega-Beltran, A.; Callicott, K.A.; Cotty, P.J. Founder Events Influence Structures of Aspergillus flavus Populations. Environ. Microbiol. 2020, 22, 3522–3534. [Google Scholar] [CrossRef] [PubMed]
  42. Grubisha, L.C.; Cotty, P.J. Genetic Analysis of the Aspergillus flavus Vegetative Compatibility Group to Which a Biological Control Agent That Limits Aflatoxin Contamination in U.S. Crops Belongs. Appl. Environ. Microbiol. 2015, 81, 5889–5899. [Google Scholar] [CrossRef] [PubMed]
  43. Chang, P.K.; Abbas, H.K.; Weaver, M.A.; Ehrlich, K.C.; Scharfenstein, L.L.; Cotty, P.J. Identification of Genetic Defects in the Atoxigenic Biocontrol Strain Aspergillus flavus K49 Reveals the Presence of a Competitive Recombinant Group in Field Populations. Int. J. Food Microbiol. 2012, 154, 192–196. [Google Scholar] [CrossRef]
  44. Mauro, A.; Garcia-Cela, E.; Pietri, A.; Cotty, P.J.; Battilani, P. Biological Control Products for Aflatoxin Prevention in Italy: Commercial Field Evaluation of Atoxigenic Aspergillus flavus Active Ingredients. Toxins 2018, 10, 30. [Google Scholar] [CrossRef]
  45. Chang, P.K. Aspergillus flavus La3279, a Component Strain of the AflasafeTM Biocontrol Product, Contains a Partial Aflatoxin Biosynthesis Gene Cluster Followed by a Genomic Region Highly Variable among A. flavus Isolates. Int. J. Food Microbiol. 2022, 366, 109559. [Google Scholar] [CrossRef]
  46. Barontini, J.M. Aislados De Espigas De Maíz En Santiago Del Estero Y Regiones Colindantes. Ph.D. Thesis, Instituto Nacional de Tecnología Agropecuaria, Buenos Aires, Argentina, 2022. [Google Scholar]
  47. Singh, P.; Cotty, P.J. Characterization of Aspergilli from Dried Red Chilies (Capsicum spp.): Insights into the Etiology of Aflatoxin Contamination. Int. J. Food Microbiol. 2019, 289, 145–153. [Google Scholar] [CrossRef] [PubMed]
  48. Probst, C.; Bandyopadhyay, R.; Cotty, P.J. Diversity of Aflatoxin-Producing Fungi and Their Impact on Food Safety in Sub-Saharan Africa. Int. J. Food Microbiol. 2014, 174, 113–122. [Google Scholar] [CrossRef] [PubMed]
  49. Dorner, J.W. Biological Control of Aflatoxin Contamination in Corn Using a Nontoxigenic Strain of Aspergillus flavus. J. Food Prot. 2009, 72, 801–804. [Google Scholar] [CrossRef] [PubMed]
  50. Moral, J.; Garcia-Lopez, M.T.; Camiletti, B.X.; Jaime, R.; Michailides, T.J.; Bandyopadhyay, R.; Ortega-Beltran, A. Present Status and Perspective on the Future Use of Aflatoxin Biocontrol Products. Agronomy 2020, 10, 491. [Google Scholar] [CrossRef]
  51. Molo, M.S.; Heiniger, R.W.; Boerema, L.; Carbone, I. Trial Summary on the Comparison of Various Non-Aflatoxigenic Strains of Aspergillus flavus on Mycotoxin Levels and Yield in Maize. Agron. J. 2019, 111, 942–946. [Google Scholar] [CrossRef]
  52. Katati, B.; Kovács, S.; Njapau, H.; Kachapulula, P.W.; Zwaan, B.J.; Van Diepeningen, A.D.; Schoustra, S.E. Maize Aspergillus Section Flavi Isolate Diversity May Be Distinct from That of Soil and Subsequently the Source of Aflatoxin Contamination. Mycotoxin Res. 2024, 40, 351–367. [Google Scholar] [CrossRef]
Figure 1. Gel electrophoresis image showing PCR products for mating type identification in fungal strains. M: molecular weight marker (100 bp). MAT1-1 = 1: AS04322. 2: AS03145. 4: AS04001. MAT1-2 = 3: AS00019. 5: ASQU16. C: control.
Figure 1. Gel electrophoresis image showing PCR products for mating type identification in fungal strains. M: molecular weight marker (100 bp). MAT1-1 = 1: AS04322. 2: AS03145. 4: AS04001. MAT1-2 = 3: AS00019. 5: ASQU16. C: control.
Agronomy 14 02962 g001
Figure 2. Distribution of the mating type of A. flavus strains in regions I and IV of Argentina.
Figure 2. Distribution of the mating type of A. flavus strains in regions I and IV of Argentina.
Agronomy 14 02962 g002
Figure 3. Distribution of the aflatoxigenic (black) or non-aflatoxigenic (gray) types, separated by the MAT genotype.
Figure 3. Distribution of the aflatoxigenic (black) or non-aflatoxigenic (gray) types, separated by the MAT genotype.
Agronomy 14 02962 g003
Figure 4. Distribution of mating type MAT1-1 and MAT1-2 among the vegetative compatibility groups (VCGs) of A. flavus. Bars represent the proportion of MAT1-1 (black) or MAT1-2 (gray) A. flavus isolates in each VCG.
Figure 4. Distribution of mating type MAT1-1 and MAT1-2 among the vegetative compatibility groups (VCGs) of A. flavus. Bars represent the proportion of MAT1-1 (black) or MAT1-2 (gray) A. flavus isolates in each VCG.
Agronomy 14 02962 g004
Table 1. Percentages of strain distribution by idiomorph according to season.
Table 1. Percentages of strain distribution by idiomorph according to season.
Idiomorph2012/13
(31)
2013/14
(5)
2014/15
(4)
2015/16
(1)
2016/17
(5)
2017/18
(7)
2018/19
(7)
2020/21
(21)
Total
(81)
MAT1-171% (22)80% (4)100% (4)0% (0)100% (5)29% (2)0% (0)90% (19)69% (56)
MAT1-229% (9)20% (1)0% (0)100% (1)0% (0)71% (5)100% (7)10% (2)31% (25)
p-value0.0190.179ndndnd0.249nd<0.001<0.001
() number of strains. nd: not determined.
Table 2. Percentages of sclerotia types by idiomorph.
Table 2. Percentages of sclerotia types by idiomorph.
IdiomorphSLNPp-Value
Mat1-10% (0)31% (12)69% (27)0.043
Mat1-248% (11)17% (4)35% (8)0.041
() number of strains.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ruiz Posse, A.M.; Torrico Ramallo, A.K.; Barontini, J.M.; Camiletti, B.X. Mating Type of Native Aspergillus flavus Strains Causing Corn Ear Rot in Argentina. Agronomy 2024, 14, 2962. https://doi.org/10.3390/agronomy14122962

AMA Style

Ruiz Posse AM, Torrico Ramallo AK, Barontini JM, Camiletti BX. Mating Type of Native Aspergillus flavus Strains Causing Corn Ear Rot in Argentina. Agronomy. 2024; 14(12):2962. https://doi.org/10.3390/agronomy14122962

Chicago/Turabian Style

Ruiz Posse, Agustina María, Ada Karina Torrico Ramallo, Javier Miguel Barontini, and Boris Xavier Camiletti. 2024. "Mating Type of Native Aspergillus flavus Strains Causing Corn Ear Rot in Argentina" Agronomy 14, no. 12: 2962. https://doi.org/10.3390/agronomy14122962

APA Style

Ruiz Posse, A. M., Torrico Ramallo, A. K., Barontini, J. M., & Camiletti, B. X. (2024). Mating Type of Native Aspergillus flavus Strains Causing Corn Ear Rot in Argentina. Agronomy, 14(12), 2962. https://doi.org/10.3390/agronomy14122962

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop