Next Article in Journal
Fruit Quality and Primary and Secondary Metabolites Content in Eight Varieties of Blood Oranges
Previous Article in Journal
Weed Strategy Considering the Weed Control Effect and Weed Control Uniformity with Microsprinkler Irrigation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 13
Issue 4
10.3390/agronomy13041036
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Plant Rhizospheres Harbour Specific Fungal Groups and Form a Stable Co-Occurrence Pattern in the Saline-Alkali Soil

by
Zhen Liu
1,
Jing Li
1,
Ruixing Hou
1,
Yitao Zhang
1,
Huarui Gong
1,
Yanfei Sun
2,*,
Zhu Ouyang
1,3,4 and
Zhigang Sun
1,3,4
1
CAS Engineering Laboratory for Yellow River Delta Modern Agriculture, Institute of Geographic Sciences and Natural Resources Research, Chinese Academy of Sciences, Beijing 100101, China
2
Key Laboratory of Genetics and Germplasm Innovation of Tropical Special Forest Trees and Ornamental Plants, Ministry of Education, College of Forestry, Hainan University, Haikou 570228, China
3
College of Resources and Environment, University of Chinese Academy of Sciences, Beijing 100049, China
4
Shandong Dongying Institute of Geographic Sciences, Dongying 257000, China
*
Author to whom correspondence should be addressed.
Agronomy 2023, 13(4), 1036; https://doi.org/10.3390/agronomy13041036
Submission received: 7 March 2023 / Revised: 21 March 2023 / Accepted: 29 March 2023 / Published: 31 March 2023
(This article belongs to the Section Soil and Plant Nutrition)
Browse Figures
Versions Notes

Abstract

:
Soil salinisation has been considered a substantial ecosystem issue with negative effects on sustainable agricultural practices. Practices of vegetation restoration are widely conducted for coping with saline soil degradation, especially in saline-alkali abandoned farmland. Compared with bulk soils, the rhizosphere soils of plants have different microbial community structures. However, how associations and functions of microbes vary in the rhizosphere and bulk soils of salt-tolerant plants remains unclear, limiting the successful implementation and efficacy of vegetation in restoring saline-alkali lands. Here, we analysed the fungal community composition, functional guilds, and co-occurrence networks in both rhizosphere and bulk soils of typical plant species in the abandoned farmland of the Yellow River Delta, China. Not all plant species had significantly different fungal community compositions and relative functional guild abundances between the rhizosphere and bulk soil. Soil nutrient concentrations explained more variance in the soil fungal community. Network analyses indicated that the rhizosphere fungal network had more nodes and links, more negative links, and higher modularity; however, fewer species were involved in the meta-module than those in the bulk soil network, indicating a more complex topology and niche differentiation therein. More generalist species and indicator taxa essential for carbon and nitrogen cycling (e.g., Sordariomycetes and Dothideomycetes) were identified in the salt-tolerant plant rhizosphere network. Overall, the salt-tolerant plants’ rhizosphere had a more stable fungal co-occurrence network and recruited more keystone species compared to the bulk soil, which could benefit soil nutrient cycling and soil restoration in abandoned farmlands.

1. Introduction

Soil salinisation is a major global problem that hinders efficient land utilisation and destroys ecosystem multifunctionality [1,2]. Salinized soil covers approximately 25% of the global earth’s surface, and it is expanding at an unprecedented rate due to climate change and non-sustainable agricultural practices [3]. The increase in soil salt concentration can induce the soil structural deterioration, e.g., swelling, dispersion, and hard setting, inhibition of biotic activities, and deficiencies of soil nutrients [4,5]. Hence, soil salinisation significantly detrimentally affects soil physicochemical and biological properties, soil nutrient availability, plant growth, and yield in agroecosystems [4,5]. About 15% of the world’s land has been degraded due to salinisation and soil erosion, leading to desertification [5]. Adequate use of saline soils has attracted increasing attention and many approaches have been used to remediate saline soils [6].
Vegetation restoration has emerged as a sustainable, cost-effective way for coping with saline soil degradation [7]. Salt-tolerant plants, e.g., halophytes, can adapt to saline conditions by evolving specific mechanisms for resisting and/or tolerating excess salt in the soil without affecting their life processes [8]. Thus, these specialised plant groups play a vital role in reducing soil salinity via roots absorption and increasing saline soil fertility via organic inputs [9]. In recent years, the plant-microbiota association has attracted wide attention, because soil microbes facilitate scarce nutrient acquisition for plants [10]. Accumulating evidence proves that soil microbes substantially contribute to the plant’s salt tolerance [11,12]. Therefore, understanding of plant and microbiota associations is critical to establish microbe-based strategies for efficient agriculture and plant revegetation in saline-alkali lands [10].
Because of the high salt stress and low soil nutrient content in saline-alkali lands, soil microbes, including bacteria and fungi, provide nutrients and improve the nutrient utilisation and salt stress for plants [13]. Especially important, the hyphal network extension of fungi enables an expansion of the soil-residue interface (interface between decaying plant residues and soil) and is easy for nutrient translocation therein [14]. In such a scenario, the researchers have focused on the interactions of plants and soil fungi in saline-alkali lands and found that the salt-tolerant plants can select different fungal community compositions during the plant restoration, thus influencing soil biogeochemical cycling [12,13,15,16]. That is, salt-tolerant plants can shape and enhance rhizodeposits and root exudation, resulting in a special fungal composition and accelerating the employment of a beneficial rhizosphere microbiome under excess salt conditions [17,18]. In turn, the beneficial microbes can decrease the adverse effects of salt stress on plant growth by providing exopolysaccharides, organic acids, phytohormones, etc., in the rhizosphere [5,8,13]. The development of a unique soil fungi composition in the rhizosphere contributes not only to environmental variables, such as plant species and developmental stage, but also to interactions among microbial taxa [19,20,21]. For example, some certain fungi can recruit beneficial bacteria colonization and antagonise plant pathogens [8,10,14]. Considering that soil microbial taxa associate with each other, forming interactive networks that can significantly regulate the structure of ecological communities and ecosystem functions [22,23], such interactions may be more useful than environmental factors for plant growth in the saline-alkali soil [24]. Since rhizosphere fungal diversity significantly affects plant metabolisms coping with salinisation [8], it is urgently needed to investigate the effects of salt-tolerant plants on the fungal community in their rhizosphere and bulk soil and the interactions among the fungal species.
To address this, the present study aimed to analyse soil fungal composition and the interactions among fungal species in the rhizosphere and bulk soil of typical plants in the saline-alkali abandoned farmland of Yellow River Delta (YRD). We hypothesised that, compared with bulk soils, rhizosphere soils of salt-tolerant plants would have a greater complexity and functionality of networks in saline-alkali soils as a result of both lower salt stress and higher nutrient availability. Thus, we analysed fungal compositions and co-occurrence networks in the rhizosphere and bulk soils of four different salt-tolerant plants. Soil pH, electric conductivity, and nutrient contents were also measured to evaluate salt stress and nutrient availability in rhizosphere.

2. Materials and Methods

2.1. Site Information

The study was conducted in the lower YRD of the Shandong Province, China (37°39′55″–37°40′58″ N, 118°54′41″–118°56′21″ E). The research site is characterised by a warm temperate zone continental monsoon climate. The mean temperature, annual precipitation, and evaporation are 12.40 °C, 530–630, and 1962 mm, respectively [25]. The main soil type in this region is Calcaric Fluvisol, comprising 0.12% clay, 19.99% silt, and 79.89% sand, with a soil pH of 8.04–8.53 [26]. The region contains a large area of coastal saline-alkali lands. The salinity of soil ranges from 1‰ to 10‰ or more. High-intensity salinisation is very easy to occur in the newly formed soil due to the highly saline seawater ingress, shallow groundwater levels, high evaporation rates, and improper land reclamation activities [27]. Correspondingly, soil salinisation has considerably spread from the coastline to inland areas over the past few decades [28]. Therefore, many cultivated farmlands have been abandoned and restored to their original features. Salt-tolerant plants, including Artemisia scoparia, Phragmites communis, Tamarix chinensis, and Suaeda glauca, are widely distributed along an irregular salinity gradient.

2.2. Sample Collection and Physiochemical Analysis

In September 2019, four sampling sites (100 m × 100 m with different salinity gradients) were selected within 2 km × 2 km in the abandoned farmland, based on a preliminary investigation in the soil salinity gradient and the dominant plants. The dominant plants in the four sites, defined as Site 1~4, were A. scoparia, P. communis, T. chinensis, and S. glauca, respectively (Table 1). In each site, five plots (10 m × 10 m, 20 m apart) were randomly established for plant rhizosphere and bulk soil samples collection. In each plot, six individual plants with similar growth status were chosen; the rhizosphere soil was obtained using the shake-off method, and the bulk soil was sampled from the projection range of the plant rhizosphere (0–15 cm vertical surface) [29,30]. The rhizosphere or bulk soil from the six individual plants was mixed to create one sample. Finally, 40 composite samples (four salinity gradients × two positions (rhizosphere and bulk) × five plots) were obtained. Each sample was sieved through a 2 mm mesh to remove litters and was then divided into two subsamples: the first subsample was used for examining the soil properties, while the second one was stored at −78.5 °C for microbiological sequencing.
Electrical conductivity (EC) of the saturated soil paste extraction was measured using a FE38 conductivity meter (Mettler Toledo Co., Ltd., Zürich, Switzerland). Soil pH was determined in a suspension (soil:water, 1:2.5). Soil water content (SWC) was determined using the oven-drying method. Soil organic carbon (SOC), total nitrogen (TN), available nitrogen (AN), available phosphorus (AP), and available potassium (AK) were measured according to Bao [31].

2.3. DNA Extraction, Sequencing, and Bioinformatics Analysis

Microbial DNA was extracted from 1 g of fresh soil using a PowerSoil® DNA kit (MoBio Laboratories, Inc., Carlsbad, CA, USA) following the manufacturer’s instructions. The fungal ITS2 region was amplified based on the primers ITS3-2024F (GCATCGATGAAGAACGCAGC) and ITS4-2409R (TCCTCCGCTTATTGATATGC) [32]. Amplicon sequencing was conducted using an Illumina HiSeq 2500 platform (Illumina, San Diego, CA, USA). The sequences were deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) database with accession number SRP344414.
Subsequently, raw data were filtered for quality using the Quantitative Insights into Microbial Ecology pipeline [33]. The clean tags were compared with the reference database using the UCHIME algorithm [34] to detect chimeric sequences. The operational taxonomic units (OTUs) were clustered on the base of 97% similarity [34]. To eliminate the effects of different sequence numbers among the samples in the fungal community analysis, OTU abundance was normalized at a minimum number of sequences for each soil sample. Taxonomic data were assigned to microbial representative sequences based on the Ribosomal Database Project classifier.
Functional guilds were analysed based on FUNGuild [35]. Moreover, OTUs with a ‘highly probable’ or ‘probable’ confidence level were employed in the further analyses. Unclassified OTUs or OTUs classified to a guild as ‘possible’ were considered ‘unclassified’ and excluded from further analyses.

2.4. Construction of Co-Occurrence Network

Fungal co-occurrence network was constructed using the pipeline available at http://ieg4.rccc.ou.edu/MENA/ (accessed on 4 December 2021) [36]. OTUs occurring in less than 0.01% of the samples were excluded. The topological roles of nodes were ascertained based on within-module connectivity (Zi) and among-module connectivity (Pi) [22]. Thus, all species can be divided into four categories according to the Zi and Pi: (1) network hubs (Zi > 2.5 and Pi > 0.62), (2) module hubs (Zi > 2.5 and Pi < 0.62), (3) peripherals (Zi < 2.5 and Pi < 0.62), and (4) connectors (Zi < 2.5 and Pi > 0.62) [36]. In these categories, module hubs were highly connected to several other taxa in a common module, while connectors were strongly associated with other modules, and network hubs served both the aforementioned purposes. In ecological studies, peripherals can be considered as specialists, module hubs and connectors represent generalists, and network hubs are suggested as super generalists [37]. These three categories are considered keystone network topological features, and substantially contribute to the stability and resistance of microbiomes [38]. Network images were generated using Gephi (version 0.9.2, https://gephi.org/, accessed on 10 December 2021).

2.5. Statistical Analyses

One-way analysis of variance with Tukey’s honest significant difference test was used to determine the variations in soil properties, relative abundance of fungi, and functional groups among the different sites. A pairwise t-test was performed to analyse changes in soil properties and relative abundance of fungal species and functional groups between the rhizosphere and bulk soil. Prior to the analysis, normality and homogeneity of variance were tested, and the data that did not fit normal distribution were log-transformed. Non-metric multidimensional scaling (NMDS) and permutational multivariate analysis of variance (PERMANOVA) were used for estimating the effect of plants on the soil fungal community. To identify taxa significantly associated with a specific habitat, indicator species analysis was applied based on the ‘indicspecies’ package. The phylogenetic clustering of OTUs enriched in the rhizosphere and bulk soil was constructed using ‘ggtree’ package (v3.12, https://bioconductor.org/packages/release/bioc/html/ggtree.html, accessed on 10 December 2021). In addition, variation partitioning analysis (VPA) was performed to measure the impact of soil properties on fungal composition. The Mantel test was applied to analyse the correlations between fungal networks and soil properties according to the Bray–Curtis coefficient and Euclidean distance, respectively. Statistical analyses were performed using R software (version 3.6.1, R Foundation for Statistical Computing, Vienna, Austria) [39], and effects were considered significant if p < 0.05.

3. Results

3.1. Soil Properties

The AP and AK contents were notably higher in the rhizosphere than those in the bulk soil in the A. scoparia plot (p < 0.05; Table 1). For T. chinensis and P. communis, the EC value was significantly higher in the bulk soil than that in the rhizosphere (p < 0.05). The pH was higher in the bulk soil of A. scoparia and the rhizosphere of P. communis (p < 0.05). When comparing the rhizosphere and bulk soil of one halophytic species with those of another, T. chinensis had the lowest concentration of SOC, TN, and C/N (p < 0.05), while S. glauca had the highest EC value (p < 0.05). The SWC, SOC, TN, and AN contents exhibited no remarkable variation between the rhizosphere and bulk soil of the four plants.

3.2. Soil Fungal Composition

After normalisation of sequence numbers, 3325 OTUs (781,640 sequences in all soil samples) were used for fungal composition analyses. NMDS plots showed that the composition of the soil fungal community differed among the four plant species and sampling positions (rhizosphere and bulk) (Figure 1A). Moreover, PERMANOVA showed that fungal composition was independently affected by plant species (F = 10.511, p < 0.001) and sampling positions (F = 2.783, p < 0.05). Pairwise comparisons indicated that only three species induced differences in fungal composition in the rhizosphere and bulk soil of A. scoparia, T. chinensis, and S. glauca (Table S1; p < 0.05).
Among the classified fungi, the major soil fungal phyla were Ascomycota (71.45%), Basidiomycota (6.50%), Glomeromycota (0.34%), Chytridiomycota (0.72%), Mortierellomycota (0.25%), and Aphelidiomycota (0.14%) (Figure 1B). Ascomycota and Basidiomycota were the dominant phyla in all samples, and variations in their abundance between rhizosphere and bulk soils were mainly found in two plant species. The relative abundance of Ascomycota was higher in the S. glauca rhizosphere, and that of Basidiomycota was higher in the rhizospheres of A. scoparia and S. glauca (p < 0.05).
According to the indicator species analysis, the numbers of indicator OTUs accounted for 24% of all OTUs. Most of these OTUs belonged to Ascomycota, Basidiomycota, and Chytridiomycota. The numbers of indicator OTUs were larger in the bulk soil (651) than the rhizosphere (560). To better characterise the effects of salt-tolerant plants on fungal composition, the top 50 most abundant OTUs were explored (Figure 2). Most of these OTUs (42 and 41 OTUs for rhizosphere and bulk soils) were identified as indicator taxa. The abundant indicator OTUs were mainly affiliated within phylum Ascomycota (class Sordariomycetes, Dothideomycetes, and Eurotiomycetes).
In the VPA analysis, soil nutrient indices (AN and AP) and soil saline-alkali characteristics (EC) were preferred for structuring the various partitions of rhizosphere fungi according to the BioEnv results (Figure 3A). The soil nutrients and saline-alkali parameters explained 29.19% of the detected variation, while the remaining 70.81% could not be explained. Particularly, soil nutrient and soil saline-alkali parameters accounted for 11.72% and 5.83% of the total variation, respectively. Regarding the bulk soil fungal community, soil nutrient indices (SOC, TN, C/N, AN, AP, and AK) and soil saline-alkali parameters (pH and EC) were applied to structure the variation partition based on the BioEnv results (Figure 3B). These variables accounted for 40.42% of total bulk soil fungal composition variation, while 59.58% of the variation was unexplained. Moreover, soil nutrient indices and saline-alkali characteristics contributed to 19.53 and 9.24% of the total variation, respectively.

3.3. Functional Guilds

Among the total fungal OTUs, 12.4% (413 out of 3325) were assigned to a trophic level, of which the saprotroph guild was the most abundant fungal guild, followed by plant and animal pathogens (Figure 4). Moreover, fungal guilds between the rhizosphere and bulk soil mainly differed in the A. scoparia and S. glauca species. The relative abundances of wood saprotrophs and ectomycorrhizal fungi were higher in the rhizosphere soil, and the plant and animal pathogen abundances were higher in the bulk soil (p < 0.05).

3.4. Fungal Co-Occurrence Network Analyses

Network topological metrics revealed differences in the fungal co-occurrence patterns between the rhizosphere and bulk soil (Table 2). The two fungal networks showed a good fit (bulk soil: R2 = 0.773; and rhizosphere soil: R2 = 0.734). The nodes in the bulk soil network (287) were less than those in the rhizosphere (302), and the number of total links in the rhizosphere was 14.74% higher than those in bulk soils (Figure 5A). Moreover, positive interactions (rhizosphere soil: 91.56%; and bulk soil: 94.80%) were more evident than negative interactions (rhizosphere soil: 8.44%; and bulk soil: 5.20%). In addition, the average connectivity (avgK) was lower in the bulk soil (5.946) than in the rhizosphere (6.219). The average clustering coefficient (avgCC) showed a similar trend. In contrast, the average path distance (GD) declined substantially from the bulk soil fungal network to the rhizosphere network.
Most nodes in the network were peripheral (Figure 5B). The proportion of module hubs increased from the bulk soil (0%) to the rhizosphere (0.99%), while that of connectors showed an opposite trend (from 0.35% to 0.33%). Additionally, just one node attributed to the phylum Ascomycota, genus Phoma (OTU_1295), was detected as a connector in the fungal network of bulk soil. However, in the rhizosphere fungal network, three nodes belonging to unclassified fungi (OTU_80), phylum Ascomycota, order Sordariales (OTU_82), and phylum Ascomycota, genus Alternaria (OTU_10) were classified as module hubs, and one node belonging to phylum Ascomycota, order Hypocreales (OTU_159), was assigned as a connector. Therefore, the connectors and module hubs were considered keystone fungi.
According to the module eigengene analysis, five main modules, including more than five OTU members, were detected in the bulk soil eigengenes, while three main modules were included in the rhizosphere soil eigengenes (Figure 6), explaining 32–50% and 32–40% of the variation in the bulk soil and rhizosphere modules, respectively. In bulk soils, the meta-module (a group of functionally correlated modules) contained three modules (B1, B2, and B3), thus, accounting for 59% of the total nodes; however, the rhizosphere had no meta-module. Compared with the rhizosphere soil network, module eigengenes in the bulk were more sensitive to the soil properties (Table 3).

4. Discussion

4.1. Differences in Fungal Composition between the Rhizosphere and Bulk Soil of Salt-Tolerant Plants Were Not Always Detected

In the present study, not all plant species had significantly different fungal community compositions and relative functional guild abundances between the rhizosphere and bulk soil. For the P. communis species, similar fungal community compositions were detected in the rhizosphere and bulk soil (Figure 1A; Table S1). These results differed from those observed in previous studies that reported different fungal compositions between the rhizosphere and bulk soil [40]. Generally, active roots in the plant rhizosphere can influence nutrient availability and cause differences in many bulk soil aspects, resulting in differences in the microbial composition [41,42]. According to the present study results, the soil nutrient indices exerted stronger effects on fungal composition than those of soil saline-alkali characteristics (Figure 3). It has been surmised that a soil nutrient availability gradient between sampling sites could have appeared because of variations in the release of protons from plant root respiration or exudate release [43]. However, for the P. communis species, there were no differences in nutrient availability between the rhizosphere and bulk soil (Table 1). The higher salinity in P. communis site compared with that in the A. scoparia site might inhibit plant root respiration or control enzyme activities [44]. However, in the higher saline site, with T. chinensis and S. glauba plots, although homogeneous nutrient contents and availabilities were also determined between the rhizosphere and bulk soil (Table 1), the fungal composition was notably different (Figure 1A; Table S1). A possible explanation is that the high adaptability of T. chinensis and S. glauca to abiotic stress is determined by its biological characteristics, including plant height, stem diameter, and root traits [45]. Plant root morphology is a pivotal driver of rhizosphere fungal composition [46]; thus, the distinctions in the fungal composition between the rhizosphere and bulk soil in the T. chinensis and S. glauca sites could be attributed to the effects of root traits; however, this aspect should be further studied.
The rhizosphere soil of A. scoparia and S. glauca showed a higher relative abundance of Ascomycota or Basidiomycota (Figure 1B). Notably, most Ascomycota and Basidiomycota groups are mostly decomposers [47]. The C/N ratio, a common quality indicator of organic matter [48], was higher in the S. glauca rhizosphere soil, implying that organic matter in the rhizosphere was not easily decomposed, which increased the number of Ascomycota and Basidiomycota groups. Although the C/N ratio was similar between the rhizosphere and bulk soil of the A. scoparia site, Basidiomycota were more abundant in the rhizosphere, possibly because A. scoparia can volatilise essential oils [49], which can, in turn, alter the relative abundance of Basidiomycota.
The differences in the soil fungal functional guilds in the rhizosphere and bulk soil were also mainly observed in the A. scoparia and S. glauca species (Figure 4). Wood saprotrophic fungi was higher in the rhizosphere. The plant rhizosphere zone provides more litter and root exudates [17], which could be beneficial for recruiting wood saprotrophs. In contrast, plant and animal pathogens were more abundant in bulk soils than those in the rhizosphere. For bulk soils, due to the absence of a mutualistic association between the mycorrhizal fungi and plant, the defensive ability of plant communities may be reduced to protect themselves resist pathogenic fungi, thereby increasing the relative abundance of pathogenic fungi [50].
Though salinity has adverse effects on the fungal colonization capacity and hyphae growth, plants colonized with mycorrhizal fungi can adapt to saline-alkali environment [8,51]. Mycorrhizal fungi play a critical role in plant development and soil genesis by establishing and regulating interactions between the plant and soil [52]. In the present study, both the ectomycorrhizal fungi and endophytic fungi were determined in the rhizosphere soil (Figure 4). The endophytic fungi, especially, the arbuscular mycorrhizal fungi have been shown to promote plant growth and salinity tolerance by many researchers [51]. They can promote plant salinity tolerance by enhancing nutrient uptake, producing plant growth hormones and improving rhizosphere conditions [51,53]. Only a few studies have investigated the function of ectomycorrhizal fungi in the protection of plants against salt stress. Previous research has suggested that ectomycorrhizal fungi attenuate salinity induced injury in plant leaves because of the improved nutrient status [54]. S. glauca, a succulent plant, can absorb soil ions into its succulent leaf tissue, thereby reducing rhizosphere salinity [55]. However, according to the results, rhizosphere EC was similar to the bulk soil EC in the S. glauca site (Table 1), which could facilitate the degradation of leaf litter, thereby increasing the salt content in the topsoil. Nonetheless, the high salt content might limit salt uptake by S. glauca roots. Therefore, a higher abundance of ectomycorrhizal fungi in the S. glauca rhizosphere might protect plants against salinity stress. The roots of P. communis and T. chinensis also absorb salt from the soil; however, excess salt accumulates in the xylem parenchyma of the roots or is excreted through foliar glands [56,57]. Taken together, these results indicate that the presence of salt-tolerant plants induced differences in fungal composition and functional guilds between the rhizosphere and bulk soil, and these differences were disparate among the four plant species. These findings further suggest that the salt-tolerant plant can reduce the adverse effects of salinity on the soil microflora by creating favourable microhabitats.

4.2. Rhizosphere Harboured a More Complex Fungal Co-Occurrence Network

As expected, the fungal community network pattern differed in the rhizosphere and bulk soil of the four typical plant species (Figure 5A), and the network pattern revealed more nodes and links in the rhizosphere than those in the bulk soil, indicating that the co-occurrence patterns were more complex in the rhizosphere. These results are contradictory to those reported in previous studies, that more complex networks exist in the bulk soil than those in the rhizosphere [22,58], which is generally considered a bulk soil subset. The stronger selection observed in the rhizosphere microbial community than that in the bulk soil could lead to more complex networks in the rhizosphere [59].
Distinct OTUs within a network were positively or negatively correlated among the fungi as illustrated by the correlation coefficients, which indicated ecological and functional relationships among the fungi and plants [60]. The present study reported a high number of positive fungal correlations in the soil networks (Figure 5A). A positive correlation indicates that microbes have an ecological niche overlap or similar living conditions [61]. The relationships can establish syntrophic associations that facilitate the accumulation of substrates in nutrient-limited environments, thereby increasing microbial resistance to abiotic and biotic stress [62]. Furthermore, more negative links (8.44%), which indicate strong competition among species [63], were observed among the fungal communities in the rhizosphere network. The more complex fungal soil network in the rhizosphere could increase fungal cooperation for soil nutrients, which can, in turn, improve the ecological stability of the microbial community following plant colonisation [64].
Our results revealed a higher modularity value in the rhizosphere network, indicating stronger niche differentiation than in bulk soils, which suggests that rhizosphere fungal co-occurrence is promoted via niche differentiation [62]. Accordingly, more fungal members were present in the meta-module of bulk soil (Figure 6). Therefore, more fungal members functionally interacted in bulk soils, which may have consequently led to increased cooperation and shared niches among its members; however, rhizospheres developed fewer shared niches. Niche differentiation maintains the correlation between community stability and diversity under environmental disturbances [65]. Module eigengenes in the bulk soil were more sensitive to changes in the soil condition (Table 3). Thus, the fungal communities in the rhizosphere soil might be more stable. This was further supported by the presence of a great number of generalists (connectors and module hubs) in the rhizosphere network (Figure 5B). Generalists can connect with many microbial species within their own module and with species belonging to other modules [66]. The higher proportion of generalists in the rhizosphere fungal network observed in the present study increased the stability and efficiency of the fungal community.
In the plots of the four typical plant species, a higher proportion of generalists in the rhizosphere fungal network was identified (Figure 5B). These keystone taxa possess crucial ecological functions in fungal communities. The plant rhizosphere might recruit more keystone species belonging to Dothideomycetes and Sordariomycetes to enable different ecological functions of bulk soil fungi. Additionally, 26 (rhizosphere)/29 (bulk soil) out of 50 most abundant OTUs were related to Sordariomycetes and Dothideomycetes; however, the indicator taxa in those OTUs were more in rhizosphere soil (Figure 2). Sordariomycetes can degrade soil organic matters and contribute to carbon and nitrogen cycling [67], while Dothideomycetes can improve nutrient acquisition and maintain collaborative metabolic association with other taxa [68]. Therefore, compared with bulk soils, the rhizosphere had a more stable and complex co-occurrence pattern and harboured more keystone species essential for nutrient cycling. These results indicate that some core fungi in the plant rhizosphere may help salt-tolerance plants to combat the adverse saline-alkali conditions by improving soil health. Understanding the principles determining plant rhizosphere fungal composition and how group interactions in saline-alkali soil contribute to the design of microbiota-based strategies is important to ameliorate land degradation caused by salinisation. Future studies should focus on combining highly specific experimental data with mathematical models to provide an in-depth understanding of the interspecific interactions among soil microbes because studying microbial interactions using only mathematical models may neglect environmental filtering.

5. Conclusions

The current study demonstrated that variations in the fungal community composition and functional groups between the rhizosphere and bulk soil depend on salt-tolerant plant species. In high-salinity soils, such as the P. communis site, the similarity of soil nutrient conditions and fungal communities between rhizosphere and bulk soils indicates that some plants in high-salinity soils mainly rely on their ecological characteristics to adapt to the saline-alkali environment instead of changing the rhizosphere nutrient conditions and fungal communities. Furthermore, the network topological characteristics of fungal communities showed notable dissimilarity between the rhizosphere and bulk soil. The rhizosphere fungal network had more nodes and links, with more negative links and higher modularity, but fewer species belonging to the meta-module of the rhizosphere soil network. This indicates that the rhizosphere co-occurrence pattern was more complex, and niche differentiation occurred. An increased number of generalists and indicator taxa observed in the rhizosphere was predicted to increase the stability of fungal communities and show greater metabolic flexibility. Overall, a comprehensive understanding of fungal community compositions and interactions among fungal species in saline-alkali soils provides valuable strategies to assess the ecological consequences of salt-tolerant plants on the soil fungal community.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy13041036/s1, Table S1: Permutational multivariate analysis of variance (Bray-Curtis distance) and pairwise comparisons of fungal community differences between the rhizosphere and bulk soils of the four halophytes at OTU levels.

Author Contributions

Methodology, data curation, writing—original draft, Z.L. and J.L.; methodology, investigation, validation, R.H., Y.Z., H.G. and Z.S.; resources, funding acquisition, Z.O., Z.L. and Y.S.; writing—review and editing, Y.S. and Z.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work received funds from the National Key Research and Development Program of China (grant number 2021YFD190090503), National Natural Science Foundation of China (grant number 32101392), Natural Science Foundation of Hainan Province, China (grant number 421QN193), and Strategic Priority Research Program of Chinese Academy of Sciences (grant number XDA26050202).

Data Availability Statement

The data presented in this study are available on request from the corresponding author. The data are not publicly available due to privacy restrictions.

Conflicts of Interest

The authors declare that they have no known competing financial interest or personal relationship that could have appeared to influence the work reported in this paper.

References

  1. Cho, K.H.; Beon, M.S.; Jeong, J.C. Dynamics of soil salinity and vegetation in a reclaimed area in Saemangeum, Republic of Korea. Geoderma 2018, 321, 42–51. [Google Scholar] [CrossRef]
  2. Yu, P.J.; Liu, S.W.; Yang, H.T.; Fan, G.H.; Zhou, D.W. Short-term land use conversions influence the profile distribution of soil salinity and sodicity in northeastern China. Ecol. Indic. 2018, 88, 79–87. [Google Scholar] [CrossRef]
  3. Yadav, S.; Irfan, M.; Ahmad, A.; Hayat, S. Causes of salinity and plant manifestations to salt stress: A review. J. Environ. Biol. 2011, 32, 667–685. [Google Scholar] [PubMed]
  4. Pitman, M.G.; Läuchli, A. Global impact of salinity and agricultural ecosystems. In Salinity: Environment Plants Molecules; Läuchli, A., Lüttge, U., Eds.; Springer: Dordrecht, The Netherlands, 2002; pp. 3–20. [Google Scholar]
  5. Sahab, S.; Suhani, I.; Srivastava, V.; Chauhan, P.S.; Singh, R.P.; Prasad, V. Potential risk assessment of soil salinity to agroecosystem sustainability: Current status and management strategies. Sci. Total Environ. 2021, 764, 144164. [Google Scholar] [CrossRef]
  6. Vargas, R.; Pankova, E.I.; Balyuk, S.A.; Krasilnikov, P.V.; Khasankhanova, G.M. Handbook for Saline Soil Management; FAO: Rome, Italy, 2018. [Google Scholar]
  7. Jesus, J.M.; Danko, A.S.; Fiúza, A.; Borges, M.T. Phytoremediation of salt-affected soils: A review of processes, applicability, and the impact of climate change. Environ. Sci. Pollut. Res. 2015, 22, 6511. [Google Scholar] [CrossRef]
  8. Liu, H.Q.; Lu, X.B.; Li, Z.H.; Tian, C.Y.; Song, J. The role of root-associated microbes in growth stimulation of plants under saline conditions. Land Degrad. Dev. 2021, 32, 3471–3486. [Google Scholar] [CrossRef]
  9. Li, N.; Shao, T.Y.; Zhou, Y.J.; Cao, Y.C.; Hu, H.Y.; Sun, Q.K.; Long, X.H.; Yue, Y.; Gao, X.M.; Rengel, Z. Effects of planting Melia azedarach L. on soil properties and microbial community in saline-alkali soil. Land Degrad. Dev. 2021, 32, 2951–2961. [Google Scholar] [CrossRef]
  10. Martin, F.M.; Uroz, S.; Barker, D.G. Ancestral alliances: Plant mutualistic symbioses with fungi and bacteria. Science 2017, 356, eaad4501. [Google Scholar] [CrossRef]
  11. Rodriguez, P.A.; Rothballer, M.; Chowdhury, S.P.; Nussbaumer, T.; Falter-Braun, P. Systems biology of plant-microbiome interactions. Mol. Plant 2019, 12, 804–821. [Google Scholar] [CrossRef] [Green Version]
  12. Feng, Q.J.; Cao, S.L.; Liao, S.J.; Wassie, M.; Sun, X.Y.; Chen, L.; Xie, Y. Fusarium equiseti-inoculation altered rhizosphere soil microbial community, potentially driving perennial ryegrass growth and salt tolerance. Sc. Total Environ. 2023, 871, 162153. [Google Scholar] [CrossRef]
  13. Wang, Y.Y.; Guo, D.F. Response of soil fungi community structure to salt vegetation succession in the Yellow River Delta. Curr. Microbiol. 2016, 73, 595–601. [Google Scholar] [CrossRef]
  14. Carneiro, B.; Cardoso, P.; Figueira, E.; Lopes, I.; Venâncio, C. Forward-looking on new microbial consortia: Combination of rot fungi and rhizobacteria on plant growth-promoting abilities. Appl. Soil Ecol. 2023, 182, 104689. [Google Scholar] [CrossRef]
  15. Li, X.N.; Han, S.J.; Wang, G.Y.; Liu, X.Y.; Erick, A.; Xie, Y.; Fu, J.M. The fungus Aspergillus aculeatus enhances salt-stress tolerance, metabolite accumulation, and improves forage quality in perennial ryegrass. Front. Microbiol. 2017, 8, 1664. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Guan, B.; Zhang, H.X.; Wang, X.H.; Yang, S.S.; Chen, M.; Hou, A.X.; Grace, A.C.; Han, G.X. Salt is a main factor shaping community composition of arbuscular mycorrhizal fungi along a vegetation successional series in the Yellow River Delta. Catena 2020, 185, 104318. [Google Scholar] [CrossRef]
  17. Turner, T.R.; Ramakrishnan, K.; Walshaw, J.; Heavens, D.; Alston, M.; Swarbreck, D.; Osbourn, A.; Grant, A.; Poole, P.S. Comparative metatranscriptomics reveals kingdom level changes in the rhizosphere microbiome of plants. ISME J. 2013, 7, 2248–2258. [Google Scholar] [CrossRef] [Green Version]
  18. Williams, A.; de Vries, F.T. Plant root exudation under drought: Implications for ecosystem functioning. New Phytol. 2020, 225, 1899–1905. [Google Scholar] [CrossRef] [Green Version]
  19. Nemergut, D.R.; Schmidt, S.K.; Fukami, T.; O’Neill, S.P.; Bilinski, T.M.; Stanish, L.F.; Knelman, J.E.; Darcy, J.L.; Lynch, R.C.; Wickey, P. Patterns and processes of microbial community assembly. Microbiol. Mol. Biol. Rev. 2013, 77, 342–356. [Google Scholar] [CrossRef] [Green Version]
  20. Peiffer, J.A.; Spor, A.; Koren, O.; Jin, Z.; Tringe, S.G.; Dangl, J.L.; Buckler, E.S.; Ley, R.E. Diversity and heritability of the maize rhizosphere microbiome under field conditions. Proc. Natl. Acad. Sci. USA 2013, 110, 6548–6553. [Google Scholar] [CrossRef] [Green Version]
  21. Chaparro, J.M.; Badri, D.V.; Vivanco, J.M. Rhizosphere microbiome assemblage is affected by plant development. ISME J. 2014, 8, 790–803. [Google Scholar] [CrossRef] [Green Version]
  22. Fan, K.K.; Weisenhorn, P.; Gilbert, J.A.; Chu, H.Y. Wheat rhizosphere harbors a less complex and more stable microbial co-occurrence pattern than bulk soil. Soil Biol. Biochem. 2018, 125, 251–260. [Google Scholar] [CrossRef]
  23. Chen, J.; Xu, H.; He, D.; Li, Y.D.; Luo, T.S.; Yang, H.G.; Lin, M.X. Historical logging alters soil fungal community composition and network in a tropical rainforest. Forest Ecol. Manag. 2019, 433, 228–239. [Google Scholar] [CrossRef]
  24. Lima-Mendez, G.; Faust, K.; Henry, N.; Decelle, J.; Colin, S.; Carcillo, F.; Chaffron, S.; Ignacio-Espinosa, J.C.; Roux, S.; Vincent, F.; et al. Determinants of community structure in the global plankton interactome. Science 2015, 348, 1262073. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Bai, J.H.; Yu, Z.B.; Yu, L.; Wang, D.W.; Guan, Y.A.; Liu, X.H.; Gu, C.H.; Cui, B.S. In-situ organic phosphorus mineralization in sediments in coastal wetlands with different flooding periods in the Yellow River Delta, China. Sci. Total Environ. 2019, 682, 417–425. [Google Scholar] [CrossRef]
  26. Zhao, Q.Q.; Bai, J.H.; Zhang, G.L.; Jia, J.; Wang, W.; Wang, X. Effects of water and salinity regulation measures on soil carbon sequestration in coastal wetlands of the Yellow River Delta. Geoderma 2018, 319, 219–229. [Google Scholar] [CrossRef]
  27. Liu, S.; Hou, X.; Yang, M.; Chen, F.Y.; Coxixo, A.; Wu, X.; Zhang, Y.Q. Factors driving the relationships between vegetation and soil properties in the Yellow River Delta, China. Catena 2018, 165, 279–285. [Google Scholar] [CrossRef]
  28. Fan, X.; Pedroli, B.; Liu, G.; Liu, Q.; Liu, H.; Shu, L. Soil salinity development in the yellow river delta in relation to groundwater dynamics. Land Degrad. Dev. 2012, 23, 175–189. [Google Scholar] [CrossRef]
  29. Riley, D.; Barber, S.A. Effect of ammonium and nitrate fertilization on phosphorus uptake as related to root-induced pH changes at the root-soil interface. Soil Sci. Soc. Am. J. 1971, 35, 301–306. [Google Scholar] [CrossRef]
  30. Liu, F.D.; Mo, X.; Kong, W.J.; Song, Y. Soil bacterial diversity, structure, and function of Suaeda salsa in rhizosphere and non-rhizosphere soils in various habitats in the Yellow River Delta, China. Sci. Total Environ. 2020, 740, 140144. [Google Scholar] [CrossRef]
  31. Bao, S. Soil and Agricultural Chemistry Analysis; Agriculture Publication: Beijing, China, 2000; pp. 25–103. [Google Scholar]
  32. Ramette, A.; Tiedje, J.M. Multiscale responses of microbial life to spatial distance and environmental heterogeneity in a patchy ecosystem. Proc. Natl. Acad. Sci. USA 2007, 104, 2761–2766. [Google Scholar] [CrossRef] [Green Version]
  33. Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef] [Green Version]
  34. Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 2011, 27, 2194–2200. [Google Scholar] [CrossRef] [Green Version]
  35. Nguyen, N.H.; Song, Z.; Bates, S.T.; Branco, S.; Tedersoo, L.; Menke, J.; Schilling, J.S.; Kennedy, P.G. FUNGuild: An open annotation tool for parsing fungal community datasets by ecological guild. Fungal Ecol. 2016, 20, 241–248. [Google Scholar] [CrossRef]
  36. Deng, Y.; Jiang, Y.H.; Yang, Y.F.; He, Z.L.; Luo, F.; Zhou, J.Z. Molecular ecological network analyses. BMC Bioinform. 2012, 13, 113. [Google Scholar] [CrossRef] [Green Version]
  37. Olesen, J.M.; BascompSte, J.; Dupont, Y.L.; Jordano, P. The modularity of pollination networks. Proc. Natl. Acad. Sci. USA 2007, 104, 19891–19896. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Tylianakis, J.M.; Morris, R.J. Ecological networks across environmental gradients. Annu. Rev. Ecol. Evol. Syst. 2017, 48, 25–48. [Google Scholar] [CrossRef]
  39. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2014. [Google Scholar]
  40. Xiong, Y.W.; Li, X.W.; Wang, T.T.; Gong, Y.; Zhang, C.M.; Xing, K.; Qin, S. Root exudates-driven rhizosphere recruitment of the plant growth-promoting rhizobacterium Bacillus flexus KLBMP 4941 and its growth-promoting effect on the coastal halophyte Limonium sinense under salt stress. Ecotox. Environ. Saf. 2020, 194, 110374. [Google Scholar] [CrossRef]
  41. Hinsinger, P.; Bengough, A.G.; Vetterlein, D.; Young, I.M. Rhizosphere: Biophysics, biogeochemistry and ecological relevance. Plant Soil 2009, 321, 117–152. [Google Scholar] [CrossRef]
  42. Koranda, M.; Schnecker, J.; Kaiser, C.; Fuchslueger, L.; Kitzler, B.; Stange, C.F.; Sessitsch, A.; Zechmeister-Boltenstern, S.; Richtera, A. Microbial processes and community composition in the rhizosphere of European beech–the influence of plant C exudates. Soil Biol. Biochem. 2011, 43, 551–558. [Google Scholar] [CrossRef] [Green Version]
  43. Chaudhary, D.R.; Gautam, R.K.; Yousuf, B.; Mishra, A.; Jha, B. Nutrients, microbial community structure and functional gene abundance of rhizosphere and bulk soils of halophytes. Appl. Soil Ecol. 2015, 91, 16–26. [Google Scholar] [CrossRef]
  44. Mohammadi, M.H.; Khataar, M.; Shekari, F. Effect of soil salinity on the wheat and bean root respiration rate at low matric suctions. Paddy Water Environ. 2017, 15, 639–648. [Google Scholar] [CrossRef]
  45. Huang, Y.; Fan, G.H.; Zhou, D.W.; Pang, J.Y. Phenotypic plasticity of four Chenopodiaceae species with contrasting saline–sodic tolerance in response to increased salinity-sodicity. Ecol. Evol. 2019, 9, 1545–1553. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Sweeney, C.J.; de Vries, F.T.; van Dongen, B.E.; Bardgett, R.D. Root traits explain rhizosphere fungal community composition among temperate grassland plant species. New Phytol. 2021, 229, 1492–1507. [Google Scholar] [CrossRef]
  47. Baldrian, P.; Kolařík, M.; Štursová, M.; Kopecký, J.; Valášková, V.; Větrovský, T.; Žifčáková, L.; Šnajdr, J.; Rídl, J.; Vlček, Č.; et al. Active and total microbial communities in forest soil are largely different and highly stratified during decomposition. ISME J. 2012, 6, 248–258. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Polyakova, O.; Billor, N. Impact of deciduous tree species on litterfall quality, decomposition rates and nutrient circulation in pine stands. Forest Ecol. Manag. 2007, 253, 11–18. [Google Scholar] [CrossRef]
  49. Aati, H.Y.; Perveen, S.; Orfali, R.; Al-Taweel, A.M.; Aati, S.; Wanner, J.; Khan, A.; Mehmood, R. Chemical composition and antimicrobial activity of the essential oils of Artemisia absinthium, Artemisia scoparia, and Artemisia sieberi grown in Saudi Arabia. Arab. J. Chem. 2020, 13, 8209–8217. [Google Scholar] [CrossRef]
  50. Van Geel, M.; Yu, K.; Ceulemans, T.; Peeters, G.; van Acker, K.; Geerts, W.; Ramos, M.A.; Serafim, C.; Kastendeuch, P.; Najjar, G.; et al. Variation in ectomycorrhizal fungal communities associated with Silver linden (Tilia tomentosa) within and across urban areas. FEMS Microbiol. Ecol. 2018, 94, fiy207. [Google Scholar] [CrossRef] [Green Version]
  51. Abdel Latef, A.A.H.; Miransari, M. The role of arbuscular mycorrhizal fungi in alleviation of salt stress. In Use of Microbes for the Alleviation of Soil Stresses: Volume 2: Alleviation of Soil Stress by PGPR and Mycorrhizal Fungi; Springer: New York, NY, USA, 2014; pp. 23–38. [Google Scholar] [CrossRef]
  52. Dickie, I.A.; Martínez-García, L.B.; Koele, N.; Grelet, G.A.; Tylianakis, J.M.; Peltzer, D.A.; Richardson, S.J. Mycorrhizas and mycorrhizal fungal communities throughout ecosystem development. Plant Soil 2013, 367, 11–39. [Google Scholar] [CrossRef]
  53. Hajiboland, R.; Aliasgharzadeh, N.; Laiegh, S.F.; Poschenrieder, C. Colonization with arbuscular mycorrhizal fungi improves salinity tolerance of tomato (Solanum lycopersicum L.) plants. Plant Soil 2010, 331, 313–327. [Google Scholar] [CrossRef]
  54. Luo, Z.B.; Li, K.; Gai, Y.; Göbel, C.; Wildhagen, H.; Jiang, X.N.; Feußner, I.; Rennenberg, H.; Polle, A. The ectomycorrhizal fungus (Paxillus involutus) modulates leaf physiology of poplar towards improved salt tolerance. Environ. Exp. Bot. 2011, 72, 304–311. [Google Scholar] [CrossRef]
  55. Cao, D.; Shi, F.C.; Koike, T.; Lu, Z.H.; Sun, J.K. Halophyte plant communities affecting enzyme activity and microbes in saline soils of the Yellow River Delta in China. CLEAN—Soil Air Water 2014, 42, 1433–1440. [Google Scholar] [CrossRef]
  56. Decker, J.P. Salt secretion by Tamarix pentandra Pall. Forest Sci. 1961, 7, 214–217. [Google Scholar] [CrossRef]
  57. Koyro, H.W.; Geissler, N.; Hussin, S.; Debez, A.; Huchzermeyer, B. Strategies of halophytes to survive in a salty environment. In Abiotic Stress and Plant Responses; Khan, N.A., Singh, S., Eds.; I.K. International Publishing: New Delhi, India, 2008; pp. 83–104. [Google Scholar]
  58. Li, Y.M.; Yang, Y.; Wu, T.; Zhang, H.; Wei, G.H.; Li, Z.F. Rhizosphere bacterial and fungal spatial distribution and network pattern of Astragalus mongholicus in representative planting sites differ the bulk soil. Appl. Soil Ecol. 2021, 168, 104114. [Google Scholar] [CrossRef]
  59. Yan, Y.; Kuramae, E.E.; de Hollander, M.; Klinkhamer, P.G.L.; van Veen, J.A. Functional traits dominate the diversity-related selection of bacterial communities in the rhizosphere. ISME J. 2017, 11, 56–66. [Google Scholar] [CrossRef] [Green Version]
  60. Mendes, L.W.; Kuramae, E.E.; Navarrete, A.A.; van Veen, J.A.; Tsai, S.M. Taxonomical and functional microbial community selection in soybean rhizosphere. ISME J. 2014, 8, 1577–1587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  61. Faust, K.; Raes, J. Microbial interactions: From networks to models. Nat. Rev. Microbiol. 2012, 10, 538–550. [Google Scholar] [CrossRef] [PubMed]
  62. Zhang, B.G.; Zhang, J.; Liu, Y.; Shi, P.; Wei, G.H. Co-occurrence patterns of soybean rhizosphere microbiome at a continental scale. Soil Biol. Biochem. 2018, 118, 178–186. [Google Scholar] [CrossRef]
  63. Wang, S.; Wang, X.B.; Han, X.G.; Deng, Y. Higher precipitation strengthens the microbial interactions in semi-arid grassland soils. Glob. Ecol. Biogeogr. 2018, 27, 570–580. [Google Scholar] [CrossRef]
  64. Coyte, K.Z.; Schluter, J.; Foster, K.R. The ecology of the microbiome: Networks, competition, and stability. Science 2015, 350, 663–666. [Google Scholar] [CrossRef]
  65. Kang, S.; Niu, J.M.; Zhang, Q.; Zhang, X.F.; Han, G.D.; Zhao, M.L. Niche differentiation is the underlying mechanism maintaining the relationship between community diversity and stability under grazing pressure. Glob. Ecol. Conserv. 2020, 24, e01246. [Google Scholar] [CrossRef]
  66. Zhou, J.Z.; Deng, Y.; Luo, F.; He, Z.L.; Yang, Y.F. Phylogenetic molecular ecological network of soil microbial communities in response to elevated CO2. MBio 2011, 2, e00122-11. [Google Scholar] [CrossRef] [Green Version]
  67. Zhang, W.W.; Lu, Z.T.; Yang, K.; Zhu, J.J. Impacts of conversion from secondary forests to larch plantations on the structure and function of microbial communities. Appl. Soil Ecol. 2017, 111, 73–83. [Google Scholar] [CrossRef]
  68. Schoch, C.L.; Crous, P.W.; Groenewald, J.Z.; Boehm, E.W.A.; Burgess, T.I.; de Gruyter, J.; de Hoog, G.S.; Dixon, L.J.; Grube, M.; Gueidan, C.; et al. A class-wide phylogenetic assessment of Dothideomycetes. Stud. Mycol. 2009, 64, 1–15. [Google Scholar] [CrossRef] [PubMed]
Agronomy 13 01036 g001 550
Figure 1. Soil fungal community composition in the rhizosphere and bulk soils of the four selected plant species. (A) Ordination of the soil fungal community composition based on operational taxonomic units (OTUs), as determined by non-metric multidimensional scaling (NMDS) ordinations using the Bray-Curtis similarity index. Stress = 0.102. (B) the relative abundance (%) of major taxonomic groups at the fungal phyla level. AS, A. scoparia; PC, P. communis; TC, T. chinensis; SG, S. glauca; R, rhizosphere; B, bulk soil.
Figure 1. Soil fungal community composition in the rhizosphere and bulk soils of the four selected plant species. (A) Ordination of the soil fungal community composition based on operational taxonomic units (OTUs), as determined by non-metric multidimensional scaling (NMDS) ordinations using the Bray-Curtis similarity index. Stress = 0.102. (B) the relative abundance (%) of major taxonomic groups at the fungal phyla level. AS, A. scoparia; PC, P. communis; TC, T. chinensis; SG, S. glauca; R, rhizosphere; B, bulk soil.
Agronomy 13 01036 g001
Agronomy 13 01036 g002 550
Figure 2. Phylogenetic clustering of the top 50 most abundant OTUs, and their relative abundance and indicator roles in the fungal community of the rhizosphere (A) and bulk soil (B). OTUs that could be affiliated to genus level are shown as genus; otherwise, they are shown as OTU_ID. The bars on the left indicated OTUs clustered at class level, and the bars on the right indicated whether the OTUs were indicators or non-indicators identified using indicator species analyses. The heatmaps in the middle showed the relative abundance of the taxa.
Figure 2. Phylogenetic clustering of the top 50 most abundant OTUs, and their relative abundance and indicator roles in the fungal community of the rhizosphere (A) and bulk soil (B). OTUs that could be affiliated to genus level are shown as genus; otherwise, they are shown as OTU_ID. The bars on the left indicated OTUs clustered at class level, and the bars on the right indicated whether the OTUs were indicators or non-indicators identified using indicator species analyses. The heatmaps in the middle showed the relative abundance of the taxa.
Agronomy 13 01036 g002
Agronomy 13 01036 g003 550
Figure 3. Variation partitioning analysis of the rhizosphere fungal (A) and bulk soil fungal (B) communities according to the BioEnv results. Indices of soil nutrients included SOC, TN, C/N, AN, AP, and AK. Saline-alkali characteristics included pH and EC. SWC, soil water content; EC, electrical conductivity; SOC, soil organic carbon; TN, total nitrogen; AN, available nitrogen; AP, available phosphorus; AK, available potassium.
Figure 3. Variation partitioning analysis of the rhizosphere fungal (A) and bulk soil fungal (B) communities according to the BioEnv results. Indices of soil nutrients included SOC, TN, C/N, AN, AP, and AK. Saline-alkali characteristics included pH and EC. SWC, soil water content; EC, electrical conductivity; SOC, soil organic carbon; TN, total nitrogen; AN, available nitrogen; AP, available phosphorus; AK, available potassium.
Agronomy 13 01036 g003
Agronomy 13 01036 g004 550
Figure 4. Relative abundance of fungal guilds in the rhizosphere and bulk soil of the four selected plant species.
Figure 4. Relative abundance of fungal guilds in the rhizosphere and bulk soil of the four selected plant species.
Agronomy 13 01036 g004
Agronomy 13 01036 g005 550
Figure 5. Co-occurrence network interactions of the rhizosphere and bulk soil fungal communities in the four plant species (A); and Zi–Pi plot indicating the topological distribution of OTUs in the fungal network (B). The size of each node is proportional to the relative abundance.
Figure 5. Co-occurrence network interactions of the rhizosphere and bulk soil fungal communities in the four plant species (A); and Zi–Pi plot indicating the topological distribution of OTUs in the fungal network (B). The size of each node is proportional to the relative abundance.
Agronomy 13 01036 g005
Agronomy 13 01036 g006 550
Figure 6. The module eigengenes of fungal networks in the rhizosphere (A) and bulk soil (B) of the four selected plant species. The upper part indicates the results of hierarchical clustering according to Pearson’s correlation analyses conducted among module eigengenes, and the heatmap shows the correlation coefficient (r) value. The percentage of the total variance explained by the module eigengenes is shown on the left side of the heatmaps. Modules larger than five nodes are presented and labelled as ‘R’ (rhizosphere soil) and ‘B’ (bulk soil).
Figure 6. The module eigengenes of fungal networks in the rhizosphere (A) and bulk soil (B) of the four selected plant species. The upper part indicates the results of hierarchical clustering according to Pearson’s correlation analyses conducted among module eigengenes, and the heatmap shows the correlation coefficient (r) value. The percentage of the total variance explained by the module eigengenes is shown on the left side of the heatmaps. Modules larger than five nodes are presented and labelled as ‘R’ (rhizosphere soil) and ‘B’ (bulk soil).
Agronomy 13 01036 g006
Table
Table 1. Soil properties of the rhizosphere and bulk soil in the plots of four sampling sites. Values are given as mean ± standard deviation (SD) of the soil samples.
Table 1. Soil properties of the rhizosphere and bulk soil in the plots of four sampling sites. Values are given as mean ± standard deviation (SD) of the soil samples.
Site PropertiesSite 1Site 2Site 3Site 4
Dominant plantA. scopariaP. communisT. chinensisS. glauca
EC (μs cm−1)BS228.1 ± 45.2 c3052.4 ± 1434.2 bc *6362.2 ± 3143.2 b *10,995.4 ± 976.9 a
RS259.8 ± 33.5 b1105.1 ± 314.6 b1467.7 ± 805.8 b11,708.2 ± 1623.1 a
pHBS8.64 ± 0.032 a *8.16 ± 0.144 b *8.79 ± 0.430 a7.94 ± 0.077 b
RS8.53 ± 0.08 ab8.44 ± 0.088 ab8.81 ± 0.338 a8.11 ± 0.233 b
SWC (%)BS7.10 ± 0.702 b19.24 ± 1.58 a16.39 ± 1.31 a17.96 ± 1.57 a
RS8.41 ± 4.59 b17.45 ± 4.05 a18.12 ± 3.32 a19.96 ± 2.04 a
SOC (g kg−1)BS4.04 ± 0.367 b6.29 ± 1.62 a1.62 ± 0.339 c5.77 ± 0.527 ab
RS4.47 ± 1.10 a6.69 ± 1.94 a1.85 ± 0.130 b6.34 ± 0.886 a
TN (g kg−1)BS0.491 ± 0.049 b0.618 ±0.122 ab0.279 ± 0.047 c0.637 ± 0.052 a
RS0.534 ± 0.082 a0.626 ± 0.116 a0.320 ± 0.027 b0.599 ± 0.075 a
C/NBS8.34 ± 0.832 a10.05 ± 1.18 a6.00 ± 1.66 b9.06 ± 0.360 a **
RS8.36 ± 1.61 a10.49 ± 1.32 a5.84 ± 0.709 b10.57 ± 0.602 a
AN (mg kg−1)BS66.95 ± 14.91 a92.34 ± 23.08 a26.48 ± 14.68 b61.33 ± 16.81 ab
RS49.12 ± 14.70 b95.90 ± 21.47 a32.93 ± 22.02 b66.54 ± 11.86 ab
AP (mg kg−1)BS13.66 ± 0.692 c *37.60 ± 4.77 a13.52 ± 0.558 c23.22 ± 3.82 b
RS17.98 ± 3.06 b37.30 ± 8.74 a13.26 ± 0.454 b19.88 ± 3.17 b
AK (mg kg−1)BS125.3 ± 20.32 b *239.1 ± 27.79 a163.9 ± 42.06 b227.2 ± 16.36 a
RS233.3 ± 60.54 a208.3 ± 48.37 a171.4 ± 8.71 a203.0 ± 19.23 a
Different letters indicate significant differences among the four plant species in the bulk or rhizosphere soils. * and ** indicate significant difference between the rhizosphere and bulk soils at p < 0.05 and p < 0.01, respectively. SWC, soil water content; EC, electrical conductivity; SOC, soil organic carbon; TN, total nitrogen; AN, available nitrogen; AP, available phosphorus; AK, available potassium; BS, bulk soil; RS, rhizosphere soil.
Table
Table 2. Statistics of the topological parameters of empirical and randomised networks in the rhizosphere and bulk soils.
Table 2. Statistics of the topological parameters of empirical and randomised networks in the rhizosphere and bulk soils.
IndexRhizosphere SoilBulk Soil
EmpiricalRandomizedEmpiricalRandomized
Average degree (avgK)6.219−5.946−
Average clustering coefficient (avgCC)0.4120.104 ± 0.0160.3810.127 ± 0.015
Average path distance (GD)3.9232.868 ± 0.0484.6172.855 ± 0.042
Centralization of degree (CD)0.1340.1340.1560.156
Centralization of betweenness (CB)0.2070.083 ± 0.0110.2230.112 ± 0.014
Centralization of eigenvector centrality (CE)0.2690.193 ± 0.0160.2210.213 ± 0.012
Harmonic geodesic distance (HD)3.0472.535 ± 0.0263.2222.509 ± 0.025
Modularity (M)0.5550.326 ± 0.0100.4540.324 ± 0.008
Table
Table 3. Correlation coefficients between module eigengenes and soil properties in the bulk and rhizosphere soils of the four selected halophytes.
Table 3. Correlation coefficients between module eigengenes and soil properties in the bulk and rhizosphere soils of the four selected halophytes.
Bulk SoilRhizosphere Soil
ModuleB1B2B3B4B5R1R2R3
SWC−0.732 ***−0.938 ***−0.914 ***−0.2460.1320.4210.430−0.661 **
pH0.2530.490 *0.3680.604 **−0.240−0.218−0.214−0.035
EC−0.756 ***−0.601 **−0.463 *0.0990.612 **0.0190.800 ***−0.047
SOC0.129−0.250−0.161−0.840 ***0.1010.660 **−0.126−0.055
TN0.191−0.187−0.079−0.791 ***0.2190.572 **−0.2010.061
C/N0.110−0.142−0.109−0.750 ***−0.0630.601 **−0.049−0.055
AN0.368−0.024−0.018−0.730 ***−0.0490.730 ***−0.350−0.283
AP−0.142−0.600 **−0.614 **−0.783 ***−0.1510.799 ***−0.570 **−0.396
AK−0.470 *−0.702 ***−0.628 **−0.507 *0.2300.050−0.2240.242
Significant results are presented in bold. * p < 0.05; ** p < 0.01; *** p < 0.001.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, Z.; Li, J.; Hou, R.; Zhang, Y.; Gong, H.; Sun, Y.; Ouyang, Z.; Sun, Z. Plant Rhizospheres Harbour Specific Fungal Groups and Form a Stable Co-Occurrence Pattern in the Saline-Alkali Soil. Agronomy 2023, 13, 1036. https://doi.org/10.3390/agronomy13041036

AMA Style

Liu Z, Li J, Hou R, Zhang Y, Gong H, Sun Y, Ouyang Z, Sun Z. Plant Rhizospheres Harbour Specific Fungal Groups and Form a Stable Co-Occurrence Pattern in the Saline-Alkali Soil. Agronomy. 2023; 13(4):1036. https://doi.org/10.3390/agronomy13041036

Chicago/Turabian Style

Liu, Zhen, Jing Li, Ruixing Hou, Yitao Zhang, Huarui Gong, Yanfei Sun, Zhu Ouyang, and Zhigang Sun. 2023. "Plant Rhizospheres Harbour Specific Fungal Groups and Form a Stable Co-Occurrence Pattern in the Saline-Alkali Soil" Agronomy 13, no. 4: 1036. https://doi.org/10.3390/agronomy13041036

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop