Next Article in Journal
Revolutionizing Maize Crop Productivity: The Winning Combination of Zigzag Planting and Deep Nitrogen Fertilization for Maximum Yield through Root–Shoot Ratio Management
Next Article in Special Issue
Genome-Wide Syntenic and Evolutionary Analysis of 30 Key Genes Found in Ten Oryza Species
Previous Article in Journal
Design Optimization and Mechanism Analysis of Water Jet-Type Inter-Plant Weeding Device for Water Fields
Previous Article in Special Issue
RicePedigree: Rice Pedigree Database for Documentation and Assistance in Rice Breeding
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of flo4-6, a Novel cyOsPPDKB Allele Conferring Floury Endosperm Characteristics Suitable for Dry-Milled Rice Flour Production

1
National Institute of Crop Science, Rural Development Administration, Wanju 55365, Republic of Korea
2
Department of Crop Science and Biotechnology, Jeonbuk National University, Jeonju 54896, Republic of Korea
*
Authors to whom correspondence should be addressed.
Agronomy 2023, 13(5), 1306; https://doi.org/10.3390/agronomy13051306
Submission received: 12 February 2023 / Revised: 25 April 2023 / Accepted: 4 May 2023 / Published: 6 May 2023
(This article belongs to the Special Issue Rice and Wheat Breeding: Conventional and Novel Approaches)

Abstract

Rice cultivars with floury endosperm provide a useful raw material for producing dry-milled rice flour, helping to enhance the processed rice food industry. To expand the genetic resources for breeding floury endosperm rice cultivars, we developed Samkwang(SA)-flo3 (SK-flo3), a floury endosperm mutant line derived from the chemical mutagenesis of Samkwang, an elite Korean japonica rice cultivar. Compared with Samkwang, SK-flo3 showed significantly lower grain hardness, which is suitable for producing dry-milled flour without the soaking and drying processes required in regular wet rice milling. The dry-milled flour of SK-flo3 exhibited excellent physicochemical properties with less damaged starch and finer flour particles relative to Samkwang. Genetic analyses revealed a G-to-A point mutation in exon 7 of cyOsPPDKB, substituting glycine with aspartic acid as a causative mutation for the floury endosperm of SK-flo3. We named this allele flo4-6 and developed a molecular marker to efficiently transfer it to commercial rice cultivars. Our results provide useful genetic resources and information for developing specialty rice cultivars for high-quality rice flour production with reduced milling costs.

1. Introduction

Rice is a major cereal crop consumed as a staple by nearly four billion people globally [1]. However, rice consumption in many Asian countries has been gradually decreasing over the past few decades because of dietary diversification and globalization and the increasing consumption of wheat, meat, dairy products, vegetables, and fruits [2]. In South Korea, annual rice consumption per capita declined drastically from 116.3 kg in 1991 to 56.9 kg in 2021 [3]. On the other hand, rice consumed as processed food, such as bread, noodles, cookies, liquor, and plant-based meat, has been continuously increasing, with rice flour accounting for approximately 70% of the total rice used for processed food [4]. To further boost rice consumption and secure rice production infrastructure, the Korean government has launched policy initiatives to enhance the processed food industry using rice flour to produce various food products [5].
Unlike the dry milling process commonly used to make wheat flour, rice grains generally require a wet milling process for pulverization because of their high grain hardness. This entails the complicated procedures of soaking rice grains for softening prior to milling and the subsequent drying and sterilizing of the milled flour, which leads to high production costs as well as environmental issues surrounding wastewater [6]. Hence, developing rice cultivars suitable for dry milling has been suggested as one of the crop improvement approaches to boost rice consumption by providing improved raw materials for the processed rice food industry [7].
Endosperm mutants induced by chemicals or irradiation have been popularly utilized in rice to diversify grain characteristics. Among the different classes of endosperm mutants, such as ‘white core’, ‘floury’, ‘waxy’, ‘dull’, ‘sugary’, and ‘shrunken’ [8], floury mutants with loosely packed starch granules across the entire endosperm area are especially useful for producing dry-milled flour because their soft endosperm breaks easily without soaking and produces flour with a finer particle size and less damaged starch compared to regular rice cultivars [7,9]. Using such induced mutations with floury endosperm characteristics, several rice cultivars, including Suweon542, Hangaru, and Shingil, were released in Korea as specialty cultivars for dry-milled rice flour production [10,11,12]. Recently, the causal mutation underlying the floury endosperm characteristics of Suweon542 was revealed as a G-to-A SNP in exon 7 of cyOsPPDKB, a missense mutation replacing glycine with aspartic acid, and named flo4-4 (formerly flo7(t)) [12,13]. Through molecular breeding, flo4-4 was deployed to develop new rice cultivars for producing dry-milled flour, such as Baromi2 (formerly Garumi2), with improved disease resistance and AromaT with black pericarp and fragrance [14,15]. In Korea, these specialty rice cultivars with an induced cyOsPPDKB allele for dry-milled flour production are referred to as “Garussal” (“garu” means flour, and “ssal” means rice in Korean).
Rice floury endosperm mutants also provide valuable genetic materials for studying the molecular mechanisms underlying grain development and starch synthesis. To date, over 20 endosperm mutants named flo (floury) have been characterized [7,16]. These include induced mutations in genes that are directly involved in starch accumulation, such as SSIIIa (flo5), encoding a soluble starch synthase [17]; AGPL2 (flo6), encoding an ADP-glucose pyrophosphorylase [18]; Ugp1 (flo8), encoding a UDP-glucose pyrophosphorylase [19]; and GLYI7 (flo15) encoding a glyoxylase I [20]. While most flo mutants exhibit a milky-white appearance in the entire or partial region of the endosperm, their effects on grain quality traits, such as amylose content, amylopectin chain length distribution, protein, and lipid contents, as well as agronomic traits, such as plant height and grain yield components, are highly variable [7]. To utilize the floury endosperm characteristics in rice breeding, it is necessary to improve the flo allelic diversity and evaluate the effects of different mutant alleles on major agronomic traits and grain quality.
While Baromi2 carrying flo4-4 is an early maturing rice cultivar for dry-milled flour production well-adapted to the double cropping system in Korea [14], mid-late maturing rice cultivars with floury endosperm are also required to increase yield and expand adaptability. In this study, we conducted agronomic and genetic analyses on Samkwang(SA)-flo3 (SK-flo3), a floury endosperm mutant line induced by sodium azide with the genetic background of the Korean mid-late maturing elite cultivar, Samkwang (SK). We identified flo4-6 as the novel cyOsPPDKB allele responsible for the floury endosperm characteristics of SK-flo3 and evaluated its utility for breeding rice cultivars for dry-milled rice flour production.

2. Materials and Methods

2.1. Plant Material

Samkwang(SA)-flo3 is a floury endosperm mutant line derived from sodium azide (SA) treatment on a mid-late maturing non-glutinous japonica rice cultivar, Samkwang (SK). In brief, after harvesting a single panicle from each M1 plant, the ear-to-row method was used to advance generations until the M7 generation. A total of 5000 M8 lines were established as a mutant stock for forward genetics screens. Out of the six mutant lines screened as floury endosperm mutants, a line with the pedigree ‘Samkwang(SA)-M1-3810-1-2-6-1-1’, with good agronomic performance comparable to wild-type, was designated as Samkwang(SA)-flo3 (SK-flo3) for further analyses.

2.2. Evaluation of Agronomic Traits and Grain/Flour Physicochemical Properties

A preliminary yield trial (PYT) was conducted to evaluate the major agronomic traits and grain/flour physicochemical properties of SK-flo3 in the experimental field of the National Institute of Crop Science (NICS), Rural Development Administration (RDA), Wanju (35°84′ N 127°05′ E), South Korea, in 2020. The seeds of the SK-flo3 and wild-type SK were sown on April 30 and were transplanted on May 30. Each plot, consisting of eight rows (spaced by 30 cm) with thirty hills (spaced by 15 cm) per row and three plants per hill, was planted in two replications. For local adaptability trials (LATs), SK-flo3 was designated as Jeonju672 and evaluated in two different locations, Suweon (37°27′ N 126°98′ E) and Hwaseong (37°22′ N 127°04′ E), in 2021 and 2022. The seeds were sown on April 25 and were transplanted on May 25 with the planting density the same as the PYT described above in a randomized complete block design with three replications per variety. The plants were cultivated and evaluated according to the RDA’s standard evaluation methods for rice [21]. The heading date was determined when 40% of the plants in a plot showed emerged panicles. Culm length, panicle length, and tiller number were measured from 10 random hills in the middle rows of each plot. Kernels per panicle and 1000-grain weight of brown rice were measured using grains harvested from three random hills in each plot. Brown rice yield per plot was measured from the dehulled kernels of grains harvested from 80 hills.
The grain hardness of brown rice was determined by measuring the pressure at the grain breakage point using a 50 mm probe attachment of TA.XT Plus (Stable Micro Systems, Godalming, Surrey, UK) under the conditions of 0.4 mm/s and 40.0 g for test speed and trigger force, respectively. After tempering at 15% moisture, the dehulled kernels were milled using the Buhler MLU-202 laboratory mill (Buhler AG, Uzwil, Switzerland). The particle size distribution of the flour was determined using an LSI 32320 laser diffraction particle size analyzer (Beckman Coulter, CA, USA).

2.3. Genetic Analyses, Sequencing, and Molecular Marker Development

To study the genetics underlying the floury endosperm of SK-flo3, an F2 population (n = 173) derived from the cross between SK-flo3 and SK was used. Based on the visual endosperm phenotype of the F2 seeds, a chi-squared test was conducted to determine the goodness of fit of the observed phenotype to the expected segregation ratio. An additional F2 population (n = 167) derived from the cross between SK-flo3 and Baromi2, a floury endosperm rice cultivar carrying flo4-4 [13], was used for an allelism test.
As the genetic analyses revealed that SK-flo3 and flo4-4 (cyOsPPDKB carrying a G-to-A SNP in exon 8) [13] were allelic, cyOsPPDKB (Os05g0405000-2) was sequenced from SK-flo3 and wild-type SK. The amplification and Sanger sequencing of cyOsPPDKB were conducted using the customized sequencing service at Macrogen (Daejeon, Republic of Korea). To develop a molecular marker for the novel SNP in cyOsPPDKB identified from SK-flo3, a derived cleaved amplified polymorphic sequence (dCAPS) marker with a restriction enzyme RsaI was designed using dCAPS Finder 2.0 [22]. Polymerase chain reaction (PCR) was performed in a total volume of 20 μL containing 10 ng of template DNA, 5 pmol of each primer, 1.5 mM MgCl2, 0.2 mM of dNTPs, and 1U of Taq polymerase. PCR was performed under the following conditions: one cycle at 95 °C for 5 min, followed by 40 cycles of 95 °C for 20 s, 58 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 10 min. The PCR products digested with RsaI were separated on a 2% agarose gel.

3. Results

3.1. Major Agronomic Traits of SK-flo3

Major agronomic and yield-related traits of SK-flo3 (designated as Jeonju672 in LAT) were evaluated and compared with its wild-type cultivar, SK (Figure 1, Table 1). In PYT conducted in Wanju in 2020, there was no significant difference in heading date, culm length, panicle length, and tiller number between SK-flo3 and SK (Table 1). However, kernels per panicle of SK-flo3 (87) were 13.9% fewer than those of SK (101). In addition, due to its floury endosperm with loosely packed starch granules, the 1000-grain weight of the brown rice of SK-flo3 (18.5 g) was 13.1% lighter than that of SK (21.3 g) (Figure 1b, Table 1). As a result, the brown rice yield of SK-flo3 (445 kg/10 a) was 17.7% lower than that of SK (541 kg/10 a). The reduced yield of SK-flo3 relative to wild-type SK was also observed in LAT conducted in two different locations in 2021 and 2022, where the brown rice yield of SK-flo3 was 13.0–17.5% lower than that of SK.

3.2. Identification of the Causal Mutation for the Floury Endosperm of SK-flo3

To study the genetics underlying the floury endosperm phenotype of SK-flo3, an F2 population was derived from the cross between SK-flo3 and wild-type SK. The F2 population exhibited a 3:1 segregation ratio of the transparent endosperm phenotype to the floury endosperm phenotype (130 transparent:43 floury; chi-square p-value 0.965), indicating that the mutant phenotype is controlled by a single recessive gene. To further test whether the causal mutation of SK-flo3 is allelic to flo4-4, a previously reported floury endosperm mutant carrying a missense mutation in cyOsPPDKB [13], we crossed SK-flo3 with Baromi2, a Korean rice cultivar carrying the flo4-4 allele. All individuals in the F2 population (n = 167) exhibited the floury endosperm, suggesting that SK-flo3 is allelic to flo4-4.
Sequencing cyOsPPDKB (Os05g04045000-2) from SK-flo3 and SK revealed a G-to-A SNP in exon 7 from SK-flo3 relative to SK, which substitutes glycine (G) at position 354 with aspartic acid (D) (Figure 2). The ORF sequence of cyOsPPDKB was identical between SK and Nipponbare, and the G-to-A SNP in exon 7 was the only nucleotide variation of cyOsPPDKB between SK and SK-flo3 (GenBank ID: MW349590.1). We designated this mutation as flo4-6, a novel induced cyOsPPDKB allele conferring the floury endosperm phenotype. To distinguish flo4-6 from the wild-type allele, a dCAPS marker was developed with the RsaI restriction enzyme, which digests the PCR amplicon from SK-flo3 into two fragments (175 bp and 43 bp) while leaving that of the wild-type SK intact (218 bp) (Table 2, Figure 3a).
Genotyping the SK/SK-flo3 F2 population with the dCAPS marker clearly classified three different genotypes—the homozygous wild-type cyOsPPDKB from SK, the homozygous flo4-6 from SK-flo3, and the heterozygous genotype (Figure 3a). All F2:3 seeds derived from the homozygous wild-type and homozygous flo4-6 F2 plants exhibited transparent and floury endosperm, respectively, while those derived from the heterozygous plants showed a 3:1 ratio of transparent seeds to floury seeds (Figure 3b). The co-segregation pattern confirmed that the G-to-A mutation in exon 7 of cyOsPPDKB (flo4-6 allele) is responsible for the floury endosperm phenotype of SK-flo3.

3.3. Dry Milling Properties of SK-flo3

To evaluate SK-flo3 as raw material for producing dry-milled rice flour, we compared the physicochemical properties of rice grains and dry-milled flour of SK-flo3 with those of SK and Baromi2. Baromi2, formerly known as Garumi2 [28], is a major Korean rice cultivar carrying flo4-4 used for dry-milled flour production.
Grain hardness is an important factor determining dry milling suitability because the grains with low hardness produce fine flour particles preferred for enhancing end-use quality [29]. The grain hardness of brown rice of SK-flo3 was 3.0 kg, which was 67% lower than that of SK (9.2 kg) and as soft as that of Baromi2 (3.1 kg) (Table 3). The mean particle size of dry-milled flour of SK-flo3 (65.3 μm) was 28% lower than that of SK (91.1 μm) and similar to that of Baromi2 (61.5 μm). The damaged starch content of the dry-milled flour was 6.0% in SA-flo3, which was one-half the value of SK (12.0%) but slightly higher than that of Baromi2 (4.9%). There was no significant difference in the lightness and ash content of dry-milled flour among SK-flo3, SK, and Baromi2. Overall, our analyses suggest that SK-flo3 and its novel cyOsPPDKB allele, flo4-6, provide a useful genetic resource for developing rice cultivars suitable for dry-milled flour production.

4. Discussion

In this study, we developed a rice mutant line SK-flo3 with floury endosperm through chemical mutagenesis. Analyses of agronomic and physicochemical traits demonstrated that SK-flo3 provides a useful genetic resource for breeding cultivars suitable for dry-milled rice flour production. Through genetic analyses, we identified flo4-6 as a novel mutated cyOsPPDKB allele causative of the floury endosperm phenotype of SK-flo3 and developed a dCAPS marker for efficiently transferring flo4-6 during molecular breeding. In this section, we discuss the practical use of flo4-6 in rice breeding programs, the comparison of flo4-6 with previously identified flo4 alleles, and future research prospects regarding rice starch biosynthesis.
Samkwang, the wild-type cultivar of SK-flo3, is a high-quality medium-late maturing japonica rice cultivar recorded as having the largest seed production of government-certified seeds in Korea from 2017 to 2020 [30]. As SK-flo3 retains the elite genetic background of Samkwang, it represents useful breeding material to develop rice cultivars for dry-milled flour production with high quality. Our study demonstrated that SK-flo3 possesses excellent dry milling properties, such as low grain hardness, fine flour particle size, and low damaged starch content, which are comparable to Suweon542 [12], a previously developed floury endosperm mutant in the genetic background of Namil, a Korean japonica rice cultivar with early maturity. Yield reduction is a common drawback of floury endosperm cultivars because the loosely-packed starch granule structure of the floury endosperm reduces grain weight. In PYT (2020) and LAT (2021 and 2022) conducted in three different locations, SK-flo3 showed a 13.0–17.7% yield reduction relative to wild-type SK. As the yield reduction observed in SK-flo3 is more severe than that observed in Suweon542, which showed only a 6% decrease relative to wild-type Namil [12], breeding efforts are underway to improve the yield potential of SK-flo3 by crossing it with high-yielding japonica cultivars. Similar breeding efforts have proven successful in breeding Baromi2, which was developed by crossing Suweon542 with Jopyeong to improve disease resistance and preharvest sprouting tolerance and is currently used as a main rice cultivar for producing dry-milled flour in Korea [14].
The causal mutation for the floury endosperm of SK-flo3 was revealed as an amino acid substitution mutation in exon 7 of cyOsPPDKB. We named this flo4-6 as a novel induced allele of flo4 [23]. Including flo4-6, nine different flo4 alleles have been reported so far (Figure 2, Table 4). These include three insertional mutant alleles induced by transgenic approaches (flo4-1, flo4-2, and flo4-3), four chemically mutagenized alleles (flo4-4, flo4-5, flo4-6, and floTR1), and two radioactively mutagenized alleles (M14 and flo4-303) (see Table 4 for the relevant references). All nine flo4 mutants exhibit a white non-translucent appearance throughout the endosperm with a loosely packed starch granule structure, resulting in a decrease in grain weight of 6–16% (Table 4). These characteristics are also observed in other floury endosperm mutants carrying induced mutations in different flo genes, such as FLO2, AGPL2, FLO10, AlaAT1, NDUFA9, NPPR3, and CMDH (reviewed in [7]). Unlike the common endosperm appearance and reduced grain weight, physicochemical traits showed wide variation among different flo4 mutants (Table 4). For example, the changes in amylose content relative to the wild type ranged from a 46% decrease in floTR1 to a 5% increase in flo4-4, and those in the protein content ranged from an 18% decrease in flo4-4 to a 16% increase in floTR1. Considering the flo4 mutants were developed under different genetic backgrounds and carry a number of random background mutations from chemical or radioactive mutagenesis, it is currently unclear whether the wide variation in the physicochemical traits are the effects of different cyOsPPDKB alleles or whether there are other underlying genetic causes. Developing near-isogenic lines (NILs) carrying different flo4 alleles in the identical genetic background would help answer this question. The NILs are also required for evaluating the more precise effects of different flo4 alleles on agronomic, physicochemical, and milling properties. This will provide breeders with information that can be used when choosing proper flo4 alleles. Further evaluation on the quality of processed food made from rice flour, such as bread, noodles, and cookies, would also facilitate the utilization of the floury endosperm rice cultivars, as recently demonstrated by floTR4, which confers enhanced bread loaf volume as well as dry milling properties [26].
Allelic variation in cyOsPPDKB also provides useful material for gene function studies. Pyruvate orthophosphate dikinase (PPDK) encoded by the PPDK gene is an enzyme that produces pyruvate and ATP from PEP, PPi, and AMP [32]. Rice OsPPDKB produces two different transcripts—a chloroplastic PPDKB (chOsPPDKB; Os05t0405000-01) and a cytoplasmic PPDKB (cyOsPPDKB; Os05t0405000-02). Of these, cyOsPPDKB is expressed highly in the endosperm and is considered to play an important role in compensating for the lack of ATP under anaerobic conditions in the developing endosperm [32]. The current study, as well as previous research, demonstrates that cyOsPPDKB plays a crucial role in rice endosperm starch synthesis because not only the knockout mutations (flo4-1, flo4-2, flo4-3, and flo4-303) but also the missense mutations (flo4-4, flo 4-5, flo 4-6, M17, and flo-TR) substituting an amino acid in different protein regions exhibit the similar floury endosperm appearance (Figure 2, Table 4). As these mutants show wide variation in other physicochemical properties, such as amylose and protein contents, a more precise molecular genetics study is required to further elucidate the function of cyOsPPDKB in rice endosperm development. In addition to the mutant flo4 alleles, creating an allelic variation with an identical genetic background using a gene editing tool, such as CRISPR-Cas9, would help elucidate the molecular function of cyOsPPDKB and evaluate its role in grain development.

5. Patents

Patent number; 10-2020-0181310 (application date: 22 December 2020).

Author Contributions

Conceptualization, J.-U.J.; investigation, S.-K.H., H.-S.L., S.Y.L. and C.-M.L.; writing—original draft preparation, S.-K.H. and S.Y.L.; writing—review and editing, Y.M.; supervision, Y.M. and J.-U.J.; project administration, J.-U.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Institute of Crop Science, Rural Development Administration of South Korea (PJ016831012022).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available upon request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Fukagawa, N.K.; Ziska, L.H. Rice: Importance for Global Nutrition. J. Nutr. Sci. Vitam. 2019, 65, S2–S3. [Google Scholar] [CrossRef] [PubMed]
  2. Pingali, P. Westernization of Asian Diets and the Transformation of Food Systems: Implications for Research and Policy. Food Policy 2007, 32, 281–298. [Google Scholar] [CrossRef]
  3. KOSTAT. The 2021 Results of Grain Consumption Survey. 2021. Available online: http://kostat.go.kr/portal/korea/kor_nw/1/4/8/index.board (accessed on 24 December 2022).
  4. Kim, M.H. Review on Rice Flour Manufacturing and Utilization. J. Biosyst. Eng. 2013, 38, 103–112. [Google Scholar] [CrossRef][Green Version]
  5. Jeong, O.Y.; Park, H.S.; Baek, M.K.; Kim, W.J.; Lee, G.M.; Lee, C.M.; Bombay, M.; Ancheta, M.B.; Lee, J.H. Review of Rice in Korea: Current Status, Future Prospects, and Comparisons with Rice in Other Countries. J. Crop Sci. Biotechnol. 2021, 24, 1–11. [Google Scholar] [CrossRef]
  6. Chiang, P.-Y.; Yeh, A.-I. Effect of Soaking on Wet-Milling of Rice. J. Cereal Sci. 2002, 35, 85–94. [Google Scholar] [CrossRef]
  7. Mo, Y.; Jeung, J.-U. The Use of Floury Endosperm Mutants to Develop Rice Cultivars Suitable for Dry Milling. Plant Biotechnol. Rep. 2020, 14, 185–191. [Google Scholar] [CrossRef]
  8. Satoh, H.; Omura, T. New Endosperm Mutations Induced by Chemical Mutagens in Rice Oryza sativa L. Jpn. J. Breed. 1981, 31, 316–326. [Google Scholar] [CrossRef]
  9. Araki, E.; Ashida, K.; Aoki, N.; Takahashi, M.; Hamada, S. Characteristics of Rice Flour Suitable for the Production of Rice Flour Bread Containing Gluten and Methods of Reducing the Cost of Producing Rice Flour. Jpn. Agric. Res. Q. 2016, 50, 23–31. [Google Scholar] [CrossRef]
  10. Won, Y.-J.; Ahn, E.-K.; Jeong, E.-G.; Chang, J.-K.; Lee, J.-H.; Jung, K.-H.; Hyun, U.-J.; Cho, Y.-C.; Oh, S.-K.; Yoon, M.-R.; et al. An Opaque Endosperm Rice Cultivar, ‘Hangaru’, Suitable for Exclusive Dry-Milling Rice Flour Production. Korean J. Breed. Sci. 2019, 51, 134–139. [Google Scholar] [CrossRef]
  11. Cho, Y.; Baek, M.; Park, H.; Cho, J.; Ahn, E.; Suh, J.; Jeung, J. ‘Shingil (Milyang317)’, Tongil-Type Variety Specialized for Rice Flour. Korean J. Breed. Sci. 2020, 72, 58–72. [Google Scholar] [CrossRef]
  12. Mo, Y.; Jeung, J.-U.; Shin, Y.-S.; Park, C.S.; Kang, K.-H.; Kim, B.-K. Agronomic and Genetic Analysis of Suweon 542, a Rice Floury Mutant Line Suitable for Dry Milling. Rice 2013, 6, 37. [Google Scholar] [CrossRef] [PubMed]
  13. Wang, H.; Mo, Y.; Im, D.E.; Jang, S.G.; Ham, T.H.; Lee, J.; Jeung, J.U.; Kwon, S.W. A New SNP in CyOsPPDK Gene is Associated with Floury Endosperm in Suweon 542. Mol. Genet. Genom. 2018, 293, 1151–1158. [Google Scholar] [CrossRef] [PubMed]
  14. Ha, S.K.; Kim, B.-K.; Hwang, W.-H.; Mo, Y.; Jeong, J.-M.; Lee, D.-K.; Kim, W.-J.; Kim, J.-J.; Jeong, J.-U. Early Maturing Rice Variety “Baromi2” with a Floury Endosperm and Suitable for Dry-Milling of Rice Grain. Korean J. Breed. Sci. 2022, 54, 433–441. [Google Scholar] [CrossRef]
  15. Ha, S.K.; Mo, Y.; Jeong, J.-M.; Lee, H.-S.; Kim, J.; Seo, W.-D.; Jeong, J.-U. Agronomic and End-Use Quality Analysis of “AromaT”, a Black Rice (Oryza sativa L.) Variety with Floury Endosperm. Korean J. Crop Sci. 2022, 67, 9–16. [Google Scholar] [CrossRef]
  16. Yang, H.; Wang, Y.; Tian, Y.; Teng, X.; Lv, Z.; Lei, J.; Duan, E.; Dong, H.; Yang, X.; Zhang, Y.; et al. Rice FLOURY ENDOSPERM22, Encoding a Pentatricopeptide Repeat Protein, Is Involved in Both Mitochondrial RNA Splicing and Editing and Is Crucial for Endosperm Development. J. Integr. Plant Biol. 2023, 65, 755–771. [Google Scholar] [CrossRef]
  17. Ryoo, N.; Yu, C.; Park, C.S.; Baik, M.Y.; Park, I.M.; Cho, M.H.; Bhoo, S.H.; An, G.; Hahn, T.R.; Jeon, J.S. Knockout of a Starch Synthase Gene OsSSIIIa/Flo5 Causes White-Core Floury Endosperm in Rice (Oryza satva L.). Plant Cell Rep. 2007, 26, 1083–1095. [Google Scholar] [CrossRef]
  18. Zhang, D.; Wu, J.; Zhang, Y.; Shi, C. Phenotypic and Candidate Gene Analysis of a New Floury Endosperm Mutant (Osagpl2-3) in Rice. Plant Mol. Biol. Report. 2012, 30, 1303–1312. [Google Scholar] [CrossRef]
  19. Long, W.; Dong, B.; Wang, Y.; Pan, P.; Wang, Y.; Liu, L.; Chen, X.; Liu, X.; Liu, S.; Tian, Y.; et al. FLOURY ENDOSPERM8, Encoding the UDP-Glucose Pyrophosphorylase 1, Affects the Synthesis and Structure of Starch in Rice Endosperm. J. Plant Biol. 2017, 60, 513–522. [Google Scholar] [CrossRef]
  20. You, X.; Zhang, W.; Hu, J.; Jing, R.; Cai, Y.; Feng, Z.; Kong, F.; Zhang, J.; Yan, H.; Chen, W.; et al. FLOURY ENDOSPERM15 Encodes a Glyoxalase I Involved in Compound Granule Formation and Starch Synthesis in Rice Endosperm. Plant Cell Rep. 2019, 38, 345–359. [Google Scholar] [CrossRef]
  21. RDA. Manual for Standard Evaluation Method in Agricultural Experiment and Research; RDA Press: Suweon, Republic of Korea, 2012; pp. 317–338. ISBN 978-8-948-01649-9. [Google Scholar]
  22. Neff, M.M.; Turk, E.; Kalishman, M. Web-Based Primer Design for Single Nucleotide Polymorphism Analysis. Trends Genet. 2002, 18, 613–615. [Google Scholar] [CrossRef]
  23. Kang, H.G.; Park, S.; Matsuoka, M.; An, G. White-Core Endosperm floury endosperm-4 in Rice Is Generated by Knockout Mutations in the C4-Type Pyruvate Orthophosphate Dikinase Gene (OsPPDKB). Plant J. 2005, 42, 901–911. [Google Scholar] [CrossRef]
  24. Wang, H.; Ham, T.H.; Im, D.E.; Lar, S.M.; Jang, S.G.; Lee, J.; Mo, Y.; Jeung, J.U.; Kim, S.T.; Kwon, S.W. A New SNP in Rice Gene Encoding Pyruvate Phosphate Dikinase (PPDK) Associated with Floury Endosperm. Genes 2020, 11, 465. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, L.; Zhao, L.; Lin, L.; Zhao, L.; Liu, Q.; Wei, C. A Novel Mutation of OsPPDKB, Encoding Pyruvate Orthophosphate Dikinase, Affects Metabolism and Structure of Starch in the Rice Endosperm. Int. J. Mol. Sci. 2018, 19, 2268. [Google Scholar] [CrossRef] [PubMed]
  26. Muroyama, R.; Ito, H.; Takahashi, S.; Kang, D.J.; Hamada, S. Biochemical Analysis of a Novel Allele of the OsPPDKB Gene Associated with Floury Endosperm. J. Cereal Sci. 2022, 107, 103529. [Google Scholar] [CrossRef]
  27. Matsuba, S.; Maruyama-Funatsuki, W.; Umemoto, T.; Kato, H.; Kuroki, M.; Yokogami, N.; Ikegaya, T.; Shimizu, H.; Iriki, N. The Induced Mutant Allele flo4-303 Confers Floury Characteristics on the Japonica Rice Cultivar ‘Hoshinoko’. Breed. Sci. 2022, 72, 383–388. [Google Scholar] [CrossRef] [PubMed]
  28. Jeong, J.-U.; Kim, B.-K.; Hwang, W.-H.; Mo, Y.; Jeong, J.-M.; Lee, D.-K.; Ha, S.K.; Kim, W.-J.; Kim, J.-J. New Rice Cultivar, Garumi1 and Garumi2 Suitable for Dry Milling. Korea Intellectual Property Rights Information Service. 2019. Available online: http://kpat.kipris.or.kr/kpat/biblioa.do?method=biblioFrame&link=Y&applno=1020200066078&pub_reg= (accessed on 7 February 2023).
  29. Ashida, K.; Iida, S.; Yasui, T. Morphological, Physical, and Chemical Properties of Grain and Flour from Chalky Rice Mutants. Cereal Chem. 2009, 86, 225–231. [Google Scholar] [CrossRef]
  30. Jeong, J.-U.; Shin, Y.-S. Evaluations on the Namil(SA)-Flo1, a Floury Japonica Rice Line, for Dry Milling Process to Produce Rice Flour. Korean J. Crop Sci. 2011, 56, 57–63. [Google Scholar] [CrossRef][Green Version]
  31. Korea Seed & Variety Service. Available online: https://www.seed.go.kr/sites/seed_eng/index..do (accessed on 2 January 2023).
  32. Lee, S.K.; Jeon, J.S. Review: Crucial Role of Inorganic Pyrophosphate in Integrating Carbon Metabolism from Sucrose Breakdown to Starch Synthesis in Rice Endosperm. Plant Sci. 2020, 298, 110572. [Google Scholar] [CrossRef]
Figure 1. Phenotypic comparison between Samkwang(SA)-flo3 (SK-flo3), a floury endosperm mutant line, and Samkwang (SK), the wild-type cultivar. Plants at maturity (a) and hulled rice, brown rice, and their cross-sections (b).
Figure 1. Phenotypic comparison between Samkwang(SA)-flo3 (SK-flo3), a floury endosperm mutant line, and Samkwang (SK), the wild-type cultivar. Plants at maturity (a) and hulled rice, brown rice, and their cross-sections (b).
Agronomy 13 01306 g001
Figure 2. The structure of cyOsPPDKB and the sequence near the mutation site in SK-flo3 relative to wild-type SK. The G-to-A mutation in exon 7 of SK-flo3 is highlighted in red boxes. Previously reported allelic mutants of cyOsPPDKB are indicated in blue boxes, i.e., flo4-1 through flo4-3 [23], flo4-4 [13], flo4-5 [24], M14 [25], floTR1 [26], and flo4-303 [27].
Figure 2. The structure of cyOsPPDKB and the sequence near the mutation site in SK-flo3 relative to wild-type SK. The G-to-A mutation in exon 7 of SK-flo3 is highlighted in red boxes. Previously reported allelic mutants of cyOsPPDKB are indicated in blue boxes, i.e., flo4-1 through flo4-3 [23], flo4-4 [13], flo4-5 [24], M14 [25], floTR1 [26], and flo4-303 [27].
Agronomy 13 01306 g002
Figure 3. Co-segregation analysis of the cyOsPPDKB genotype and endosperm phenotype. (a) Genotyping SK, SK-flo3, and the F2 plants derived from the SK/SK-flo3 cross using the dCAPS marker for flo4-6. (b) Endosperm phenotype of the F2:3 seeds according to the cyOsPPDKB genotype of F2. M indicates a size marker. A, B, and H indicate the homozygous wild-type (SK), the homozygous flo4-6 (SK-flo3), and the heterozygous genotype, respectively.
Figure 3. Co-segregation analysis of the cyOsPPDKB genotype and endosperm phenotype. (a) Genotyping SK, SK-flo3, and the F2 plants derived from the SK/SK-flo3 cross using the dCAPS marker for flo4-6. (b) Endosperm phenotype of the F2:3 seeds according to the cyOsPPDKB genotype of F2. M indicates a size marker. A, B, and H indicate the homozygous wild-type (SK), the homozygous flo4-6 (SK-flo3), and the heterozygous genotype, respectively.
Agronomy 13 01306 g003
Table 1. Comparison of major agronomic traits between Samkwang(SA)-flo3 (SK-flo3, designated as Jeonju672 in LAT) and Samkwang (SK).
Table 1. Comparison of major agronomic traits between Samkwang(SA)-flo3 (SK-flo3, designated as Jeonju672 in LAT) and Samkwang (SK).
TrialLocationVarietyHD
(mm/dd)
CL
(cm)
PL
(cm)
TN
(No.)
SN
(No.)
TGW
(g)
BRY
(kg/10 a)
Yield
Decrease (%)
PYTWanjuSK-flo38/1476 ± 1.719 ± 0.715 ± 1.887 ± 20.6 *18.5 ± 0.62 *445 ± 24.0 *–17.7
SK8/1377 ± 2.120 ± 0.314 ± 2.9101 ± 12.521.3 ± 0.52541 ± 19.6
LATSuweonSK-flo38/1586 ± 5.119 ± 0.614 ± 1.3119 ± 13.418.9 ± 0.56 **591 ± 49.6 *–13.0
SK8/1688 ± 4.120 ± 1.615 ± 1.8121 ± 13.821.9 ± 0.70679 ± 66.3
HwaseongSK-flo38/1680 ± 5.417 ± 1.3 *13 ± 1.594 ± 15.921.9 ± 2.66491 ± 44.6 *–17.5
SK8/1581 ± 3.519 ± 1.213 ± 0.9109 ± 16.823.4 ± 0.77595 ± 94.9
PYT: preliminary yield trial (2020); LAT: local adaptability trial (2021 and 2022); HD: heading date; CL: culm length; PL: panicle length; TN: tiller number per plant; SN: spikelet number per panicle; TGW: 1000-grain weight of brown rice; BRY: brown rice yield. * p < 0.05; ** p < 0.01. The p values are from Student’s t-tests for PYT and 2-way (year × variety) ANOVAs for LAT.
Table 2. dCAPS marker for distinguishing flo4-6 of SK-flo3 from wild-type cyOsPPDKB of SK.
Table 2. dCAPS marker for distinguishing flo4-6 of SK-flo3 from wild-type cyOsPPDKB of SK.
Primer Sequence (5′ to 3′)Restriction
Enzyme
Fragment Size
F: GATTTGAAACGTCTTGATCATGC
R: AGCATGAACTTGGTCACCTTCTGTCTACAGCAATCTTTACAGTA
RsaISK-flo3: 218 bp
(intact)
SK: 175 bp and 43 bp
(digested)
Underlined: tail sequence added for size discrimination.
Table 3. Physicochemical properties of rice grains and dry-milled flour.
Table 3. Physicochemical properties of rice grains and dry-milled flour.
VarietyGrain
Hardness
(kg)
Dry-Milled Rice Flour
Mean Particle Size
(μm)
Damaged Starch (%)Amylose
(%)
Protein
(%)
Lightness
(CIE Value)
Ash
(%)
SK-flo33.0 ± 0.34 a65.3 ± 0.86 a6.0 ± 0.09 a15.6 ± 0.55 a6.2 ± 0.06 a92.6 ± 1.82 a0.64 ± 0.01 a
SK9.2 ± 0.82 b91.1 ± 0.73 b12.0 ± 0.13 b18.0 ± 1.08 b6.4 ± 0.10 a93.2 ± 1.49 a0.67 ± 0.01 a
Baromi23.1 ± 0.33 a61.5 ± 1.36 a4.9 ± 0.02 c17.0 ± 1.33 b 6.5 ± 0.45 a 91.2 ± 0.03 a0.58 ± 0.01 a
Different letters indicate significant differences according to Tukey’s HSD test (p < 0.05).
Table 4. Allelic mutants of cyOsPPDKB characterized in rice.
Table 4. Allelic mutants of cyOsPPDKB characterized in rice.
MutantMutagen
(Wild-Type)
Effect
(Position z)
GWACPCLCHDPSDSRef.
flo4-1T-DNA
(Dongjin)
insertional
(intron 3)
6%↓15%↓~5%↑ y~30%↑ y---[17,23]
flo4-2Tos17
(Hwayoung)
insertional
(exon 8)
7%↓15%↓~5%↑ y~35%↑ y---[17,23]
flo4-3T-DNA
(Hwayoung)
insertional
(intron 3)
-------[23]
flo4-4
[flo7(t)]
sodium azide
(Namil)
Gly→Asp
(exon 8)
16%↓5%↑18%↓-56%↓25%↓47%↓[12,13]
flo4-5sodium azide
(Namil)
Ser→Phe
(exon 2)
11%↓=15%↓107%↑55%↓21%↓45%↓[24,31]
M14gamma-ray
(Kitaake)
Leu→Phe
(exon 13)
11%↓13%↓=----[25]
floTR1sodium azide
(Tsugaruroman)
Gly→Asp
(exon 17)
11%↓46%↓16%↑--50%↓ x27%↓[26]
flo4-303gamma-ray
(Hoshinoyume)
frame-shift
(exon 7)
10%↓14%↓---38%↓ x40%↓[27]
flo4-6sodium azide
(Samkwang)
Gly→Asp
(exon 7)
6–14%↓13%↓=-67%↓28%↓50%↓this study
GW grain weight; AC amylose content; PC protein content; LC lipid content; HD hardness of rice grain; PS particle size of rice flour; DS damaged starch content; ↑ increase, ↓ decrease, and = equivalent relative to wild-type; - unavailable. z See Figure 2 for the positions of the causal mutations. The exon/intron position is based on the Os05g0405000-2 annotation for cyOsPPDKB. y PC and LC changes in flo4-1 and flo4-2 relative to wild-type were estimated based on the bar graphs in the figures of the relevant references. x median particle size for floTR1 and flo4-303, while the rest are the mean particle size.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ha, S.-K.; Lee, H.-S.; Lee, S.Y.; Lee, C.-M.; Mo, Y.; Jeung, J.-U. Characterization of flo4-6, a Novel cyOsPPDKB Allele Conferring Floury Endosperm Characteristics Suitable for Dry-Milled Rice Flour Production. Agronomy 2023, 13, 1306. https://doi.org/10.3390/agronomy13051306

AMA Style

Ha S-K, Lee H-S, Lee SY, Lee C-M, Mo Y, Jeung J-U. Characterization of flo4-6, a Novel cyOsPPDKB Allele Conferring Floury Endosperm Characteristics Suitable for Dry-Milled Rice Flour Production. Agronomy. 2023; 13(5):1306. https://doi.org/10.3390/agronomy13051306

Chicago/Turabian Style

Ha, Su-Kyung, Hyun-Sook Lee, Seung Young Lee, Chang-Min Lee, Youngjun Mo, and Ji-Ung Jeung. 2023. "Characterization of flo4-6, a Novel cyOsPPDKB Allele Conferring Floury Endosperm Characteristics Suitable for Dry-Milled Rice Flour Production" Agronomy 13, no. 5: 1306. https://doi.org/10.3390/agronomy13051306

APA Style

Ha, S.-K., Lee, H.-S., Lee, S. Y., Lee, C.-M., Mo, Y., & Jeung, J.-U. (2023). Characterization of flo4-6, a Novel cyOsPPDKB Allele Conferring Floury Endosperm Characteristics Suitable for Dry-Milled Rice Flour Production. Agronomy, 13(5), 1306. https://doi.org/10.3390/agronomy13051306

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop