Increasing Phosphorus Application Level Alleviated Adverse Effects of Low-Temperature Stress on Antioxidant Metabolism and Carbohydrate Metabolism in Tobacco Seedlings
Abstract
1. Introduction
2. Materials and Methods
2.1. Experiment Design
2.2. Measurement of Agronomic Traits
2.3. Measurement of the Gas Exchange Parameter
2.4. Measurement of ROS
2.5. Measurement of Carbohydrate Content
2.6. RNA Extraction and Quantitative RT-PCR
2.7. Statistical Analysis
3. Results
3.1. Effects of Temperature and P Level on Agronomic Traits of Tobacco
3.2. Effects of Temperature and P Level on Gas Exchange Parameters
3.3. Effects of Temperature and P Level on ROS and MDA Contents
3.4. Effects of Temperature and P Level on Carbohydrate Content
3.5. Effects of Temperature and P Level on the Expression of Genes Related to the Antioxidant Enzyme System
3.6. Effects of Temperature and P Level on the Expression of Genes Related to Carbohydrate Metabolism
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ai, D.; Zhang, Y.; Li, Z.; Feng, W.; Zhu, J.; Chen, X.; Chang, N.; Bian, L.; Liu, Q. Modification of transplanting substrates for promotion of rapid root development in early growing period of tobacco. J. Plant Nutr. Fertil. 2024, 30, 615–626. [Google Scholar]
- Jones, J.; Terrill, T. Effects of transplant size and condition on the survival, yield, and quality of flue-cured tobacco. Tob. Sci. 1984, 2, 73–77. [Google Scholar]
- Yi, J.; Li, Y.; Dai, Z.; Jia, Z.; Pu, W.; Sun, Z.; Wang, Y.; Shen, H. Enhanced tolerance to low temperature in tobacco (Nicotiana tabacum L.) sprayed with a low-temperature-resistant agent. Exp. Agric. 2015, 51, 179–190. [Google Scholar] [CrossRef]
- Dai, X.; Zhang, Y.; Xu, X.; Ran, M.; Zhang, J.; Deng, K.; Ji, G.; Xiao, L.; Zhou, X. Transcriptome and functional analysis revealed the intervention of brassinosteroid in regulation of cold induced early flowering in tobacco. Front. Plant Sci. 2023, 14, 1136884. [Google Scholar] [CrossRef]
- Tao, X.; Yang, L.; Zhang, M.; Li, Y.; Xiao, H.; Yu, L.; Jiang, C.; Long, Z.; Zhang, Y. Shallow water seeding cultivation enhances cold tolerance in tobacco seedlings. BMC Plant Biol. 2024, 24, 698. [Google Scholar] [CrossRef] [PubMed]
- Hassan, M.A.; Xiang, C.; Farooq, M.; Muhammad, N.; Yan, Z.; Hui, X.; Yuanyuan, K.; Bruno, A.K.; Lele, Z.; Jincai, L. Cold stress in wheat: Plant acclimation responses and management strategies. Front. Plant Sci. 2021, 12, 676884. [Google Scholar] [CrossRef] [PubMed]
- Cheng, M.; Wang, Z.; Cao, Y.; Zhang, J.; Yu, H.; Wang, S.; Zhou, Z.; Hu, W. Soil drought during the development of cotton ovule destroyed the antioxidant balance of cotton pistil to hinder the ovule formation. J. Agron. Crop Sci. 2024, 210, e12695. [Google Scholar] [CrossRef]
- Zhang, J.; Cheng, M.; Cao, N.; Li, Y.; Wang, S.; Zhou, Z.; Hu, W. Drought stress and high temperature affect the antioxidant metabolism of cotton (Gossypium hirsutum L.) anthers and reduce pollen fertility. Agronomy 2023, 13, 2550. [Google Scholar] [CrossRef]
- Xu, S.; Li, Y.; Jin, H.; Guan, Y.; Zheng, Y.; Zhu, S. Responses of antioxidant enzymes to chilling stress in tobacco seedlings. Agric. Sci. China 2010, 9, 1594–1601. [Google Scholar] [CrossRef]
- Gao, Y.; Qiao, Q.; Liu, Z.; Gao, Z.; Wang, D.; Liu, C.; Xi, Y.; Fang, M.; Yu, H.; Zhang, L. Analysis of transcriptomic and metabolomic differences revealed the mechanism underlying the tobacco response to low-temperature. Environ. Exp. Bot. 2024, 217, 105576. [Google Scholar] [CrossRef]
- Xu, H.; Hou, K.; Fang, H.; Liu, Q.-Q.; Wu, Q.; Lin, F.-F.; Deng, R.; Zhang, L.-J.; Chen, X.; Li, J.-C. Twice-split phosphorus application alleviates low-temperature impacts on wheat by improved spikelet development and setting. J. Integr. Agric. 2023, 22, 3667–3680. [Google Scholar] [CrossRef]
- Hu, W.; Loka, D.A.; Yang, Y.; Wu, Z.; Wang, J.; Liu, L.; Wang, S.; Zhou, Z. Partial root-zone drying irrigation improves intrinsic water-use efficiency and maintains high photosynthesis by uncoupling stomatal and mesophyll conductance in cotton leaves. Plant Cell Environ. 2024, 47, 3147–3165. [Google Scholar] [CrossRef] [PubMed]
- Liao, R.; Liu, Z.; Dongchen, W.; Deng, X.; Ma, E.; Manzoor, N.; Lin, C.; Zhou, S.; Tong, W.; Zhou, M.; et al. Integrated metabolomic and metagenomic strategies shed light on interactions among planting environments, rhizosphere microbiota, and metabolites of tobacco in Yunnan, China. Front. Microbiol. 2024, 15, 1386150. [Google Scholar] [CrossRef]
- Ouyang, L.; Leus, L.; De Keyser, E.; Van Labeke, M.-C. Seasonal changes in cold hardiness and carbohydrate metabolism in four garden rose cultivars. J. Plant Physiol. 2019, 232, 188–199. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Loka, D.A.; Wang, J.; Ran, Y.; Shao, C.; Tuersun, G.; Li, Y.; Wang, S.; Zhou, Z.; Hu, W. Co-occurring elevated temperature and drought stress inhibit cotton pollen fertility by disturbing anther carbohydrate and energy metabolism. Ind. Crops Prod. 2024, 208, 117894. [Google Scholar] [CrossRef]
- Nguyen-Quoc, B.; Foyer, C.H. A role for ‘futile cycles’ involving invertase and sucrose synthase in sucrose metabolism of tomato fruit. J. Exp. Bot. 2001, 52, 881–889. [Google Scholar] [CrossRef]
- Elsayed, A.I.; Rafudeen, M.S.; Golldack, D.; Weber, A. Physiological aspects of raffinose family oligosaccharides in plants: Protection against abiotic stress. Plant Biol. 2014, 16, 1–8. [Google Scholar] [CrossRef]
- Hu, W.; Liu, Y.; Loka, D.A.; Zahoor, R.; Wang, S.; Zhou, Z. Drought limits pollen tube growth rate by altering carbohydrate metabolism in cotton (Gossypium hirsutum) pistils. Plant Sci. 2019, 286, 108–117. [Google Scholar] [CrossRef] [PubMed]
- Hammond, J.B.; Burton, K.S. Leaf starch metabolism during the growth of pepper (Capsicum annuum) plants. Plant Physiol. 1983, 73, 61–65. [Google Scholar] [CrossRef]
- Zhang, W.; Wang, J.; Huang, Z.; Mi, L.; Jiang, D. Effects of low temperature at booting stage on sucrose metabolism and endogenous hormone contents in winter wheat spikelet. Front. Plant Sci. 2019, 10, 498. [Google Scholar] [CrossRef]
- Shu, H.; Zhou, Z.; Xu, N.; Wang, Y.; Zheng, M. Sucrose metabolism in cotton (Gossypium hirsutum L.) fibre under low temperature during fibre development. Eur. J. Agron. 2009, 31, 61–68. [Google Scholar] [CrossRef]
- Sharma, K.D.; Patil, G.; Kiran, A. Characterization and differential expression of sucrose and starch metabolism genes in contrasting chickpea (Cicer arietinum L.) genotypes under low temperature. J. Genet. 2021, 100, 71. [Google Scholar] [CrossRef]
- Zhou, P.; Khan, R.; Li, Q.; Liu, G.; Xu, N.; Yang, Y.; Wang, Y.; Wang, S.; Chen, A. Transcriptomic analyses of chilling stress responsiveness in leaves of tobacco (Nicotiana tabacum) seedlings. Plant Mol. Biol. Report. 2020, 38, 1–13. [Google Scholar] [CrossRef]
- Parks, S.E.; Haigh, A.M.; Cresswell, G.C. Stem tissue phosphorus as an index of the phosphorus status of Banksia ericifolia L. f. Plant Soil 2000, 227, 59–65. [Google Scholar] [CrossRef]
- Ahn, T.; Oke, M.; Schofield, A.; Paliyath, G. Effects of phosphorus fertilizer supplementation on antioxidant enzyme activities in tomato fruits. J. Agric. Food Chem. 2005, 53, 1539–1545. [Google Scholar] [CrossRef] [PubMed]
- Qiu, J.; Israel, D.W. Carbohydrate accumulation and utilization in soybean plants in response to altered phosphorus nutrition. Physiol. Plant. 1994, 90, 722–728. [Google Scholar] [CrossRef]
- Huang, X.; Wang, J.; Wang, Q.; Li, H.; Hu, W.; Wang, S.; Zhou, Z. Phosphorus-induced improvement of photosynthate synthesis and transport in the leaf subtending to cotton boll provided sufficient sucrose for fiber thickening during the crucial period and improved fiber bundle strength. Field Crops Res. 2024, 306, 109230. [Google Scholar] [CrossRef]
- Wasaki, J.; Shinano, T.; Onishi, K.; Yonetani, R.; Yazaki, J.; Fujii, F.; Shimbo, K.; Ishikawa, M.; Shimatani, Z.; Nagata, Y. Transcriptomic analysis indicates putative metabolic changes caused by manipulation of phosphorus availability in rice leaves. J. Exp. Bot. 2006, 57, 2049–2059. [Google Scholar] [CrossRef]
- Ariovich, D.; Cresswell, C. The effect of nitrogen and phosphorus on starch accumulation and net photosynthesis in two variants of Panicum maximum Jacq. Plant Cell Environ. 1983, 6, 657–664. [Google Scholar] [CrossRef]
- Noor, I.; Sohail, H.; Hasanuzzaman, M.; Hussain, S.; Li, G.; Liu, J. Phosphorus confers tolerance against manganese toxicity in Prunus persica by reducing oxidative stress and improving chloroplast ultrastructure. Chemosphere 2022, 291, 132999. [Google Scholar] [CrossRef]
- Xu, H.; Wu, Z.; Xu, B.; Sun, D.; Hassan, M.A.; Cai, H.; Wu, Y.; Yu, M.; Chen, A.; Li, J. Optimized phosphorus application alleviated adverse effects of short-term low-temperature stress in winter wheat by enhancing photosynthesis and improved accumulation and partitioning of dry matter. Agronomy 2022, 12, 1700. [Google Scholar] [CrossRef]
- Xu, H.; Hassan, M.A.; Sun, D.; Wu, Z.; Jiang, G.; Liu, B.; Ni, Q.; Yang, W.; Fang, H.; Li, J. Effects of low temperature stress on source–sink organs in wheat and phosphorus mitigation strategies. Front. Plant Sci. 2022, 13, 807844. [Google Scholar] [CrossRef]
- Wang, T.; Song, J.; Yan, S.; Li, C. Growth and development of olive under low temperature stress influenced by phosphate fertilizer application. J. Plant Nutr. Fertil. 2020, 26, 879–890. [Google Scholar]
- Wang, Y.; Sun, Z.; Wang, Q.; Xie, J.; Yu, L. Transcriptomics and metabolomics revealed that phosphate improves the cold tolerance of alfalfa. Front. Plant Sci. 2023, 14, 1100601. [Google Scholar] [CrossRef] [PubMed]
- Soudek, P.; Kufner, D.; Petrova, S.; Mihaljevic, M.; Vanek, T.J.C. Composition of hydroponic medium affects thorium uptake by tobacco plants. Chemosphere 2013, 92, 1090–1098. [Google Scholar] [CrossRef]
- Gu, K.; Hou, S.; Chen, J.; Guo, J.; Wang, F.; He, C.; Zou, C.; Xie, X. The physiological response of different tobacco varieties to chilling stress during the vigorous growing period. Sci. Rep. 2021, 11, 22136. [Google Scholar] [CrossRef]
- Yang, Y.; Yang, X.; Dai, K.; He, S.; Zhao, W.; Wang, S.; Zhou, Z.; Hu, W. Nanoceria-induced variations in leaf anatomy and cell wall composition drive the increase in mesophyll conductance of salt-stressed cotton leaves. Plant Physiol. Biochem. 2024, 216, 109111. [Google Scholar] [CrossRef]
- Zhang, S.; Han, S.; Yang, W.; Wei, H.; Zhang, M.; Qi, L. Changes in H2O2 content and antioxidant enzyme gene expression during the somatic embryogenesis of Larix leptolepis. Plant Cell Tissue Organ Cult. 2010, 100, 21–29. [Google Scholar] [CrossRef]
- Hu, W.; Lv, X.; Yang, J.; Chen, B.; Zhao, W.; Meng, Y.; Wang, Y.; Zhou, Z.; Oosterhuis, D.M. Effects of potassium deficiency on antioxidant metabolism related to leaf senescence in cotton (Gossypium hirsutum L.). Field Crops Res. 2016, 191, 139–149. [Google Scholar] [CrossRef]
- Hu, W.; Loka, D.A.; Fitzsimons, T.R.; Zhou, Z.; Oosterhuis, D.M. Potassium deficiency limits reproductive success by altering carbohydrate and protein balances in cotton (Gossypium hirsutum L.). Environ. Exp. Bot. 2018, 145, 87–94. [Google Scholar] [CrossRef]
- Yu, H.; Luo, Y.; Cao, N.; Wang, S.; Zhou, Z.; Hu, W. Drought-induced cell wall degradation in the base of pedicel is associated with accelerated cotton square shedding. Plant Physiol. Biochem. 2024, 214, 108894. [Google Scholar] [CrossRef] [PubMed]
- Fang, H.; Huang, J.; Zhu, X.; Hassan, M.A.; Ren, J.; Huang, J.; Zheng, B.; Chen, X.; Lin, F.; Li, J. Postponed application of phosphorus and potassium fertilizers mitigates the damage of late spring coldness by Improving winter wheat root physiology. Plants 2024, 13, 2311. [Google Scholar] [CrossRef] [PubMed]
- Hu, W.; Jiang, N.; Yang, J.; Meng, Y.; Wang, Y.; Chen, B.; Zhao, W.; Oosterhuis, D.M.; Zhou, Z. Potassium (K) supply affects K accumulation and photosynthetic physiology in two cotton (Gossypium hirsutum L.) cultivars with different K sensitivities. Field Crops Res. 2016, 196, 51–63. [Google Scholar] [CrossRef]
- Huner, N.P.; Öquist, G.; Hurry, V.M.; Krol, M.; Falk, S.; Griffith, M. Photosynthesis, photoinhibition and low temperature acclimation in cold tolerant plants. Photosynth. Res. 1993, 37, 19–39. [Google Scholar] [CrossRef]
- Van Heerden, P.; Kruger, G. Photosynthetic limitation in soybean during cold stress. S. Afr. J. Sci. 2000, 96, 201–206. [Google Scholar]
- Khan, F.; Siddique, A.B.; Shabala, S.; Zhou, M.; Zhao, C. Phosphorus plays key roles in regulating plants’ physiological responses to abiotic stresses. Plants 2023, 12, 2861. [Google Scholar] [CrossRef] [PubMed]
- Singh, S.; Reddy, V.; Fleisher, D.; Timlin, D. Interactive effects of temperature and phosphorus nutrition on soybean: Leaf photosynthesis, chlorophyll fluorescence, and nutrient efficiency. Photosynthetica 2019, 57, 248–257. [Google Scholar] [CrossRef]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef]
- Valizadeh-Kamran, R.; Toorchi, M.; Mogadam, M.; Mohammadi, H.; Pessarakli, M. Effects of freeze and cold stress on certain physiological and biochemical traits in sensitive and tolerant barley (Hordeum vulgare) genotypes. J. Plant Nutr. 2018, 41, 102–111. [Google Scholar] [CrossRef]
- Liu, W.; Yu, K.; He, T.; Li, F.; Zhang, D.; Liu, J. The low temperature induced physiological responses of Avena nuda L., a cold-tolerant plant species. Sci. World J. 2013, 2013, 658793. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Parvin, K.; Bardhan, K.; Nahar, K.; Anee, T.I.; Masud, A.A.C.; Fotopoulos, V. Biostimulants for the regulation of reactive oxygen species metabolism in plants under abiotic stress. Cells 2021, 10, 2537. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Zhang, Y.; Cong, B. Physiological and antioxidant activities of phosphate fertilizers on alfalfa roots under freezing stress. J. Northwest A F Univ. 2021, 49, 58–66. [Google Scholar]
- Hu, W.; Yang, J.; Meng, Y.; Wang, Y.; Chen, B.; Zhao, W.; Oosterhuis, D.M.; Zhou, Z. Potassium application affects carbohydrate metabolism in the leaf subtending the cotton (Gossypium hirsutum L.) boll and its relationship with boll biomass. Field Crops Res. 2015, 179, 120–131. [Google Scholar] [CrossRef]
- Meng, F.; Hu, L.; Wang, S.; Sui, X.; Wei, L.; Wei, Y.; Sun, J.; Zhang, Z. Effects of exogenous abscisic acid (ABA) on cucumber seedling leaf carbohydrate metabolism under low temperature. Plant Growth Regul. 2008, 56, 233–244. [Google Scholar] [CrossRef]
- Zhang, W.; Zhang, A.; Zhou, Q.; Fang, R.; Zhao, Y.; Li, Z.; Zhao, J.; Zhao, M.; Ma, S.; Fan, Y. Low-temperature at booting reduces starch content and yield of wheat by affecting dry matter transportation and starch synthesis. Front. Plant Sci. 2023, 14, 1207518. [Google Scholar] [CrossRef] [PubMed]
- Singh, S.K.; Reddy, V.R.; Fleisher, D.H.; Timlin, D.J. Phosphorus nutrition affects temperature response of soybean growth and canopy photosynthesis. Front. Plant Sci. 2018, 9, 1116. [Google Scholar] [CrossRef] [PubMed]
- Zia, M.S.; Salim, M.; Aslam, M.; Gill, M.A.; Rahmatullah. Effect of low temperature of irrigation water on rice growth and nutrient uptake. J. Agron. Crop Sci. 1994, 173, 22–31. [Google Scholar] [CrossRef]
- Borling, K.; Otabbong, E.; Barberis, E. Phosphorus sorption in relation to soil properties in some cultivated Swedish soils. Nutr. Cycl. Agroecosyst. 2001, 59, 39–46. [Google Scholar] [CrossRef]
- Liu, L.; Zheng, X.; Wei, X.; Kai, Z.; Xu, Y. Excessive application of chemical fertilizer and organophosphorus pesticides induced total phosphorus loss from planting causing surface water eutrophication. Sci. Rep. 2021, 11, 23015. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
NtSOD | GACGGACCTTAGCAACAGG | CTGTAAGTAGTATGCATGTTC |
NtPOD | CTCCATTTCCATGACTGCTTTG | GTTGGGTGGTGAGGTCTTT |
NtCAT | CACCTTACCTGTGCTGATTTC | CTGGTGTAGAACTTGACAGC |
NtSuSy | CTCAACATCACCCCTCGAAT | ACCAGGGGAAACAATGTTGA |
NtCWINV | CTTACACCCAATTACCGGCG | GACACTCTTTTGGGTCGTCG |
NtNINV | TTATCCTGCTCTTGAGGGCC | GAGCAAAGTTGGCCAGGATC |
NtADP | AGCAAAGACGTGATGTTAAACC | TCTTCACATTGTCCCCTATACG |
NtSSS | TGAGTTCAGGTGGTCTTGTCTTTGG | AATAGCCCTTATGCGTCGATGATGG |
NtGBSS | AACAGCTCGAAGTGTTGTA | ATCTGCTTGGAACCAACATAA |
α-amylase | ATATTGCAGGCCTTCAACTGGG | TGGAAGGTAACCTTCAGGAGACAA |
β-amylase | TGAGCTATTGGAAATGGCGAAGA | AAGAGGGATCGTGCAGGAATCA |
Nttubulin | GCATCTTTGCGTACACTTTGCT | ACATAAGCCCAAAACTAGCTGGA |
Temperature | P Level (mM L−1) | Plant Height (cm) | Stem Diameter (mm) | Shoot Biomass (g) | Root Biomass (g) |
---|---|---|---|---|---|
Control temperature | P1 | 19.08 a 1 | 3.07 a | 0.67 b | 0.063 a |
P2 | 18.98 a | 3.27 a | 0.69 b | 0.066 a | |
P3 | 18.78 a | 2.91 a | 0.74 a | 0.073 a | |
Low temperature | P1 | 11.64 b | 2.27 b | 0.50 b | 0.052 b |
P2 | 16.88 a | 3.14 a | 0.64 a | 0.059 ab | |
P3 | 15.25 a | 2.85 ab | 0.65 a | 0.067 a | |
Significance of factors | |||||
Temperature | ** 2 | * | ** | * | |
P level | * | ns | ** | ns | |
Temperature × P level | * | ns | * | ns |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, W.; Liu, Q.; Wang, Y.; Wu, Z. Increasing Phosphorus Application Level Alleviated Adverse Effects of Low-Temperature Stress on Antioxidant Metabolism and Carbohydrate Metabolism in Tobacco Seedlings. Agronomy 2024, 14, 2902. https://doi.org/10.3390/agronomy14122902
Xu W, Liu Q, Wang Y, Wu Z. Increasing Phosphorus Application Level Alleviated Adverse Effects of Low-Temperature Stress on Antioxidant Metabolism and Carbohydrate Metabolism in Tobacco Seedlings. Agronomy. 2024; 14(12):2902. https://doi.org/10.3390/agronomy14122902
Chicago/Turabian StyleXu, Wenzheng, Qiaozhen Liu, Youhua Wang, and Zhaohui Wu. 2024. "Increasing Phosphorus Application Level Alleviated Adverse Effects of Low-Temperature Stress on Antioxidant Metabolism and Carbohydrate Metabolism in Tobacco Seedlings" Agronomy 14, no. 12: 2902. https://doi.org/10.3390/agronomy14122902
APA StyleXu, W., Liu, Q., Wang, Y., & Wu, Z. (2024). Increasing Phosphorus Application Level Alleviated Adverse Effects of Low-Temperature Stress on Antioxidant Metabolism and Carbohydrate Metabolism in Tobacco Seedlings. Agronomy, 14(12), 2902. https://doi.org/10.3390/agronomy14122902