Genetic Variation in Turkish Bread Wheat (Triticum aestivum L.) Varieties for Resistance to Common Bunt
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Inoculum Source
2.2. Field Trials
2.3. Extraction of Genomic DNA
2.4. Molecular Detection of CB Resistance Genes
2.5. Statistical Analyses
3. Results
3.1. Evaluation of Bread Wheat Varieties for Resistance to Common Bunt
3.2. Molecular Detection of Common Bunt Resistance Genes
4. Discussion
5. Conclusions
Supplementary Materials
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAOSTAT. Crops and Livestock Products. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 30 August 2023).
- FAOSTAT. Trade: Crops and Livestock Products. Available online: https://www.fao.org/faostat/en/#data/TCL (accessed on 30 August 2023).
- Aydogdu, M.; Kaya, Y. Reactions of spring wheat varieties to common bunt (Tilletia laevis) in Turkey. Cereal Res. Commun. 2020, 48, 333–339. [Google Scholar] [CrossRef]
- Wang, S.; Knox, R.E.; DePauw, R.M.; Clarke, F.R.; Clarke, J.M.; Thomas, J.B. Markers to a common bunt resistance gene derived from ‘Blizzard’ wheat (Triticum aestivum L.) and mapped to chromosome arm 1BS. Theor. Appl. Genet. 2009, 119, 541–553. [Google Scholar] [CrossRef] [PubMed]
- Akcura, M.; Akan, K. Assessment of the reactions of pure lines selected from Turkish bread wheat landraces against bunt disease (Tilletia foetida) with the GGE-biplot method. Plant Genet. Resour.-C 2018, 16, 325–333. [Google Scholar] [CrossRef]
- Mourad, A.M.I.; Morgounov, A.; Baenziger, P.S.; Esmail, S.M. Genetic variation in common bunt resistance in synthetic hexaploid wheat. Plants 2023, 12, 2. [Google Scholar] [CrossRef]
- Barroga-Matanguihan, J.; Murphy, K.M.; Jones, S.S. Control of common bunt in organic wheat. Plant Dis. 2011, 95, 92–103. [Google Scholar] [CrossRef]
- Akan, K.; Cetin, L.; Albostan, S.; Dusunceli, F.; Mert, Z. Important cereals and chickpea diseases in Central Anatolia. J. Cent. Res. Inst. Field Crops 2014, 15, 29–48. [Google Scholar]
- Murphy, K.M.; Campbell, K.G.; Lyon, S.R.; Jones, S.S. Evidence of varietal adaptation to organic farming systems. Field Crop Res. 2007, 102, 172–177. [Google Scholar] [CrossRef]
- Luczka, W.; Kalinowski, S. Barriers to the development of organic farming: A Polish case study. Agriculture 2020, 10, 536. [Google Scholar] [CrossRef]
- Akyuz, N.C.; Theuvsen, L. The impact of behavioral drivers on adoption of sustainable agricultural practices: The case of organic farming in Turkey. Sustainability 2020, 12, 6875. [Google Scholar] [CrossRef]
- Mesnage, R.; Straw, E.A.; Antoniou, M.N.; Benbrook, C.; Brown, M.J.F.; Chauzat, M.P.; Finger, R.; Goulson, D.; Leadbeater, E.; Lopez-Ballesteros, A.; et al. Improving pesticide-use data for the EU. Nat. Ecol. Evol. 2021, 5, 1560. [Google Scholar] [CrossRef]
- McNeil, M.; Roberts, A.M.I.; Cockerell, V.; Mulholland, V. Real-time PCR assay for quantification of Tilletia caries contamination of UK wheat seed. Plant Pathol. 2004, 53, 741–750. [Google Scholar] [CrossRef]
- Anonymous. Diagnosing Common Bunt of Wheat. Available online: https://www.agric.wa.gov.au/mycrop/diagnosing-common-bunt-wheat (accessed on 23 September 2023).
- Anonymous. Common Bunt (Stinking Smut) in Wheat. Available online: https://cropwatch.unl.edu/common-bunt-stinking-smut-wheat (accessed on 23 September 2023).
- Dumalasova, V.; Leisova-Svobodova, L.; Bartos, P. Common Bunt Resistance of Czech and European Winter Wheat Cultivars and Breeder Lines. Czech. J. Genet. Plant 2014, 50, 201–207. [Google Scholar] [CrossRef]
- Goates, B.J. Identification of New Pathogenic Races of Common Bunt and Dwarf Bunt Fungi, and Evaluation of Known Races Using an Expanded Set of Differential Wheat Lines. Plant Dis. 2012, 96, 361–369. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Sears, E.R.; Schaller, C.W.; Briggs, F.N. Identification of the chromosome carrying the Martin gene for resistance of wheat to bunt. Can. J. Genet. Cytol. 1960, 2, 262–267. [Google Scholar] [CrossRef]
- Scmidt, J.W.; Morris, R.; Johnson, V.A. Monosomic analysis for bunt resistance in derivatives of Turkey and oro wheats. Crop Sci. 1969, 9, 286–288. [Google Scholar] [CrossRef]
- McIntosh, R.A. Catalogue of gene symbols for wheat. In Proceedings of the 9th International Wheat Genetics Symposium, Saskatoon, SK, Canada, 2–7 August 1998; pp. 119–120. [Google Scholar]
- Ciuca, M. A Preliminary Report on the Identification of SSR Markers for Bunt (Tilletia sp.) Resistance in Wheat. Czech J. Genet. Plant 2011, 47, S142–S145. [Google Scholar] [CrossRef]
- Schaller, C.W.; Holton, C.S.; Kendrick, E.L. Inheritance of the second factor for resistance to bunt, Tilletia caries and T. foetida, in the wheat variety Martin. Agron. J. 1960, 52, 280–285. [Google Scholar] [CrossRef]
- Menzies, J.G.; Knox, R.E.; Popovic, Z.; Procunier, J.D. Common bunt resistance gene Bt10 located on wheat chromosome 6D. Can. J. Plant Sci. 2006, 86, 1409–1412. [Google Scholar] [CrossRef]
- Tekin, M.; Emiralioglu, O.; Yeken, M.Z.; Nadeem, M.A.; Ciftci, V.; Baloch, F.S. Wild relatives and their contributions to wheat breeding. In Ancient Wheats; Zencirci, N., Ulukan, H., Baloch, F.S., Mansoor, S., Rasheed, A., Eds.; Springer: Zug, Switzerland, 2022; pp. 197–233. [Google Scholar]
- Ipek, E.; Tekin, M.; Cat, A.; Akar, T. Resistance to stripe rust in Turkish durum wheat varieties and wild emmer genotypes. Cereal Res. Commun. 2023, 51, 147–154. [Google Scholar] [CrossRef]
- Goates, B. Common bunt and dwarf bunt. In Bunt and Smut Diseases of Wheat: Concepts and Methods of Disease Management; Wilcoxsin, R.D., Saari, E.E., Eds.; CIMMYT: Mexico City, Mexico, 1996; pp. 12–25. [Google Scholar]
- Cichy, K.; Goates, B. Evaluation of molecular markers for common bunt resistance genes in diverse wheat genotypes. In Proceedings of the ASA-CSSA-SSSA Annual Meeting, Pittsburg, PA, USA, 1–5 November 2009. [Google Scholar]
- Steffan, P.M.; Torp, A.M.; Borgen, A.; Backes, G.; Rasmussen, S.K. Mapping of common bunt resistance gene Bt9 in wheat. Theor. Appl. Genet. 2017, 130, 1031–1040. [Google Scholar] [CrossRef]
- Koch, E.; Weil, B.; Eibel, P. Development of a leaf symptom-based screening method for seed treatments with activity against Tilletia caries and application of the method using microbial antagonists. Z. Pflanzenk Pflanzen. 2004, 111, 470–483. [Google Scholar]
- Alvarado, G.; Rodriguez, F.M.; Pacheco, A.; Burgueno, J.; Crossa, J.; Vargas, M.; Perez-Rodriguez, P.; Lopez-Cruz, M.A. META-R: A software to analyze data from multi-environment plant breeding trials. Crop J. 2020, 8, 745–756. [Google Scholar] [CrossRef]
- Mamluk, O.F.; Van Slageren, M.W. Resistance to common bunt, yellow rust, leaf rust, and Septoria tritici blotch in wild einkorn and wild emmer wheat. Phytopathol. Mediterr. 1993, 32, 14–19. [Google Scholar]
- Bhatta, M.; Morgounov, A.; Belamkar, V.; Yorgancilar, A.; Baenziger, P.S. Genome-wide association study reveals favorable alleles associated with common bunt resistance in synthetic hexaploid wheat. Euphytica 2018, 214, 200. [Google Scholar] [CrossRef]
- Waud, J.L.; Metzger, R.J. Inheritance of a New Factor (Bt8) for Resistance to Common Bunt in Wheat. Crop Sci. 1970, 10, 703–704. [Google Scholar] [CrossRef]
- Johnsson, L. Climate Factors Influencing Attack of Common Bunt (Tilletia-Caries (Dc) Tul) in Winter-Wheat in 1940-1988 in Sweden. Z. Pflanzenk. Pflanzen. 1992, 99, 21–28. [Google Scholar]
- Polisenska, I.; Pospisil, A.; Benada, J. Effects of sowing date on common bunt (Tilletia caries) infection in winter wheat at lower inoculum rates. Z. Pflanzenk. Pflanzen. 1998, 105, 295–305. [Google Scholar]
- Liatukas, Z.; Ruzgas, V. Effect of air temperature on common bunt (Tilletia caries) infection in winter wheat. Acta Agric. Scand. Sect. B–Soil Plant Sci. 2009, 59, 225–232. [Google Scholar] [CrossRef]
- Koch, E.; Weil, B.; Wachter, R.; Wohlleben, S.; Spiess, H.; Krauthausen, H.J. Evaluation of selected microbial strains and commercial alternative products as seed treatments for the control of Tilletia tritici, Fusarium culmorum, Drechslera graminea and D-teres. J. Plant Dis. Protect. 2006, 113, 150–158. [Google Scholar] [CrossRef]
- Laroche, A.; Demeke, T.; Gaudet, D.A.; Puchalski, B.; Frick, M.; McKenzie, R. Development of a PCR marker for rapid identification of the Bt-10 gene for common bunt resistance in wheat. Genome 2000, 43, 217–223. [Google Scholar] [CrossRef]
- Ehn, M.; Michel, S.; Morales, L.; Gordon, T.; Dallinger, H.G.; Buerstmayr, H. Genome-wide association mapping identifies common bunt (Tilletia caries) resistance loci in bread wheat (Triticum aestivum) accessions of the USDA National Small Grains Collection. Theor. Appl. Genet. 2022, 135, 3103–3115. [Google Scholar] [CrossRef] [PubMed]
- Steffan, P.M.; Borgen, A.; Torp, A.M.; Backes, G.; Rasmussen, S.K. Association Mapping for Common Bunt Resistance in Wheat Landraces and Cultivars. Agronomy 2022, 12, 642. [Google Scholar] [CrossRef]
- Madenova, A.; Sapakhova, Z.; Bakirov, S.; Galymbek, K.; Yernazarova, G.; Kokhmetova, A.; Keishilov, Z. Screening of wheat genotypes for the presence of common bunt resistance genes. Saudi J. Biol. Sci. 2021, 28, 2816–2823. [Google Scholar] [CrossRef] [PubMed]
- Randhawa, M.S.; Bains, N.S.; Sohu, V.S.; Chhuneja, P.; Trethowan, R.M.; Bariana, H.S.; Bansal, U. Marker Assisted Transfer of Stripe Rust and Stem Rust Resistance Genes into Four Wheat Cultivars. Agronomy 2019, 9, 497. [Google Scholar] [CrossRef]
- Liu, R.; Lu, J.; Zhou, M.; Zheng, S.G.; Liu, Z.H.; Zhang, C.H.; Du, M.; Wang, M.X.; Li, Y.F.; Wu, Y.; et al. Developing stripe rust resistant wheat (Triticum aestivum L.) lines with gene pyramiding strategy and marker-assisted selection. Genet. Resour. Crop. Evol. 2020, 67, 381–391. [Google Scholar] [CrossRef]
- Sharma, A.; Srivastava, P.; Mavi, G.S.; Kaur, S.; Kaur, J.; Bala, R.; Singh, T.P.; Sohu, V.S.; Chhuneja, P.; Bains, N.S.; et al. Resurrection of Wheat Cultivar PBW343 Using Marker-Assisted Gene Pyramiding for Rust Resistance. Front Plant Sci 2021, 12, 570408. [Google Scholar] [CrossRef]
- Mundt, C.C. Pyramiding for Resistance Durability: Theory and Practice (vol 108, pg 792, 2019). Phytopathology 2018, 108, 792–802, Erratum in Phytopathology 2019, 109, 498. [Google Scholar]
Genes | Marker Name | Marker Type | Sequence (5′→3′) | Annealing Temperature (°C) | Reference |
---|---|---|---|---|---|
Bt8 | Xgwm114 | SSR | ACAAACAGAAAATCAAAACCCG | 58 °C | [27] |
Bt10 | ATCCATCGCCATTGGAGTG | ||||
Bt11 | |||||
Bt9 | Xgpw7433 | SSR | GTACATGGAAAGAGACCAACACCA | 60 °C | [28] |
CGCTGAGCAAGGACGATAG | |||||
Bt10 | FSD | SCAR | GTTTTATCTTTTTATTTC | 44 °C | [29] |
RSA | CTCCTCCCCCCA |
Number of Varieties | Resistance Gene | |||
---|---|---|---|---|
Bt8 | Bt9 | Bt10 | Bt11 | |
2 | + a | - | - | - |
10 | - | - | + | - |
15 | - | - | - | + |
10 | + | + | - | - |
2 | + | - | - | + |
18 | - | + | + | - |
30 | - | + | - | + |
6 | + | + | + | - |
9 | + | + | - | + |
Total | 29 | 73 | 34 | 56 |
Source of Variance | d.f. | Mean Squares | F |
---|---|---|---|
Genotype | 101 | 4224.49 | 90.42 ** |
Year | 2 | 15,541.00 | 332.66 ** |
Replication | 1 | 27.30 | 0.58 ns |
Genotype × year | 202 | 306.95 | 6.57 ** |
Error | 611 | 46.72 | |
Broad-sense heritability | 0.92 ** |
Season | N | Mean | Minimum | Maximum | CV (%) * | SD ** | Kurtosis | Skewness |
---|---|---|---|---|---|---|---|---|
2019–2020 | 102 | 66.44 | 3.17 | 94.49 | 42.69 | 28.36 | −0.59 | −0.92 |
2020–2021 | 102 | 49.88 | 5.41 | 91.41 | 54.63 | 27.25 | −1.38 | −0.15 |
2021–2022 | 102 | 62.94 | 5.29 | 94.06 | 46.93 | 29.53 | −0.99 | −0.77 |
Overall | 102 | 59.75 | 6.85 | 90.30 | 44.41 | 26.53 | −1.01 | −0.68 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the author. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tekin, M. Genetic Variation in Turkish Bread Wheat (Triticum aestivum L.) Varieties for Resistance to Common Bunt. Agronomy 2023, 13, 2491. https://doi.org/10.3390/agronomy13102491
Tekin M. Genetic Variation in Turkish Bread Wheat (Triticum aestivum L.) Varieties for Resistance to Common Bunt. Agronomy. 2023; 13(10):2491. https://doi.org/10.3390/agronomy13102491
Chicago/Turabian StyleTekin, Mehmet. 2023. "Genetic Variation in Turkish Bread Wheat (Triticum aestivum L.) Varieties for Resistance to Common Bunt" Agronomy 13, no. 10: 2491. https://doi.org/10.3390/agronomy13102491
APA StyleTekin, M. (2023). Genetic Variation in Turkish Bread Wheat (Triticum aestivum L.) Varieties for Resistance to Common Bunt. Agronomy, 13(10), 2491. https://doi.org/10.3390/agronomy13102491