Next Article in Journal
The Formation of Rice Tillers and Factors Influencing It
Previous Article in Journal
Seed Priming: Molecular and Physiological Mechanisms Underlying Biotic and Abiotic Stress Tolerance
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Increasing Phosphorus Application Level Alleviated Adverse Effects of Low-Temperature Stress on Antioxidant Metabolism and Carbohydrate Metabolism in Tobacco Seedlings

1
Institute of Tobacco Research, Henan Academy of Agricultural Sciences, Xuchang 461000, China
2
Key Laboratory of Crop Physiology Ecology and Production Management, Ministry of Agriculture, Nanjing Agricultural University, Nanjing 210000, China
*
Author to whom correspondence should be addressed.
Agronomy 2024, 14(12), 2902; https://doi.org/10.3390/agronomy14122902
Submission received: 23 October 2024 / Revised: 23 November 2024 / Accepted: 30 November 2024 / Published: 5 December 2024

Abstract

Low temperature, as a major abiotic stress, impacts the formation of high-quality tobacco seedlings. It is urgent to take appropriate measures to improve the low-temperature tolerance of tobacco seedlings. A hydroponics experiment was conducted with a tobacco cv. Y2001 under 25 °C (control temperature) and 10 °C (low-temperature stress). Three phosphorus (P) levels including the traditional P concentration (2 mM PO43−) and higher P levels (3 mM PO43− and 4 mM PO43−) were applied to investigate their effects on antioxidant metabolism and carbohydrate metabolism in low-temperature-stressed tobacco seedlings. The results showed that the low temperature decreased plant height, stem diameter, and biomass of shoots and roots, while the higher P levels promoted plant height and shoot biomass of low-temperature-stressed tobacco seedlings compared to the traditional P level. The leaf net photosynthetic rate (AN) was decreased by the low temperature, while the AN of low-temperature-stressed tobacco leaves was increased by 38.6–61.3% for the higher P levels than the traditional P level. Higher O2 and H2O2 were observed in tobacco leaves exposed to low-temperature stress, damaging the AN, although the low temperature upregulated the expression of encoding superoxide dismutase (NtSOD), peroxidase (NtPOD), and catalase (NtCAT). However, compared with the traditional P level, the higher P levels further upregulated the expression of NtSOD and NtCAT in low-temperature-stressed tobacco leaves to accelerate O2 and H2O2 removal. Higher leaf sucrose content was detected since the low temperature significantly downregulated the expression of NtSuSy, NtCWINV, and NtNINV encoding sucrose synthase, the cell wall, and alkaline invertases, respectively, inhibiting sucrose hydrolysis. Compared with the traditional P level, higher P levels downregulated the expression of NtCWINV in low-temperature-stressed tobacco leaves, further promoting leaf sucrose content. The low temperature downregulated the expression of NtAGP encoding ADP-glucose pyrophosphorylase, NtSSS encoding soluble starch synthase, and NtGBSS encoding granule-bound starch synthase, thereby restricting starch biosynthesis. Additionally, the low temperature upregulated the expression of α-amylase and β-amylase, accelerating starch hydrolysis. These led to a lower starch content in low-temperature-stressed tobacco leaves. The higher P levels further upregulated the expression of α-amylase in low-temperature-stressed tobacco leaves than the traditional P level, further lowering the starch content. Moreover, the leaf soluble sugar content was higher under the low temperature than the control temperature, which helped the tobacco plants resist low-temperature stress. And higher P levels further promoted the soluble sugar content in low-temperature-stressed tobacco leaves compared with the traditional P level, further improving tobacco seedlings’ low-temperature tolerance. Therefore, these results indicated that increasing the P application level can alleviate the adverse impacts of cold stress on antioxidant metabolism and carbohydrate metabolism in tobacco seedlings.

1. Introduction

Tobacco (Nicotiana tabacum), as an important industrial crop, is generally cultivated by transplanting in many countries. For example, in China, the area of transplanting tobacco accounts for more than 80% of the total area of tobacco in the country [1]. During transplanting, high-quality tobacco seedlings have higher survival rates, and the condition of seedlings has a marked influence on the later tobacco yield and variety formation [2]. As a crop of tropical origin, the optimum growth temperature of tobacco is 23–28 °C. When the average temperature of the day is less than 17 °C, tobacco seedlings’ growth will be gradually inhibited [3]. However, in southern China, often, sudden cold weather, known as “spring frost”, affects the formation of high-quality seedlings and negatively affects the final yield and quality of tobacco [4]. Additionally, with climate change, extreme weather has become more frequent in recent years. Particularly, the occurrence of cold stress at the tobacco seedling stage has become more frequent [5]. Therefore, minimizing the impacts of cold stress on tobacco seedlings is urgent for tobacco production.
Low temperatures can cause a series of changes in physiological and biochemical metabolism in plants. Most obviously, the reactive oxygen species (ROS) balance is disrupted by low temperatures, causing high ROS levels [6]. To maintain ROS homeostasis and mitigate the detrimental effects of elevated ROS levels on cell membrane stability, plants have evolved sophisticated antioxidant mechanisms. Among these, the antioxidant enzyme system is the most crucial, encompassing catalase (CAT), peroxidase (POD), and superoxide dismutase (SOD) [7]. SOD can catalyze the reduction of superoxide anion (O2∙−) to produce H2O2 and O2. Then, CAT and POD can catalyze the further decomposition of H2O2 into H2O and O2 [8]. Ultimately, ROS will be transformed into non-toxic substances, avoiding oxidative toxicity to the plants. Multiple studies have reported that low-temperature stress resulted in ROS accumulation by damaging the antioxidant enzyme system with the changed activity of POD, SOD, or CAT [3,9,10]. Photosynthesis is another physiological process of crops that is sensitive to low temperatures [11]. The carbohydrates synthesized through photosynthesis are the material basis of plant survival and growth [12], although secondary metabolites, which include alkaloids, phenols, and terpenes, play an important role in the final quality formation of tobacco [13]. The normal metabolism of starch and sucrose is essential for plants to resist cold stress because the level of soluble sugars related to these metabolisms can determine the strength of plant resistance to cold [14] and hexose, the product of the breakdown of sucrose and starch, can provide a substrate for energy metabolism against adversity [15]. Sucrose can be hydrolyzed to hexose (glucose and fructose) by acid and alkaline invertases (Inv) and sucrose synthase (SuSy) [16]. Studies showed that the accumulation of sucrose content was conducive to improving the abiotic stress resistance of drought-affected plants and stabilizing yield [17]. Subsequently, glucose is converted to glucose-6-phosphate by hexokinase (HK), which can either enter the glycolysis process to produce energy [15] or be converted by phosphoglucose mutase into glucose-1-phosphate, serving as a direct substrate of starch metabolism. Then, glucose-1-phosphate is catalyzed by ADPG pyrophosphorylase (AGPase), granule-bound starch synthase (GBSSase), and soluble starch synthase (SSSase) in turn to form starch [18]. Moreover, α- and β-amylase can catalyze the breakdown of starch to form hexose [19]. Previous research found that cold stress decreases the activities of SuSy and Inv in Triticum aestivum [20] and Gossypium hirsutum [21], as well as downregulates the expression of GBSSase and β-amylase in chickpea (Cicer arietinum) [22]. For tobacco seedlings, transcriptomic and metabolomic analysis also showed that significant differences in genes or metabolites between low-temperature and normal-temperature treatments were mainly concentrated in sucrose metabolism, starch metabolism, glucose metabolism, etc. [23].
Phosphorus (P), the second most essential macronutrient for plants after nitrogen, accounts for approximately 0.5% of the total dry matter of plants [24]. P regulates many metabolic processes during plant growth, such as antioxidant and carbohydrate metabolism. Under conditions of P deficiency, P application can upregulate the activities of antioxidant enzymes (SOD, POD, and CAT). However, under conditions of sufficient P, the supplementation of P generally has no obvious effect on SOD, POD, or CAT activities [25]. Previous studies stated that the influences of P on starch and sucrose metabolism varied with species. For instance, under P deficiency, P application resulted in an increased sucrose content in soybean (Glycine max) leaves [26]. However, in cotton leaves, the application of P increased the activities of acid Inv and SuSy, promoting sucrose hydrolysis and thereby decreasing the sucrose content in leaves [27]. Under conditions of P deficiency, P application led to less starch accumulation in the leaves of rice (Oryza sativa) by inhibiting the expression of SSSase and GBSSase [28], while P supplementation led to a higher starch content in the leaves of Panicum maximum [29]. Nevertheless, under sufficient P conditions, the effects of additional P supplementation on sucrose and starch metabolism are usually not significant [27]. Moreover, multiple studies showed that additional P supplementation could improve the resistance of field crops and horticultural crops to abiotic stress [30]. However, there are few studies on P application to alleviate cold stress. Only a few recent studies showed that additional P alleviated adverse impacts of cold stress on photosynthesis and dry matter in wheat [31,32], biomass accumulation in olive trees (Olea europaea) [33], and O2∙− and H2O2 accumulation and dry matter in alfalfa (Medicago sativa) [34]. However, the specific physiological mechanisms of how P supplementation improves the growth and stress resistance of crops, especially antioxidant metabolism and carbohydrate metabolism as mentioned above, are still unclear. Furthermore, there are no reports on whether supplementary P application can promote the quality of tobacco seedlings under cold conditions, although the occurrence of cold stress at the tobacco seedling stage in production has become more frequent.
Therefore, we hypothesized that additional P supplementation can alleviate the negative influences of cold stress on tobacco seedlings by promoting ROS and carbohydrate balance. Hence, this research aimed to investigate the impacts of additional P supplementation on antioxidant metabolism and carbohydrate metabolism (substances, enzymes, or genes) in tobacco seedlings and its relationship with the growth state of tobacco seedlings under low-temperature conditions. The expected results will reveal, for the first time, the specific physiological mechanisms by which P application alleviates the effects of cold stress on tobacco seedlings, which will provide a reference for exploring the cultivation technology of high-quality tobacco seedlings under low-temperature conditions.

2. Materials and Methods

2.1. Experiment Design

The experiments were established in a greenhouse at Henan Academy of Agricultural Sciences using the tobacco cultivar Y2001, which is a major cultivated variety in production. The tobacco seeds were planted in a seedling tray in a greenhouse at a humidity of 75%, a temperature of 25 °C, and a photosynthetic photon flux density (PPFD) of 20,000 LX for 14 h each day. At the two-true leaf stage, seedlings of uniform size were transplanted into hydroponic transit tanks containing three different P levels: 2 mM PO43− (P1), the traditional P concentration for tobacco seedling growth in Hoagland nutrient solution [35], 3 mM PO43− (P2), and 4 mM PO43− (P3). The concentrations of 3 mM PO43− and 4 mM PO43− were informed by preliminary experiments (unpublished data). At the three-true leaf stage, the hydroponic transit tanks under each P level were evenly divided into two groups, which were then placed in two greenhouses with different temperatures, 25 °C (control temperature) and 10 °C (low-temperature stress), according to Gu et al. [36]. The temperature experiment lasted for 7 days. Then, the agronomic traits of the plants were measured, and the latest fully developed leaves in the main stem in each treatment were used for the assay of gas exchange parameters. Subsequently, these leaves were sampled and preserved at −80 °C for the physiological and biochemical assay.

2.2. Measurement of Agronomic Traits

The plant height and stem diameter were recorded. The plants were separated into aboveground and underground parts before being heated at 105 °C for 15 min. Following this, the samples were heated at 70 °C until they reached a constant weight, and the weight was recorded.

2.3. Measurement of the Gas Exchange Parameter

Li-6400 (Li-COR, Lincoln, NE, USA) equipment was utilized to analyze the net photosynthetic rate (AN), stomatal conductance (gs), intercellular CO2 concentration (Ci), and transpiration rate (Tr) according to Yang et al. [37].

2.4. Measurement of ROS

The O2∙− content was assayed according to Zhang et al. [38]. After the O2 mixture underwent one centrifugation at 10,000× g for 10 min, the supernatant was retained for the subsequent assay of O2∙− utilizing the hydroxylamine oxidation technique.
The assay of H2O2 content referred to Zhang et al. [38]. Fresh tissues (0.2 g) were ground with 1.5 mL acetone before centrifugation for 10 min at 10,000× g. Then, 0.1 mL Ti2SO4 (5%), 1 mL supernatant, and 0.2 mL NH4OH were mixed before centrifugation as above described. The precipitate was thoroughly washed using acetone until it became colorless. Then, the precipitate was dissolved using 2 N H2SO4 before the absorbance was measured at 415 nm. Compared with the H2O2 standard curve, the H2O2 content was estimated.
The MDA (malondialdehyde) level referred to the report by Hu et al. [39]. Fresh leaves (0.2 g) and 2 mL trichloroacetic acid (8%) solution were ground before being centrifuged for 12 min at 10,000× g. Then, 7 mL of 0.6% thiobarbituric acid and 2 mL of the supernatant were boiled for 15 min before being centrifugation as above described. Then, after cooling, the A450, A532, and A600 were detected.

2.5. Measurement of Carbohydrate Content

Carbohydrate contents in the leaves were assayed as described previously [40]. Forty milligrams of dry tissue and 1 mL ethanol (80%, v/v) were heated at 80 °C, with this process being repeated three times. Then, the alcohol extracts obtained from these three extractions were pooled and quantified to a 3 mL final volume using 80% ethanol. Activated charcoal (about 30 mg) was added to the alcohol extracts before centrifugation for 15 min at 10,000× g. For glucose, fructose, and sucrose analyses, 20 μL of the extract was transported into a 96-well microtitration plate before being heated at 45 °C. Then, 20 μL distilled water was added. The samples were heated three times at 30 °C with 100 μL glucose assay reagent (Sigma-Aldrich, St. Louis, MO, USA), 10 μL phosphoglucose isomerase (0.25 U), and 10 μL invertase (83 U) for 15, 15, and 60 min, respectively. After each heating, the absorbances at 340 nm were measured.
For the starch assay, the residue with 1 M KOH (0.5 mL) was boiled before adding acetic acid (0.2 M) to adjust the pH to within 6.5–7.5. Then, 100 μL α-amylase was added before incubating for 1 h at 65 °C. Acetic acid was used again to adjust the pH < 5 before incubating at 55 °C with amyloglucosidase (0.25 mL) for 60 min. After centrifuging at 10,000× g for 15 min, the supernatant was retained, and distilled water was used to bring the volume to 3 mL. The glucose concentration was assayed following the above method, and the starch content was calculated as described previously [40].

2.6. RNA Extraction and Quantitative RT-PCR

Leaf RNA was extracted with a Plant RNA Kit (Omega Bio-Tek, Norcross, GA, USA). cDNA was generated using a synthesis kit (Takara Bio, Shiga, Japan). The quantitative RT-PCR was conducted according to Yu et al. [41] with three technical repeats per sample. The relative expression level of genes encoding SOD (NtSOD), POD (NtPOD), CAT (NtCAT), and acid (NtSuSy) and alkaline INV (NtCWINV), SuSy (NtNINV), AGPase (NtAGP), SSSase (NtSSS), GBSSase (NtGBSS), α-amylase (α-amylase), and β-amylase (β-amylase) was estimated by the 2−ΔΔCt method. Detailed primers are shown in Table 1.

2.7. Statistical Analysis

The influences of temperature treatment, P treatment, and temperature × P interaction were assessed by the statistics package SPSS 17.0 (IBM, Armonk, NY, USA) using a two-way ANOVA using the LSD test (p = 0.05). All figures were produced with Origin 8.0 (OriginLab, Northampton, MA, USA).

3. Results

3.1. Effects of Temperature and P Level on Agronomic Traits of Tobacco

An obvious interaction effect between temperature and the P level was detected for plant height and shoot biomass (Table 2) because the P level had no influence on plant height under the control temperature, while the higher P application (P2 and P3) treatments had a higher plant height compared to the traditional P application (P1) treatment under the low temperature. Moreover, the P3 treatments had higher shoot biomass compared to the P1 treatment, while the increased magnitude of shoot biomass in the P3 treatment than in the P1 treatment was higher under the low temperature (30.0%) than the control temperature (10.4%). The stem diameter and root biomass were not impacted by the P level, and for the interaction of temperature and the P level (Table 2), the temperature had an obvious effect on stem diameter and root biomass since low temperature resulted in lower stem diameter and root biomass.

3.2. Effects of Temperature and P Level on Gas Exchange Parameters

AN was obviously impacted by the temperature and P level interaction (Figure 1). Compared with the P1 treatment, the increases in AN caused by the P2 and P3 treatments were greater under the low temperature than under the control temperature. gs was not impacted by the interaction of temperature × P level (Figure 1). gs was decreased by the low temperature, and gs was increased by the P2 and P3 treatments when compared to the P1 treatment under the low temperature. Ci was significantly impacted by the temperature × P level interaction (Figure 1) since the P level had no influence on Ci under the control temperature, while the P2 and P3 treatments had lower Ci with 16.6% and 18.0%, respectively, compared to the P1 treatment under the low temperature. A significant interaction effect for temperature × P level was detected for Tr (Figure 1). This was because the increases in Tr caused by the P2 and P3 treatments relative to the P1 treatment were higher under the control temperature (19.3–21.1%) than under the low temperature (22.6–47.4%).

3.3. Effects of Temperature and P Level on ROS and MDA Contents

A significant interaction effect of temperature × P level was observed on the O2∙− and H2O2 contents since the P level had no influence on the O2∙− and H2O2 contents under the control temperature, while the P2 and P3 treatments had lower contents of O2∙− (33.5–46.5%) and H2O2 (27.3–29.6%) compared to the P1 treatment under the low temperature (Figure 2). Moreover, the interaction effect between temperature and the P level was significant for the MDA content, which was manifested as significant decreases in MDA content in the P2 and P3 treatments than in the P1 treatment under the low temperature, while no differences were measured between the different P levels under the control temperature (Figure 2).

3.4. Effects of Temperature and P Level on Carbohydrate Content

The sucrose content was significantly impacted by the interaction of temperature and the P level (Figure 3) since the P level had no influence on sucrose content under the control temperature while the P2 and P3 treatments had higher contents of sucrose 46.5% and 36.1%, respectively, compared to the P1 treatment under the low temperature (Figure 2). The glucose content was not significantly affected by the interaction of temperature × P level (Figure 3) since the P2 and P3 treatments had a more significant influence on the glucose content than the P1 treatment under both temperature conditions (except for the P2 treatment under the low temperature). The fructose content was not affected by the temperature × P level interaction r the P level (Figure 3). The starch content was significantly impacted by the interaction of temperature × P level (Figure 3) because the P2 and P3 treatments had lower starch contents than the P1 treatment under the low temperature than under the control temperature. The soluble sugar content was significantly impacted by the interaction of temperature × P level (Figure 4) because the P2 and P3 treatments had 32.8% and 35.9%, respectively, higher soluble sugar contents than the P1 treatment under the low-temperature condition, while they had similar soluble sugar content to the P1 treatment under the control temperature.

3.5. Effects of Temperature and P Level on the Expression of Genes Related to the Antioxidant Enzyme System

There was a significant interaction effect of temperature and P level on NtSOD expression (Figure 5). The P2 and P3 treatments had an increase of 3.4-fold and 2.0-fold, respectively, for NtSOD expression compared with the P1 treatment under the low-temperature condition, while they had similar NtSOD expression to the P1 treatment under the control temperature. The expression of NtPOD was not affected by the temperature × P level interaction or the P level (Figure 5). The expression of NtCAT was significantly affected by the interaction of temperature × P level (Figure 5) because the expression of NtCAT was not affected by the P2 treatment relative to the P1 treatment the under control temperature, but it was significantly upregulated by both the P2 and P3 treatments relative to the P1 treatment under the low temperature.

3.6. Effects of Temperature and P Level on the Expression of Genes Related to Carbohydrate Metabolism

The expression of NtSuSy was markedly affected by the temperature × P level interaction because the expression of NtSuSy was not affected by different P levels under the control temperature but was significantly upregulated by 3.1- and 2.9-fold under the P2 and P3 treatments, respectively, relative to the P1 treatment under the low temperature (Figure 6). The expression of NtCWIN was not affected by the temperature × P level interaction but was obviously influenced by the temperature and P level (Figure 6). The expression of NtNINV was not affected by the P level or the temperature × P level interaction, but it was obviously influenced by the low temperature (Figure 6).
There was no significant interaction effect (temperature × P level) for the expression of NtAGP (Figure 7). The expression of NtAGP was upregulated by both the P2 and P3 treatments relative to the P1 treatment under both the control and low-temperature conditions. No significant interaction effect (temperature × P level) was detected for the expression of NtSSS (Figure 7). Although the expression of NtSSS was upregulated by both the P2 and P3 treatments relative to the P1 treatment under the control temperature condition, it was not impacted by different P levels under the low-temperature condition. The expression of NtGBSS was significantly affected by the interaction of temperature × P level (Figure 7) since the magnitude of upregulations in NtGBSS expression caused by the P2 (5.8-fold) and P3 (3.1-fold) treatments compared with the P1 treatment under the low temperature was higher than that (1.4-fold for the P2 treatment and 1.3-fold for the P3 treatment) under the control temperature.
The expression of α-amylase was markedly impacted by the interaction of temperature × P level (Figure 8) since the upregulation in α-amylase expression caused by the P2 and P3 treatments compared with the P1 treatment under the low temperature was higher than that caused by the P2 and P3 treatments compared with the P1 treatment under the control temperature. The interaction effect of cultivar × K rate on the expression of β-amylase was not significant (Figure 8). Moreover, the expression of β-amylase was not altered by different P levels under the low temperature.
In order to find out whether there is a simple linear relationship between all the measured physiological and agronomic indicators, the correlation of all the measured indicators is analyzed in Figure 9.

4. Discussion

Plant height and biomass are obvious morphological indexes that can indicate the degree of temperature influence at early growth stages [9]. Previous studies showed that low-temperature stress could result in low plant height, shoot biomass, and root biomass [3,40]. Similarly, our study found that a low temperature decreased the plant height, stem diameter, and biomass of shoots and roots (Table 2), suggesting that cold stress restricted the growth of tobacco seedlings [3,12]. Past studies indicated that P application could alleviate low-temperature impacts on the growth of wheat [31] and corn (Zea mays) [42]. In this study, although stem diameter and root biomass were not affected by the P level or the interaction of temperature and P level (Table 2), an obvious interaction effect between temperature and the P level was detected for plant height and shoot biomass (Table 2) because the P level had no influence on plant height under the control temperature; however, the higher P application (P2 and P3) treatments had a higher plant height compared to the traditional P application (P1) treatment under the low temperature. Moreover, the increased magnitude of shoot biomass (30.0%) caused by the P3 treatment compared with the P1 treatment under the low temperature was greater than that (10.4%) under the control temperature. Thus, these results suggested that increasing the P application level mainly mitigated the effects of cold stress on the growth of tobacco seedlings in the aboveground part but not in the underground part.
Photosynthesis is the only way for plants to accumulate biomass, and poor photosynthesis will reduce the accumulation of dry matter, finally halting plant growth [43]. Previous studies reported that the photosynthetic capacity of various plants decreased markedly after cold stress [31,44]. In the current study, leaf AN, gs, Ci, and Tr were significantly affected by temperature (Figure 1) since AN, gs, and Tr decreased and Ci increased under cold stress compared to the control temperature. Hu et al. [43] stated that the decrease in AN accompanied by the simultaneous decrease in gs and Ci indicated that the decrease in AN mainly resulted from stomatal limitation. The decreased AN accompanied by a decrease in gs and an increase in Ci indicated that non-stomatal factors seem to play a more important role in the decrease in AN. Hence, decreased the AN of tobacco leaves caused by the low-temperature treatment in this study was mainly caused by non-stomatal factors. Similar conclusions have been reported for soybeans (Glycine max) [45] and wheat [11]. Xu et al. [31] described that P application can promote the photosynthetic capacity of wheat under cold stress. Similarly, this study showed that the AN of tobacco leaves was increased by 38.6% and 61.3%, respectively, for the higher P application treatments than the P1 treatment under the low temperature. Furthermore, this suggested that higher P levels could also augment the photosynthetic capacity of tobacco leaves under cold stress. Moreover, under the low temperature, gs was increased by the higher P application treatments when compared to the P1 treatment, which might be related to the fact that P application can reduce the damage caused by stress on stomatal morphological characteristics [46]; on the contrary, Ci was significantly decreased by the higher P application treatments relative to the P1 treatment (Figure 1), indicating that under low-temperature stress, the promotion effect of higher P levels on AN was related to the reduction in non-stomatal limiting factors in addition to the reduction in stomatal limiting factors. These results supported a previous study by Singh et al. [47], in which the P supply was observed to mitigate the negative effects of temperature stress on photosynthesis by reducing stomatal and mesophyll limitations.
Excessive ROS accumulation will damage the photosynthetic structure, which is considered to be one of the main reasons for the decline in photosynthesis [12,37]. In order to maintain ROS balance, higher plants have evolved highly efficient peroxide clearance systems in which the antioxidant enzyme system plays an important role [8]. Multiple studies have reported that cold stress resulted in ROS accumulation, leading to oxidative stress [11,36]. In support of their reports, our results also found that compared with the control temperature, the low temperature resulted in higher O2 and H2O2 contents in tobacco leaves, causing membrane lipid peroxidation and ultimately an increase in the MDA content. SOD, POD, and CAT are the three most important enzymes in the antioxidant enzyme system; SOD can exclusively scavenge O2∙− to form H2O2 and O2, and CAT and POD convert H2O2 to O2 [48]. Previous studies showed that low temperatures increased POD and CAT activities in barley (Hordeum vulgare) leaves [49] and SOD, CAT, and POD activities in naked oats (Avena nuda) [50]. The findings of the present experiment correspond to their reports since the low temperature upregulated the expression of NtSOD, NtPOD, and NtCAT in tobacco leaves compared with the control temperature, which would promote the reduction of O2∙− and H2O2 in theory. However, higher O2 and H2O2 contents still were observed under low-temperature conditions than under control temperature conditions, possibly because the increase in the ROS-clearing rate facilitated by the antioxidant enzyme system was insufficient to keep pace with the heightened rate of ROS production caused by low-temperature stress [50,51]. Studies showed that the application of P fertilizer could activate the activity of SOD, POD, and CAT in the antioxidant enzymatic system in wheat [11] and in alfalfa (Medicago sativa) under low-temperature stress. Hence, extra P fertilizer application could reduce O2 and H2O2 contents in low-temperature-stressed plants [11,52]. Similar to the above studies, the results of the present investigation indicated that compared with the P1 treatment, the application of the higher P treatments further upregulated the expression of NtSOD and NtCAT in low-temperature-stressed tobacco leaves, although different P levels had no significant influences on the expression of NtPOD low-temperature-stressed tobacco leaves, finally resulting in less O2 and H2O2 accumulation and subsequently leading to less membrane lipid peroxidation (indicated by lower MDA content). Hence, these results can explain why a significant interaction effect of temperature × P level was observed on the O2∙− and H2O2 contents.
Sucrose is one of the most important photosynthetic products [53]. In this study, lower leaf AN was observed under the low-temperature treatment relative to the control temperature (Figure 2), implying that leaf sucrose content might have been lower under the low temperature than the control temperature. Surprisingly, the opposite trend was observed in Figure 2. The metabolism of sucrose hydrolysis to hexose (glucose and fructose) is catalyzed by acid–base convertase (INV) and sucrose synthetase (SuSy) [15]. Past studies reported that cold stress could decrease the activities of SuSy, acid INV, and alkaline INV in multiple plants [20,54]. Consistent with their observations, compared with the control temperature, the low temperature significantly downregulated the expression of NtSuSy, NtCWINV, and NtNINV (Figure 6) in this study, which inhibited sucrose hydrolysis, thus explaining the higher sucrose content under the low-temperature conditions. The sucrose content was significantly impacted by the interaction of temperature and the P level (Figure 3) since the P level had no influence on the sucrose content under the control temperature, while the higher P application had a higher content of sucrose compared to the P1 treatment under the low temperature, indicating that the effect of P application on sucrose decomposition may be different at different temperatures. Further analyses showed that compared with the P1 treatment, higher P application upregulated the expression of NtSuSy, downregulated the expression of NtCWINV, and had no significant influences on the expression of NtNINV in low-temperature-stressed tobacco leaves. Considering that leaf sucrose content was higher in the higher P application treatments than in P1 treatment under the low temperature, we concluded that the increase in the sucrose content in tobacco leaves after higher P application under low-temperature stress was mainly due to the inhibition of sucrose decomposition by the further downregulation of NtCWINV expression since the upregulated expression of NtSuSy caused by higher P application will accelerate sucrose hydrolysis in theory. Starch is another important photosynthetic product besides sucrose [53]. Three key enzymes regulate starch synthesis. AGPase acts on the conversion of glucose-1-phosphate into ADP-glucose, then SSSase and GBSSase are responsible for the formation of amylose and amylopectin using ADP-glucose [18], and the two enzymes, α-amylase and β-amylase, regulate starch hydrolysis by catalyzing the breakdown of starch [19]. In this study, the low temperature downregulated the expression of NtAGP, NtSSS, and NtGBSS, which could restrict starch biosynthesis, and upregulated the expression of α-amylase and β-amylase, which could promote the breakdown of starch. Hence, inhibited starch synthesis and accelerated starch hydrolysis reveal why the decreased starch content in tobacco leaves was measured under the low temperature and not the control temperature. Similarly, Zhang et al. [55] also found that cold stress led to low starch content in wheat. Moreover, the starch content was significantly impacted by the interaction of temperature × P level (Figure 3) because P application had no influence on the starch content under the control temperature, which might be the result of a balance between increased starch synthesis (caused by the upregulated expression of NtAGP, NtSSS, and NtGBSS) and increased starch degradation (caused by the upregulated expression of α-amylase and β-amylase) after high P application; however, compared with the P1 treatment, the higher P application treatments had lower starch in low-temperature-stressed tobacco leaves. Further analyses showed that although the higher P application treatments markedly upregulated the expression of NtAGP and NtGBSS, compared to the P1 treatment in low-temperature-stressed tobacco leaves, promoting starch accumulation in theory, the expression of α-amylase was further enhanced by the higher P application treatments than the P1 treatment in low-temperature-stressed tobacco leaves, promoting the breakdown of starch into glucose, which could finally explain the lower starch level in the higher P application treatments than in the P1 treatment in low-temperature-stressed tobacco leaves. Moreover, this also explained why the glucose content was significantly increased in the P3 treatment compared with the P1 treatment in low-temperature-stressed tobacco leaves, although the decomposition of sucrose to form glucose was inhibited by the P3 treatment compared with the P1 treatment in low-temperature-stressed tobacco leaves by the downregulation of NtCWINV expression. Soluble sugars composed of sucrose, glucose, etc., are confirmed to serve a vital role in the strength of cold resistance [14]. As previously reported in cucumber (Cucumis sativus) leaves [54], the soluble sugar content was significantly higher in tobacco leaves under the low temperature than the control temperature in this study (Figure 4), which helped tobacco plants resist low-temperature stress. Moreover, the P2 and P3 treatments had 32.8% and 35.9%, respectively, higher soluble sugar content than the P1 treatment under the low-temperature conditions, further improving the low-temperature tolerance of tobacco seedlings, which supported the previously observed results of higher soluble sugar content in wheat under cold stress after P application [11].
In soybeans (Glycine max), it was found that the application of high-rate P fertilizer under low-temperature conditions could enhance photosynthetic efficiency and promote biomass accumulation, which was beneficial to pod development and maintained yield [56]. Similar studies have also been conducted on rice (Oryza sativa L.), revealing that high phosphorus levels under low-temperature conditions led to an improvement in the dry weight of shoots and roots in rice, as well as plant height [57]. The above studies, along with our research, hold certain reference significance for other crops subjected to cold stress through the application of appropriate increased phosphorus inputs. Moreover, this study found that higher P fertilizer can regulate antioxidant metabolism and carbohydrate metabolism to enhance the resistance of tobacco seedlings to cold stress, which can provide research ideas for the study of other abiotic stresses, such as drought or salinity, because several other abiotic stresses also affect these two metabolisms [46]. Moreover, in production, Borling’s study found that the availability of P is related to soil texture in different regions, and there are significant differences in P availability among different types of soil [58]. Therefore, in actual production and application, it is necessary to explore the appropriate level of P input based on the soil nutrient level in the region to alleviate the damage to tobacco and other crops caused by cold stress. Only reasonable use of P fertilizer can avoid the environmental pollution caused by excessive P fertilizer to the maximum extent, after all, the excessive use of phosphate fertilizer is also an important problem at present [59].

5. Conclusions

In summary, a low temperature decreased plant height, stem diameter, and biomass of shoots and roots, while higher P levels promoted plant height and shoot biomass of low-temperature-stressed tobacco seedlings compared to the traditional P level. Leaf AN decreased under the low temperature compared with the control temperature, while the AN of low-temperature-stressed tobacco was increased by the higher P levels than the traditional P level (Figure 10). Higher O2 and H2O2 contents were observed in low-temperature-stressed tobacco leaves, damaging AN, although the low temperature upregulated the expression of NtSOD, NtPOD, and NtCAT in tobacco leaves compared with the control temperature. However, compared with the traditional P level, the higher P levels further upregulated the expression of NtSOD and NtCAT in low-temperature-stressed tobacco leaves, finally resulting in less O2 and H2O2 accumulation and subsequently leading to less MDA content. Although lower leaf AN was observed under the low-temperature treatment, a higher leaf sucrose content was detected under the low temperature compared to the control temperature since the low temperature significantly downregulated the expression of NtSuSy, NtCWINV, and NtNINV, inhibiting sucrose hydrolysis. Compared with the traditional P level, the higher P levels downregulated the expression of NtCWINV in low-temperature-stressed tobacco leaves, further promoting leaf sucrose content. The low temperature downregulated the expression of NtAGP, NtSSS, and NtGBSS, restricting starch biosynthesis, and upregulated the expression of α-amylase and β-amylase, accelerating starch hydrolysis, leading to lower starch content in low-temperature-stressed tobacco leaves. The higher P levels further upregulated the expression of α-amylase in low-temperature-stressed tobacco leaves, although they also upregulated the expression of NtAGP and NtGBSS in low-temperature-stressed tobacco leaves compared to the traditional P level, finally leading to a lower starch level in low-temperature-stressed tobacco leaves. Moreover, the soluble sugar content was significantly higher in tobacco leaves under the low temperature than in the control temperature, helping tobacco plants resist cold stress. The higher P levels further promoted the soluble sugar content in low-temperature-stressed tobacco leaves than the traditional P treatment, further improving the low-temperature tolerance of tobacco seedlings.
Thus, this study can provide research ideas for the study of other crops or other abiotic stresses by higher P fertilizer can regulate antioxidant metabolism and carbohydrate metabolism to enhance the resistance to stress. Moreover, it should be noted that in actual production, when applying P to alleviate the damage caused by stresses, further research to explore the appropriate level of P input based on the soil nutrient level in the region is necessary.

Author Contributions

W.X.: data collection, data analysis, investigation, writing, and funding acquisition. Q.L.: data collection, investigation, and methodology. Y.W.: data collection, investigation, and methodology. Z.W.: project administration, supervision, writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Innovation Project of Henan Academy of Agricultural Sciences (2024ZC047).

Data Availability Statement

The original contributions presented in this study are included in this article. Further inquiries can be directed to the corresponding author/s.

Acknowledgments

Thank you to Jiping Sun, Huige Han, and Researcher Yanping Li for their strong support in ensuring the smooth progress of this research work. We fully appreciate the editors and all anonymous reviewers for their constructive comments on this manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ai, D.; Zhang, Y.; Li, Z.; Feng, W.; Zhu, J.; Chen, X.; Chang, N.; Bian, L.; Liu, Q. Modification of transplanting substrates for promotion of rapid root development in early growing period of tobacco. J. Plant Nutr. Fertil. 2024, 30, 615–626. [Google Scholar]
  2. Jones, J.; Terrill, T. Effects of transplant size and condition on the survival, yield, and quality of flue-cured tobacco. Tob. Sci. 1984, 2, 73–77. [Google Scholar]
  3. Yi, J.; Li, Y.; Dai, Z.; Jia, Z.; Pu, W.; Sun, Z.; Wang, Y.; Shen, H. Enhanced tolerance to low temperature in tobacco (Nicotiana tabacum L.) sprayed with a low-temperature-resistant agent. Exp. Agric. 2015, 51, 179–190. [Google Scholar] [CrossRef]
  4. Dai, X.; Zhang, Y.; Xu, X.; Ran, M.; Zhang, J.; Deng, K.; Ji, G.; Xiao, L.; Zhou, X. Transcriptome and functional analysis revealed the intervention of brassinosteroid in regulation of cold induced early flowering in tobacco. Front. Plant Sci. 2023, 14, 1136884. [Google Scholar] [CrossRef]
  5. Tao, X.; Yang, L.; Zhang, M.; Li, Y.; Xiao, H.; Yu, L.; Jiang, C.; Long, Z.; Zhang, Y. Shallow water seeding cultivation enhances cold tolerance in tobacco seedlings. BMC Plant Biol. 2024, 24, 698. [Google Scholar] [CrossRef] [PubMed]
  6. Hassan, M.A.; Xiang, C.; Farooq, M.; Muhammad, N.; Yan, Z.; Hui, X.; Yuanyuan, K.; Bruno, A.K.; Lele, Z.; Jincai, L. Cold stress in wheat: Plant acclimation responses and management strategies. Front. Plant Sci. 2021, 12, 676884. [Google Scholar] [CrossRef] [PubMed]
  7. Cheng, M.; Wang, Z.; Cao, Y.; Zhang, J.; Yu, H.; Wang, S.; Zhou, Z.; Hu, W. Soil drought during the development of cotton ovule destroyed the antioxidant balance of cotton pistil to hinder the ovule formation. J. Agron. Crop Sci. 2024, 210, e12695. [Google Scholar] [CrossRef]
  8. Zhang, J.; Cheng, M.; Cao, N.; Li, Y.; Wang, S.; Zhou, Z.; Hu, W. Drought stress and high temperature affect the antioxidant metabolism of cotton (Gossypium hirsutum L.) anthers and reduce pollen fertility. Agronomy 2023, 13, 2550. [Google Scholar] [CrossRef]
  9. Xu, S.; Li, Y.; Jin, H.; Guan, Y.; Zheng, Y.; Zhu, S. Responses of antioxidant enzymes to chilling stress in tobacco seedlings. Agric. Sci. China 2010, 9, 1594–1601. [Google Scholar] [CrossRef]
  10. Gao, Y.; Qiao, Q.; Liu, Z.; Gao, Z.; Wang, D.; Liu, C.; Xi, Y.; Fang, M.; Yu, H.; Zhang, L. Analysis of transcriptomic and metabolomic differences revealed the mechanism underlying the tobacco response to low-temperature. Environ. Exp. Bot. 2024, 217, 105576. [Google Scholar] [CrossRef]
  11. Xu, H.; Hou, K.; Fang, H.; Liu, Q.-Q.; Wu, Q.; Lin, F.-F.; Deng, R.; Zhang, L.-J.; Chen, X.; Li, J.-C. Twice-split phosphorus application alleviates low-temperature impacts on wheat by improved spikelet development and setting. J. Integr. Agric. 2023, 22, 3667–3680. [Google Scholar] [CrossRef]
  12. Hu, W.; Loka, D.A.; Yang, Y.; Wu, Z.; Wang, J.; Liu, L.; Wang, S.; Zhou, Z. Partial root-zone drying irrigation improves intrinsic water-use efficiency and maintains high photosynthesis by uncoupling stomatal and mesophyll conductance in cotton leaves. Plant Cell Environ. 2024, 47, 3147–3165. [Google Scholar] [CrossRef] [PubMed]
  13. Liao, R.; Liu, Z.; Dongchen, W.; Deng, X.; Ma, E.; Manzoor, N.; Lin, C.; Zhou, S.; Tong, W.; Zhou, M.; et al. Integrated metabolomic and metagenomic strategies shed light on interactions among planting environments, rhizosphere microbiota, and metabolites of tobacco in Yunnan, China. Front. Microbiol. 2024, 15, 1386150. [Google Scholar] [CrossRef]
  14. Ouyang, L.; Leus, L.; De Keyser, E.; Van Labeke, M.-C. Seasonal changes in cold hardiness and carbohydrate metabolism in four garden rose cultivars. J. Plant Physiol. 2019, 232, 188–199. [Google Scholar] [CrossRef] [PubMed]
  15. Zhang, J.; Loka, D.A.; Wang, J.; Ran, Y.; Shao, C.; Tuersun, G.; Li, Y.; Wang, S.; Zhou, Z.; Hu, W. Co-occurring elevated temperature and drought stress inhibit cotton pollen fertility by disturbing anther carbohydrate and energy metabolism. Ind. Crops Prod. 2024, 208, 117894. [Google Scholar] [CrossRef]
  16. Nguyen-Quoc, B.; Foyer, C.H. A role for ‘futile cycles’ involving invertase and sucrose synthase in sucrose metabolism of tomato fruit. J. Exp. Bot. 2001, 52, 881–889. [Google Scholar] [CrossRef]
  17. Elsayed, A.I.; Rafudeen, M.S.; Golldack, D.; Weber, A. Physiological aspects of raffinose family oligosaccharides in plants: Protection against abiotic stress. Plant Biol. 2014, 16, 1–8. [Google Scholar] [CrossRef]
  18. Hu, W.; Liu, Y.; Loka, D.A.; Zahoor, R.; Wang, S.; Zhou, Z. Drought limits pollen tube growth rate by altering carbohydrate metabolism in cotton (Gossypium hirsutum) pistils. Plant Sci. 2019, 286, 108–117. [Google Scholar] [CrossRef] [PubMed]
  19. Hammond, J.B.; Burton, K.S. Leaf starch metabolism during the growth of pepper (Capsicum annuum) plants. Plant Physiol. 1983, 73, 61–65. [Google Scholar] [CrossRef]
  20. Zhang, W.; Wang, J.; Huang, Z.; Mi, L.; Jiang, D. Effects of low temperature at booting stage on sucrose metabolism and endogenous hormone contents in winter wheat spikelet. Front. Plant Sci. 2019, 10, 498. [Google Scholar] [CrossRef]
  21. Shu, H.; Zhou, Z.; Xu, N.; Wang, Y.; Zheng, M. Sucrose metabolism in cotton (Gossypium hirsutum L.) fibre under low temperature during fibre development. Eur. J. Agron. 2009, 31, 61–68. [Google Scholar] [CrossRef]
  22. Sharma, K.D.; Patil, G.; Kiran, A. Characterization and differential expression of sucrose and starch metabolism genes in contrasting chickpea (Cicer arietinum L.) genotypes under low temperature. J. Genet. 2021, 100, 71. [Google Scholar] [CrossRef]
  23. Zhou, P.; Khan, R.; Li, Q.; Liu, G.; Xu, N.; Yang, Y.; Wang, Y.; Wang, S.; Chen, A. Transcriptomic analyses of chilling stress responsiveness in leaves of tobacco (Nicotiana tabacum) seedlings. Plant Mol. Biol. Report. 2020, 38, 1–13. [Google Scholar] [CrossRef]
  24. Parks, S.E.; Haigh, A.M.; Cresswell, G.C. Stem tissue phosphorus as an index of the phosphorus status of Banksia ericifolia L. f. Plant Soil 2000, 227, 59–65. [Google Scholar] [CrossRef]
  25. Ahn, T.; Oke, M.; Schofield, A.; Paliyath, G. Effects of phosphorus fertilizer supplementation on antioxidant enzyme activities in tomato fruits. J. Agric. Food Chem. 2005, 53, 1539–1545. [Google Scholar] [CrossRef] [PubMed]
  26. Qiu, J.; Israel, D.W. Carbohydrate accumulation and utilization in soybean plants in response to altered phosphorus nutrition. Physiol. Plant. 1994, 90, 722–728. [Google Scholar] [CrossRef]
  27. Huang, X.; Wang, J.; Wang, Q.; Li, H.; Hu, W.; Wang, S.; Zhou, Z. Phosphorus-induced improvement of photosynthate synthesis and transport in the leaf subtending to cotton boll provided sufficient sucrose for fiber thickening during the crucial period and improved fiber bundle strength. Field Crops Res. 2024, 306, 109230. [Google Scholar] [CrossRef]
  28. Wasaki, J.; Shinano, T.; Onishi, K.; Yonetani, R.; Yazaki, J.; Fujii, F.; Shimbo, K.; Ishikawa, M.; Shimatani, Z.; Nagata, Y. Transcriptomic analysis indicates putative metabolic changes caused by manipulation of phosphorus availability in rice leaves. J. Exp. Bot. 2006, 57, 2049–2059. [Google Scholar] [CrossRef]
  29. Ariovich, D.; Cresswell, C. The effect of nitrogen and phosphorus on starch accumulation and net photosynthesis in two variants of Panicum maximum Jacq. Plant Cell Environ. 1983, 6, 657–664. [Google Scholar] [CrossRef]
  30. Noor, I.; Sohail, H.; Hasanuzzaman, M.; Hussain, S.; Li, G.; Liu, J. Phosphorus confers tolerance against manganese toxicity in Prunus persica by reducing oxidative stress and improving chloroplast ultrastructure. Chemosphere 2022, 291, 132999. [Google Scholar] [CrossRef]
  31. Xu, H.; Wu, Z.; Xu, B.; Sun, D.; Hassan, M.A.; Cai, H.; Wu, Y.; Yu, M.; Chen, A.; Li, J. Optimized phosphorus application alleviated adverse effects of short-term low-temperature stress in winter wheat by enhancing photosynthesis and improved accumulation and partitioning of dry matter. Agronomy 2022, 12, 1700. [Google Scholar] [CrossRef]
  32. Xu, H.; Hassan, M.A.; Sun, D.; Wu, Z.; Jiang, G.; Liu, B.; Ni, Q.; Yang, W.; Fang, H.; Li, J. Effects of low temperature stress on source–sink organs in wheat and phosphorus mitigation strategies. Front. Plant Sci. 2022, 13, 807844. [Google Scholar] [CrossRef]
  33. Wang, T.; Song, J.; Yan, S.; Li, C. Growth and development of olive under low temperature stress influenced by phosphate fertilizer application. J. Plant Nutr. Fertil. 2020, 26, 879–890. [Google Scholar]
  34. Wang, Y.; Sun, Z.; Wang, Q.; Xie, J.; Yu, L. Transcriptomics and metabolomics revealed that phosphate improves the cold tolerance of alfalfa. Front. Plant Sci. 2023, 14, 1100601. [Google Scholar] [CrossRef] [PubMed]
  35. Soudek, P.; Kufner, D.; Petrova, S.; Mihaljevic, M.; Vanek, T.J.C. Composition of hydroponic medium affects thorium uptake by tobacco plants. Chemosphere 2013, 92, 1090–1098. [Google Scholar] [CrossRef]
  36. Gu, K.; Hou, S.; Chen, J.; Guo, J.; Wang, F.; He, C.; Zou, C.; Xie, X. The physiological response of different tobacco varieties to chilling stress during the vigorous growing period. Sci. Rep. 2021, 11, 22136. [Google Scholar] [CrossRef]
  37. Yang, Y.; Yang, X.; Dai, K.; He, S.; Zhao, W.; Wang, S.; Zhou, Z.; Hu, W. Nanoceria-induced variations in leaf anatomy and cell wall composition drive the increase in mesophyll conductance of salt-stressed cotton leaves. Plant Physiol. Biochem. 2024, 216, 109111. [Google Scholar] [CrossRef]
  38. Zhang, S.; Han, S.; Yang, W.; Wei, H.; Zhang, M.; Qi, L. Changes in H2O2 content and antioxidant enzyme gene expression during the somatic embryogenesis of Larix leptolepis. Plant Cell Tissue Organ Cult. 2010, 100, 21–29. [Google Scholar] [CrossRef]
  39. Hu, W.; Lv, X.; Yang, J.; Chen, B.; Zhao, W.; Meng, Y.; Wang, Y.; Zhou, Z.; Oosterhuis, D.M. Effects of potassium deficiency on antioxidant metabolism related to leaf senescence in cotton (Gossypium hirsutum L.). Field Crops Res. 2016, 191, 139–149. [Google Scholar] [CrossRef]
  40. Hu, W.; Loka, D.A.; Fitzsimons, T.R.; Zhou, Z.; Oosterhuis, D.M. Potassium deficiency limits reproductive success by altering carbohydrate and protein balances in cotton (Gossypium hirsutum L.). Environ. Exp. Bot. 2018, 145, 87–94. [Google Scholar] [CrossRef]
  41. Yu, H.; Luo, Y.; Cao, N.; Wang, S.; Zhou, Z.; Hu, W. Drought-induced cell wall degradation in the base of pedicel is associated with accelerated cotton square shedding. Plant Physiol. Biochem. 2024, 214, 108894. [Google Scholar] [CrossRef] [PubMed]
  42. Fang, H.; Huang, J.; Zhu, X.; Hassan, M.A.; Ren, J.; Huang, J.; Zheng, B.; Chen, X.; Lin, F.; Li, J. Postponed application of phosphorus and potassium fertilizers mitigates the damage of late spring coldness by Improving winter wheat root physiology. Plants 2024, 13, 2311. [Google Scholar] [CrossRef] [PubMed]
  43. Hu, W.; Jiang, N.; Yang, J.; Meng, Y.; Wang, Y.; Chen, B.; Zhao, W.; Oosterhuis, D.M.; Zhou, Z. Potassium (K) supply affects K accumulation and photosynthetic physiology in two cotton (Gossypium hirsutum L.) cultivars with different K sensitivities. Field Crops Res. 2016, 196, 51–63. [Google Scholar] [CrossRef]
  44. Huner, N.P.; Öquist, G.; Hurry, V.M.; Krol, M.; Falk, S.; Griffith, M. Photosynthesis, photoinhibition and low temperature acclimation in cold tolerant plants. Photosynth. Res. 1993, 37, 19–39. [Google Scholar] [CrossRef]
  45. Van Heerden, P.; Kruger, G. Photosynthetic limitation in soybean during cold stress. S. Afr. J. Sci. 2000, 96, 201–206. [Google Scholar]
  46. Khan, F.; Siddique, A.B.; Shabala, S.; Zhou, M.; Zhao, C. Phosphorus plays key roles in regulating plants’ physiological responses to abiotic stresses. Plants 2023, 12, 2861. [Google Scholar] [CrossRef] [PubMed]
  47. Singh, S.; Reddy, V.; Fleisher, D.; Timlin, D. Interactive effects of temperature and phosphorus nutrition on soybean: Leaf photosynthesis, chlorophyll fluorescence, and nutrient efficiency. Photosynthetica 2019, 57, 248–257. [Google Scholar] [CrossRef]
  48. Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef]
  49. Valizadeh-Kamran, R.; Toorchi, M.; Mogadam, M.; Mohammadi, H.; Pessarakli, M. Effects of freeze and cold stress on certain physiological and biochemical traits in sensitive and tolerant barley (Hordeum vulgare) genotypes. J. Plant Nutr. 2018, 41, 102–111. [Google Scholar] [CrossRef]
  50. Liu, W.; Yu, K.; He, T.; Li, F.; Zhang, D.; Liu, J. The low temperature induced physiological responses of Avena nuda L., a cold-tolerant plant species. Sci. World J. 2013, 2013, 658793. [Google Scholar] [CrossRef]
  51. Hasanuzzaman, M.; Parvin, K.; Bardhan, K.; Nahar, K.; Anee, T.I.; Masud, A.A.C.; Fotopoulos, V. Biostimulants for the regulation of reactive oxygen species metabolism in plants under abiotic stress. Cells 2021, 10, 2537. [Google Scholar] [CrossRef] [PubMed]
  52. Chen, W.; Zhang, Y.; Cong, B. Physiological and antioxidant activities of phosphate fertilizers on alfalfa roots under freezing stress. J. Northwest A F Univ. 2021, 49, 58–66. [Google Scholar]
  53. Hu, W.; Yang, J.; Meng, Y.; Wang, Y.; Chen, B.; Zhao, W.; Oosterhuis, D.M.; Zhou, Z. Potassium application affects carbohydrate metabolism in the leaf subtending the cotton (Gossypium hirsutum L.) boll and its relationship with boll biomass. Field Crops Res. 2015, 179, 120–131. [Google Scholar] [CrossRef]
  54. Meng, F.; Hu, L.; Wang, S.; Sui, X.; Wei, L.; Wei, Y.; Sun, J.; Zhang, Z. Effects of exogenous abscisic acid (ABA) on cucumber seedling leaf carbohydrate metabolism under low temperature. Plant Growth Regul. 2008, 56, 233–244. [Google Scholar] [CrossRef]
  55. Zhang, W.; Zhang, A.; Zhou, Q.; Fang, R.; Zhao, Y.; Li, Z.; Zhao, J.; Zhao, M.; Ma, S.; Fan, Y. Low-temperature at booting reduces starch content and yield of wheat by affecting dry matter transportation and starch synthesis. Front. Plant Sci. 2023, 14, 1207518. [Google Scholar] [CrossRef] [PubMed]
  56. Singh, S.K.; Reddy, V.R.; Fleisher, D.H.; Timlin, D.J. Phosphorus nutrition affects temperature response of soybean growth and canopy photosynthesis. Front. Plant Sci. 2018, 9, 1116. [Google Scholar] [CrossRef] [PubMed]
  57. Zia, M.S.; Salim, M.; Aslam, M.; Gill, M.A.; Rahmatullah. Effect of low temperature of irrigation water on rice growth and nutrient uptake. J. Agron. Crop Sci. 1994, 173, 22–31. [Google Scholar] [CrossRef]
  58. Borling, K.; Otabbong, E.; Barberis, E. Phosphorus sorption in relation to soil properties in some cultivated Swedish soils. Nutr. Cycl. Agroecosyst. 2001, 59, 39–46. [Google Scholar] [CrossRef]
  59. Liu, L.; Zheng, X.; Wei, X.; Kai, Z.; Xu, Y. Excessive application of chemical fertilizer and organophosphorus pesticides induced total phosphorus loss from planting causing surface water eutrophication. Sci. Rep. 2021, 11, 23015. [Google Scholar] [CrossRef]
Figure 1. Effect of different P levels on the net photosynthetic rate (AN), stomatal conductance (gs), intercellular CO2 concentration (Ci), and transpiration rate (Tr) of tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. **, *, and ns indicate significant differences at 0.01 and 0.05 and non-significant difference, respectively.
Figure 1. Effect of different P levels on the net photosynthetic rate (AN), stomatal conductance (gs), intercellular CO2 concentration (Ci), and transpiration rate (Tr) of tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. **, *, and ns indicate significant differences at 0.01 and 0.05 and non-significant difference, respectively.
Agronomy 14 02902 g001
Figure 2. Effect of different P levels on the content of leaf superoxide anion (O2∙−), hydrogen peroxide (H2O2), and malonaldehyde (MDA) in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. ** and * indicate significant differences at 0.01 and 0.05, respectively.
Figure 2. Effect of different P levels on the content of leaf superoxide anion (O2∙−), hydrogen peroxide (H2O2), and malonaldehyde (MDA) in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. ** and * indicate significant differences at 0.01 and 0.05, respectively.
Agronomy 14 02902 g002
Figure 3. Effect of different P levels on the content of leaf glucose, fructose, sucrose, and starch in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. **, *, and ns indicate significant differences at 0.01 and 0.05 and non-significant difference, respectively.
Figure 3. Effect of different P levels on the content of leaf glucose, fructose, sucrose, and starch in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. **, *, and ns indicate significant differences at 0.01 and 0.05 and non-significant difference, respectively.
Agronomy 14 02902 g003
Figure 4. Effect of different P levels on the content of leaf soluble sugar in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. ** indicates significant differences at 0.01.
Figure 4. Effect of different P levels on the content of leaf soluble sugar in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. ** indicates significant differences at 0.01.
Agronomy 14 02902 g004
Figure 5. Effect of different P levels on the expression of the NtSOD, NtPOD, and NtCAT genes encoding superoxide dismutase, peroxidase, and catalase, respectively, in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. ** and ns indicate significant differences at 0.01 and non-significant difference, respectively.
Figure 5. Effect of different P levels on the expression of the NtSOD, NtPOD, and NtCAT genes encoding superoxide dismutase, peroxidase, and catalase, respectively, in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. ** and ns indicate significant differences at 0.01 and non-significant difference, respectively.
Agronomy 14 02902 g005
Figure 6. Effect of different P levels on the expression of the NtSuSy, NtCWINV, and NtNINV genes encoding sucrose synthase, cell wall invertase, and alkaline invertase, respectively, in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. ** and ns indicate significant differences at 0.01 and non-significant difference, respectively.
Figure 6. Effect of different P levels on the expression of the NtSuSy, NtCWINV, and NtNINV genes encoding sucrose synthase, cell wall invertase, and alkaline invertase, respectively, in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. ** and ns indicate significant differences at 0.01 and non-significant difference, respectively.
Agronomy 14 02902 g006
Figure 7. Effect of different P levels on the expression of NtAGP, NtSSS, and NtGBSS genes encoding ADP-glucose pyrophosphorylase, soluble starch synthase, and granule-bound starch synthase, respectively, in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. **, *, and ns indicate significant differences at 0.01 and 0.05 and non-significant difference, respectively.
Figure 7. Effect of different P levels on the expression of NtAGP, NtSSS, and NtGBSS genes encoding ADP-glucose pyrophosphorylase, soluble starch synthase, and granule-bound starch synthase, respectively, in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. **, *, and ns indicate significant differences at 0.01 and 0.05 and non-significant difference, respectively.
Agronomy 14 02902 g007
Figure 8. Effect of different P levels on the expression of genes α-amylase and β-amylase encoding α- and β-amylase, respectively, in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. **, *, and ns indicate significant differences at 0.01 and 0.05 and non-significant difference, respectively.
Figure 8. Effect of different P levels on the expression of genes α-amylase and β-amylase encoding α- and β-amylase, respectively, in tobacco seedlings under low-temperature stress. Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. T, P, and T × P mean temperature, P level, and their interaction, respectively. **, *, and ns indicate significant differences at 0.01 and 0.05 and non-significant difference, respectively.
Agronomy 14 02902 g008
Figure 9. Correlation analysis of different indicators. * and ** indicate significant differences at 0.05 and 0.01, respectively.
Figure 9. Correlation analysis of different indicators. * and ** indicate significant differences at 0.05 and 0.01, respectively.
Agronomy 14 02902 g009
Figure 10. A mechanism model of phosphorus concentration affecting carbohydrate metabolism and antioxidant metabolism in tobacco seedlings under low-temperature stress. Increased or decreased parameters are indicated by red “↑” or blue “↓”, respectively.
Figure 10. A mechanism model of phosphorus concentration affecting carbohydrate metabolism and antioxidant metabolism in tobacco seedlings under low-temperature stress. Increased or decreased parameters are indicated by red “↑” or blue “↓”, respectively.
Agronomy 14 02902 g010
Table 1. Primers for the quantitative real-time PCR analysis.
Table 1. Primers for the quantitative real-time PCR analysis.
GeneForward Primer (5′-3′)Reverse Primer (5′-3′)
NtSODGACGGACCTTAGCAACAGGCTGTAAGTAGTATGCATGTTC
NtPODCTCCATTTCCATGACTGCTTTGGTTGGGTGGTGAGGTCTTT
NtCATCACCTTACCTGTGCTGATTTCCTGGTGTAGAACTTGACAGC
NtSuSyCTCAACATCACCCCTCGAATACCAGGGGAAACAATGTTGA
NtCWINVCTTACACCCAATTACCGGCGGACACTCTTTTGGGTCGTCG
NtNINVTTATCCTGCTCTTGAGGGCCGAGCAAAGTTGGCCAGGATC
NtADPAGCAAAGACGTGATGTTAAACCTCTTCACATTGTCCCCTATACG
NtSSSTGAGTTCAGGTGGTCTTGTCTTTGGAATAGCCCTTATGCGTCGATGATGG
NtGBSSAACAGCTCGAAGTGTTGTAATCTGCTTGGAACCAACATAA
α-amylaseATATTGCAGGCCTTCAACTGGGTGGAAGGTAACCTTCAGGAGACAA
β-amylaseTGAGCTATTGGAAATGGCGAAGAAAGAGGGATCGTGCAGGAATCA
NttubulinGCATCTTTGCGTACACTTTGCTACATAAGCCCAAAACTAGCTGGA
Table 2. Effect of different P levels on the agronomic traits of the plants under low-temperature stress.
Table 2. Effect of different P levels on the agronomic traits of the plants under low-temperature stress.
TemperatureP Level
(mM L−1)
Plant Height
(cm)
Stem Diameter
(mm)
Shoot Biomass
(g)
Root Biomass
(g)
Control temperatureP119.08 a 13.07 a0.67 b0.063 a
P218.98 a3.27 a0.69 b0.066 a
P318.78 a2.91 a0.74 a0.073 a
Low temperatureP111.64 b2.27 b0.50 b0.052 b
P216.88 a3.14 a0.64 a0.059 ab
P315.25 a2.85 ab0.65 a0.067 a
Significance of factors
Temperature** 2****
P level*ns**ns
Temperature × P level*ns*ns
1 Within each temperature, different letters represent significant differences at p = 0.05. Data are means of 4 replicates. 2 **, *, and ns indicate significant differences at 0.01 and 0.05 and non-significant difference, respectively.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xu, W.; Liu, Q.; Wang, Y.; Wu, Z. Increasing Phosphorus Application Level Alleviated Adverse Effects of Low-Temperature Stress on Antioxidant Metabolism and Carbohydrate Metabolism in Tobacco Seedlings. Agronomy 2024, 14, 2902. https://doi.org/10.3390/agronomy14122902

AMA Style

Xu W, Liu Q, Wang Y, Wu Z. Increasing Phosphorus Application Level Alleviated Adverse Effects of Low-Temperature Stress on Antioxidant Metabolism and Carbohydrate Metabolism in Tobacco Seedlings. Agronomy. 2024; 14(12):2902. https://doi.org/10.3390/agronomy14122902

Chicago/Turabian Style

Xu, Wenzheng, Qiaozhen Liu, Youhua Wang, and Zhaohui Wu. 2024. "Increasing Phosphorus Application Level Alleviated Adverse Effects of Low-Temperature Stress on Antioxidant Metabolism and Carbohydrate Metabolism in Tobacco Seedlings" Agronomy 14, no. 12: 2902. https://doi.org/10.3390/agronomy14122902

APA Style

Xu, W., Liu, Q., Wang, Y., & Wu, Z. (2024). Increasing Phosphorus Application Level Alleviated Adverse Effects of Low-Temperature Stress on Antioxidant Metabolism and Carbohydrate Metabolism in Tobacco Seedlings. Agronomy, 14(12), 2902. https://doi.org/10.3390/agronomy14122902

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop