Next Article in Journal
Physiological Influence of Water Stress Conditions on Novel HLB-Tolerant Citrus Rootstocks
Next Article in Special Issue
GSEYOLOX-s: An Improved Lightweight Network for Identifying the Severity of Wheat Fusarium Head Blight
Previous Article in Journal
Effects of Different Exogenous Organic Materials on Improving Soil Fertility in Coastal Saline-Alkali Soil
Previous Article in Special Issue
SSR Genotypes of the Puccinia triticina in 15 Provinces of China Indicate Regional Migration in One Season from East to West and South to North
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Pyrenophora graminea in Barley Seeds

Key Laboratory of Agricultural Integrated Pest Management of Qinghai Province, Scientific Observing and Experimental Station of Crop Pest in Xining, Ministry of Agriculture and Rural Affairs, Academy of Agriculture and Forestry Sciences, Qinghai University, Xining 810016, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Agronomy 2023, 13(1), 62; https://doi.org/10.3390/agronomy13010062
Submission received: 29 November 2022 / Revised: 22 December 2022 / Accepted: 23 December 2022 / Published: 24 December 2022
(This article belongs to the Special Issue Epidemiology and Control of Fungal Diseases of Crop Plants)

Abstract

Barley leaf stripe, caused by Pyrenophora graminea, is an essential systemic seed-borne disease in barley worldwide. Barley is a major cereal crop in the Qinghai–Tibet Plateau, and barley production has been threatened by leaf stripe in this region, particularly in organic farming regions. Detecting the pathogen in infected barley seeds is crucial for managing barley leaf stripe. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed to detect the pathogen based on primers designed based on the sequence of the pig 14 gene (GenBank: AJ277800) of P. graminea. The optimal concentrations of MgSO4, dNTPs, and enzymes in the LAMP reaction system were established as 10.0 mM, 1.0 mM, and 8 U in a 25 μL reaction volume, respectively. The established LAMP methods for detecting P. graminea were optimally performed at 63 °C for 70 min with high reliability. The minimum detection limit was 1 × 10−2 ng·μL−1 in the 25 μL reaction system. The specificity of LAMP for P. graminea was validated with eight fungal species. All DNA extracts from P. graminea-infected barley seeds with incubation, intact, and smashed treatments were applied in LAMP and confirmed to enable the detection of the pathogen. The LAMP assay in this study could facilitate the detection of P. graminea in barley seeds onsite, provide information for seed health certificates, and help decide on seed treatment in leaf stripe management.

1. Introduction

Barley (Hordeum vulgare.) is a vital cereal crop with valuable nutritional value. It ranked fourth in global grain production after maize, wheat, and rice in 2019 [1]. Barley is a widely adaptable crop. It can grow in cool conditions, having drought tolerance and a relatively short growing period [2]. These characteristics enable barley to grow in harsh geographic and ecological areas, such as the Qinghai–Tibet Plateau, where the average elevation exceeds 4500 m and the annual precipitation is about 100 to 300 mm. Barley is the major food crop providing total carbohydrate and protein nutrition for the residents in Qinghai Province of China. It has also been used as a source of animal fodder and other industrial products. The annual seeding acreage and barley production are approximately 350,000 hm2 and 1 million tons, accounting for 43% of the entire grain crop seeding area and 38% of the total outputs in Qinghai Province, respectively [3,4,5]. Large-scale losses in barley production can have disastrous impacts on this region’s economy and food security.
Barley leaf stripe, caused by Pyrenophora graminea S. Ito & Kurib. (anamorph Drechslera graminea (Rabenh. Ex Schlecht) Shoem.), is an important seed-borne disease leading to severe economic losses for barley growers in many countries [3,6,7,8,9,10,11]. In China, barley leaf stripe frequently occurs in the barley-growing areas in the Yangtze River valley and highland climate region (the Qinghai–Tibet Plateau and the surrounding areas) [12]. Barley leaf stripe is a severe disease in barley in Qinghai and Gansu Provinces, which is mainly grown in areas with highland climates. From 2009 to 2010, barley leaf stripe occurred all year round, with over 60% of fields being diseased and a disease incidence ranging from 16 to 100%, resulting in a yield loss of 30% in severely infected areas [13,14].
As a seed-borne fungus, P. graminea initiates infection as barley seeds commence to germination. The mycelia of P. graminea survive in the hull, pericarp, and seed coat, penetrate the coleorhiza, and spread systemically with the plant’s growth [13,15]. Conidia are produced from diseased leaves, spread to spikes, and infect immature embryos, resulting in diseased seeds [13,15,16]. Due to the cool and humid conditions for infection at the seed germination stage in the Qinghai–Tibet Plateau, the cool and wet climate is favorable for the development of barley leaf stripe. The mycelium of P. graminea in the infected seeds is the only primary inoculum for the disease [10,16]. Therefore, the most effective method for controlling this disease is routine seed health testing, certification, and healthy seed planting. Other disease management methods include seed treatment with systemic fungicides [7,10,17] and removing diseased barley plants at the early stage of the disease in the fields [14,18]. In the Qinghai–Tibet region, the local barley growers prefer to use farm-saved seeds for barley production due to the low cost and easy availability. At present, Qinghai is making every effort to build an export area of green organic agricultural and livestock products. To prevent pesticide imports and maintain the sustainability of the regional ecological system, the use of various chemical pesticides including seed dressing is prohibited in some areas, so the use of seeds without seed dressing has accelerated the prevalence and spread of the disease. With the extensively growing uncertificated seeds, the damage of barley leaf stripe has been becoming a severe problem to barley production in Qinghai in recent years. Therefore, identifying P. graminea in seeds is necessary for carrying out appropriate control strategies.
The current crop and seed health tests include morphological observation of pathogen colonies after incubating barley seeds on blotter or agar plates [13,14,19] and/or detection of pathogen-specific DNA fragments based on the conventional polymerase chain reaction (PCR) or real-time PCR [20,21,22]. The morphological identification requires a skillful technique to distinguish P. graminea from other fungi. The process takes a week or even more time if a pathogenicity test is required for further confirmation. In 2001, Taylor et al. developed a P. graminea-specific SCAR (sequence characterization amplification polymorphism) primer set, PG-2 F/R, which has been used to identify P. graminea from barley [8,23]. PCR-based tests significantly reduce the time, but they demand relatively expensive thermocyclers and imaging systems [8,20,22]. In addition, the above experimental methods need to be operated using professional instruments in the laboratory for disease identification, but the LAMP assay can meet the requirements of rapid disease detection in the field. It has been reported in the literature that an on-field LAMP assay was developed using Buffer C to perform on-site crude DNA extraction and a vacuum-insulated bottle as a temperature-stable, portable container for isothermal amplification under the field environment [24]. In Qinghai Province, most barley fields are scattered in remote areas due to the underdevelopment of the transportation system under the harsh geography and climate. Timely diagnosis of disease onsite, selection of pathogen-free seeds for planting, and early decisions on seed treatment for fungus-contaminated seeds will be imperative for barley growers. Therefore, developing a rapid and easy seed test method for detecting P. graminea is urgent.
Loop-mediated isothermal amplification (LAMP) is an efficient molecular diagnostic technique [25], which takes advantage of the Bst DNA polymerase with strand displacement activity to amplify more significant amounts of DNA in a short amount of time (<1 h) at a single temperature, eliminating the need for a thermocycler. The LAMP products can be directly observed and determined by the naked eye under indicator staining, eradicating the need for an imaging system [26]. Due to these advantages, LAMP assays are an ideal technique for identifying various plant pathogens [27,28,29,30,31]. Niessen and Vogel developed a LAMP assay to detect F. graminearium in wheat grains [29]. Oretag developed a LAMP assay for monitoring F. fujikuroi and Pyricularia oryzae in contaminated rice seeds [30]. Pieczul and Sedaghatjoo developed a LAMP assay to detect Tilletia spp. in contaminated wheat seeds, obtaining a high specificity and sensitivity for the detection of T. controversa with this technique [32,33]. These studies have demonstrated that the LAMP method can be used to detect cereal seed-borne fungi.
In this study, we developed a LAMP assay to detect P. graminea-contaminated barley seeds. We optimized the DNA preparation of barley seed samples and concentrations of reagents for the LAMP reaction, which will be particularly useful for pathogen identification in barley seed samples onsite, and seed management and disease control for barley leaf stripe.

2. Materials and Methods

2.1. Fungal Cultures and DNA Extraction

A total of 47 fungal isolates were used in this study (Table S1). In total, 39 P. graminea isolates (P.g-1 to P.g-39) were collected from 39 barley fields across Qinghai Province in China. The remaining eight were other barley-associated or fungal species closely related to P.graminea. These eight fungal isolates were used as the non-targets in the specificity test (Table s1). Isolate P.a-1 was provided by Dr. Guiqin Zhao of Gansu Agricultural University. Other isolates were provided by the Qinghai Academy of Agriculture and Forestry Sciences. All isolates except for Ustilago were cultured on potato dextrose agar (PDA) at 22 °C for 5 to 10 d, and the mycelium of each was used for DNA extraction. Mycocecidia of U. hordei isolate U.h-1 and U. nuda isolate U.n-1 were collected from naturally infected heads of barley plants in the fields. Urediniospores of P. striiformis isolate P.s-1 were propagated on a susceptible wheat cultivar, namely, Mingxian 169, at 10 to 15 °C for 15 to 20 d for DNA extraction. Fungal mycelia were scraped from the PDA plate surface, and P. striiformis urediniospores were harvested on the wheat leaves using a vacuum collector. In addition to the P. striiformis isolate, wheat was identified using the Chinese wheat differential hosts set for differentiating from the pathogen of wheat stripe rust; other pathogens were confirmed by morphological identification, internal transcribed spacer-polymerase chain reaction (ITS-PCR) amplification, and online homological comparison on the National Center for Biotechnology Information (NCBI) website (https://www.ncbi.nlm.nih.gov).
The genomic DNA of all isolates listed in Table S1 was extracted using the HP Fungal DNA Kit (OMEGA Bio-Tek Inc., Norcross, GA, USA) according to the manufacturer’s instructions. DNA quality was tested via 1.0% m/vol agarose gel electrophoresis, and the DNA quantity was measured using a Nanodrop Microvolume Spectrophotometer (ThermoFisher Scientific Inc., USA). DNA was stored in a refrigerator at −20 °C. The fungal species of all isolates were confirmed by PCR amplification with primers ITS1 and ITS4 (White et al., 1990).

2.2. Primer Design

The putative pathogenesis-related protein gene pig 14 of P. graminea (GenBank: AJ277800.1) was used as an amplification target for developing primers of the conventional PCR and LAMP assay. After BLAST searching the GenBank database, the sequence did not hit any of the sequences from the eight fungal species except the mentioned P. graminea. PCR tests of all fungal species showed that only P. graminea produced a specific expected band on agarose gel electrophoresis. Based on the DNA sequence of P. graminea, the primers for the LAMP assay were designed using the program PrimerExplore V5 (Eiken Chemical Co., Ltd., Tokyo, available at URL http://primerexplorer.jp/lampv5e/index.html (accessed on 11 Sep 2021) with the default parameters. Among five sets of designed primers, primer set-4 (Table 1) was selected for detection in the LAMP assay after specificity and sensitivity analyses. The position and sequences of LAMP primer set-4 and their complementary sequences in the target DNA are shown in Figure 1. All primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China).

2.3. LAMP Reaction Mixture and Amplicon Detection

The initial mixture of the LAMP reaction was developed following a previous study [27]. Briefly, a 25 µL reaction mixture was produced, containing 1.0 μL of 8 U/μL Bst DNA polymerase (New England Biolabs Inc, Ipswich, MA, USA), 2.5 µL of 10 × Isothermal Amplification Buffer (New England Biolabs Inc., Ipswich, MA, USA), 8.0 mM of MgSO4 (New England Biolabs Inc., Ipswich, MA, USA), 1.4 mM of dNTPs (Takara Bio Inc., Ipswich, MA, USA), 0.8 M of betaine (Sigma-Aldrich LLC, Beijing, China), 1.6 mM each of FIP and BIP, 0.2 mM each of F3 and B3, 0.4 mM of LB, and 2.0 µL of the template DNA. In addition, 30 μL of liquid paraffin was added to each tube to prevent volatilization. Sterile double-deionized water (ddH2O) was used instead of DNA for the negative control. The reaction mixture was incubated at 65 °C for 70 min. After amplification, the reaction was terminated by heating at 85 °C for 10 min.
LAMP products were detected by both SYBR Green I staining and agarose gel electrophoresis. For SYBR Green I staining detection, 0.5 μL of 10,000× SYBR Green I (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) was added to the reaction mixture, and the color in the mixture was visualized by the naked eye. After adding the SYBR Green I solution, LAMP reactions with amplified DNA products turned green, while the reaction without DNA amplification remained orange. For gel electrophoresis examination, 2.0 μL of the reaction products was checked on a 2.0% (m/vol) agarose gel, stained with GelGreen (Tiangen Biotech Co. Ltd., Beijing, China), and visualized under UV light. The evident ladder-shaped bands present visually if the target DNA is amplified in the LAMP assay.

2.4. Optimization of the LAMP Reaction

For the optimization of the LAMP reaction, experiments were designed according to the single-factor change based on the initial reaction conditions as described above. Five factors were tested under different levels, including a serial dilution of seven concentrations of MgSO4 solution (2.0, 4.0, 6.0, 8.0, 10.0, 12.0, and 14.0 mM), dNTPs (0.6, 0.8, 1.0, 1.2, 1.4, 1.6, and 1.8 mM), and Bst DNA polymerase (2.0, 4.0, 6.0, 8.0, 10.0, 12.0, and 14.0 U/L), eight temperatures (58, 59, 60, 61, 62, 63, 64, and 65 °C), and seven incubation times (10, 20, 30, 40, 50, 60, and 70 min). The reaction was first conducted under the initial condition excluding the test factor as the variable. Once the optimal condition of the test factor was determined, the optimal one was used in the subsequent experiments. Each experiment was repeated three times.

2.5. Conventional PCR

For comparison of the sensitivity between the LAMP assay and the conventional PCR, the same DNA template was used to perform the conventional PCR with the primer pairs pig 14-F(5′-TGCCCGTTCTTCTCGTTACC-3′) and pig 14-R (5′-TTATGTGGCAAATTAACCGACTA-3′) (Figure 1). The PCR mixture consisted of 12.5 μL of PrimeSTAR Max Premix (2×) (Takara Bio Inc, San Jose, CA, USA), 1 μL of 10 μM each of pig 14-F and pig 14-R, 2.0 μL of the template DNA, and 8.5 μL of sterile ddH2O. The PCR conditions were conducted under the following program: initial preheating for 5 min at 94 °C, followed by 30 cycles of denaturation at 94 °C for 1 min, annealing at 55 °C for 1 min, and extension at 72 °C for 1 min, with a final extension at 72 °C for 10 min. An amount of 20 μL of PCR products was separated on a 1.2% (m/vol) agarose gel, stained with GelGreen, and visualized under UV light.

2.6. Test of Analytical Sensitivity of LAMP Assay

The sensitivity of the LAMP assay was tested under the optimal reaction conditions using a 2.0 μL DNA template from P. graminea with a series of decimal dilutions ranging from 1 × 102 to 1 × 10−4 ng·μL−1. To reduce the variation in each dilution, three sets of DNA templates were diluted simultaneously. Then, the same three dilutions were combined into one set for the working DNA template. The sterile ddH2O without DNA was used as the template for the negative control. Each gradient test was repeated three times.

2.7. Experimental Study on the Specificity of LAMP Reaction

The specificity of the LAMP assay was tested with the genomic DNA of P. graminea and eight other plant-pathogenic fungi (Table 1). The eight fungal species are either closely related to P. graminea, such as P. avena, or commonly found on barley spikes/seeds. The LAMP assay was conducted under the optimal reaction conditions. The LAMP products were detected with SYBR Green staining and agarose gel electrophoresis. This experiment was conducted at least three times.

2.8. Application of LAMP Assay for Detecting P. graminea in Barley Seeds

2.8.1. Preparation of Artificially Inoculated Barley Seeds

The pathogen-free barley seeds from cultivar Kunlun 18 were soaked in sterile water for 12 h at 4 °C, followed by being frozen at −20 °C for 24 h. The seeds were then disinfected with a 75% (vol/vol) ethanol solution for 30 s and a 5% (m/vol) NaClO solution for 10 min, followed by a rinse with sterile water. Seeds were placed on the PDA medium with a 7 d culture of P. graminea at 22 °C for infection. Seeds were placed on PDA medium alone as the negative control. After 2 d, the mycelium on the surface of the seeds was removed with sterile gauze and disinfected with a 75% ethanol solution. The seeds were then used for DNA isolation.

2.8.2. DNA isolation from P. graminea in Artificially Inoculated Barley Seeds

A one-step DNA isolation kit (MightyPrep Reagent for DNA kit, Takara Bio Inc., San Jose, CA, USA) was applied to extract DNA from infected barley seeds by artificially inoculating them following the manufacturer’s instructions. Briefly, each of the barley seeds was loaded in a 0.2 mL sterile tube, and 50 μL of lysis buffer from the DNA isolation kit was added and incubated at 80 °C for 15 min. The tube was centrifugated at 12,000× g for 1 min, and 2.0 μL of supernatant DNA solution was used as the template DNA for the LAMP assay. DNA from both P. graminea-infected seeds and non-inoculated seeds was tested. Simultaneously, P. graminea genomic DNA solution and sterile double distilled water were used as positive and negative controls, respectively.

2.8.3. Detection of P. graminea in Naturally Diseased Barley Seeds

The barley seeds were collected from barley varieties 1141 and BDM02-13, susceptible to barley leaf stripe, in the experimental field in Haibei Prefecture, Qinghai Province, in 2019. The incidence of barley leaf stripe in 1141 and BDM02-13 in barley leaves was 47% and 35%, respectively. The harvested barley seeds were stored in seed storage cabinets at 4 °C. Thirty seeds of each cultivar were used for the LAMP assay. A single barley seed was rinsed with tap water for 15 s. The extra water on the seed was removed using sterile filter papers, and the seed was then placed into a 0.2 mL tube with 20 μL of sterile water. The tube was placed in an incubator at 22 °C for 3 d to promote P. graminea growth. A one-step DNA isolation method was used to obtain DNA from those seeds as described above, and 2 μL of DNA solution was used for molecular identification.
All samples were tested with the LAMP assay using the optimal conditions developed in this study, e.g., 25 μL reaction volume containing 8.0 U of Bst DNA polymerase, 1x isothermal amplification buffer, 10 mM of MgSO4 solution, 1.0 mM of dNTPs, 1.6 mM each of FIP and BIP, 0.4 mM each of F3 and B3, 0.2 mM of LB, 0.8 M of betaine, and 2.0 μL of the DNA solution, with incubation of the mixture at 63 °C for 60 min. In addition, P. graminea DNA and sterile water were used as templates in the SCAR and LAMP tests as positive and negative controls, respectively. To mitigate the chance of contamination, before the LAMP reaction, 0.5 μL of SYBR Green I solution was added to the lid of the 0.2 mL tube. After the reaction was completed, the tube was centrifuged to spin down the SYBR Green I solution and mixed with the reaction products. The LAMP products were examined by observing the color change. The rate of barley seeds carrying P. graminea was calculated as the number of LAMP assays of P. graminea-positive seeds divided by the total number of tested seeds for each barley cultivar.
For the control, the samples were also tested with specific SCAR primers PG-2 F (5′-CTTCTTAGCTGGGGCTACCGTC-3′) and PG-2 R (5′-ACCGACTCGGGAAAAGAGCA-3′) for the identification of P. graminea [22]. The PCR reaction (25 μL) consisted of 2.5 μL of 10× buffer, 2 mM MgCl2 solution, 0.5 μM each of PG-2 F and PG-2 R primers, 0.2 μM dNTPs, and 1 U Taq DNA polymerase. The PCR was amplified in a thermocycler programmed at 94 °C for 10 min, followed by 30 cycles of denaturation at 94 °C for 1 min, annealing at 68 °C for 1 min, and extension at 72 °C for 1 min, with a final extension at 72 °C for 10 min. PCR products (10 μL) were visualized and photographed under UV light after electrophoresis on 1.2% agarose gel with GelGreen staining.

2.9. Experiment on Stability of LAMP Reagent

Because the LAMP assay is used to detect P. graminea onsite in barley seed storage or fields in remote farms, LAMP reagents need to be transported in a cooler (4 °C); therefore, it is necessary to evaluate the stability of LAMP reagents. To save time during the LAMP assay onsite, the reaction ingredients were separately prepared as pre-mixed reagents A (including MgSO4, dNTPs, betaine, Bst polymerase, buffer, and H2O) and B (primer mixtures). Reagents A and B were stored in a refrigerator at −20 °C, and the stability of the reagents was tested over storage periods of 1 and 7 d. Before the test, reagents A and B were transferred to a 4 °C refrigerator for 24 h, and two reagents were then mixed for the LAMP assay. The DNA solution extracted from infected barley seeds as described above was used. Considering that the seed contents (starch, protein, lipids, etc.) might inhibit the LAMP assay, we compared DNA extracts from intact seeds and from smashed seeds; thirty seeds of highland barley variety 1141 were tested, including fifteen whole seeds and fifteen broken seeds, which were broken with sterile tips to release barley contents before adding lysis buffer for DNA isolation. The DNA solution from the smashed seeds contained more seed contents, while the DNA solution from the non-smashed seeds had no visible contents. In addition, P. graminea genomic DNA solution and sterile ddH2O were used as positive and negative controls, respectively.

3. Results

3.1. The Optimum Conditions of LAMP Reaction

When the concentration of MgSO4 solution ranged from 4.0 to 12.0 mM, the LAMP products showed an obvious green color in SYBR Green I staining. However, the products became faint green at the concentration of 14.0 mM MgSO4 solution. The products appeared orange at the concentration of 2.0 mM MgSO4 solution (Figure 2a). In the agarose gel detection, the LAMP products displayed ladder-like bands from the reaction with the MgSO4 solution concentrations ranging from 4.0 to 14.0 mM. The brightest band was produced with a concentration of 10.0 mM (Figure 2b), indicating that the optimal concentration of MgSO4 solution in the reaction was 10.0 mM.
The LAMP products from all seven serial dilutions of dNTPs were fluorescent green (Figure 3a) in SYBR Green I staining. Typical ladder-like bands appeared after agarose gel electrophoresis (Figure 3b), indicating that the target DNA could be amplified with dNTP concentrations between 0.6 and 1.8 mM. Meanwhile, the LAMP products showed robust bands in the repeat reactions with 1.0 mM dNTPs, indicating that the optimal concentration of dNTPs for the LAMP reaction was 1.0 mM.
All eight different concentrations of Bst DNA polymerase in the LAMP assay generated a substantial and similar amount of target DNA amplification (Figure 4a). The robust bands displayed on agarose when 8.0 U of Bst DNA polymerase was used in the LAMP reaction indicates that it was the optimal concentration for the reaction (Figure 4b).
In the LAMP assay, a similar green color was observed under the nine different temperature conditions in SYBR Green I staining (Figure 5a), and the typical ladder-like bands were observed at all nine of the different reaction temperatures in agarose gel electrophoresis (Figure 5b). This consistency indicates that the primers had no strict temperature requirements. The brighter bands were observed at 62 to 64 °C (Figure 5b), and thus 63 °C was regarded as the optimal temperature for the LAMP reaction.
LAMP products showed positive amplification when incubated for 50 to 70 min in both gel electrophoresis and SYBR Green staining (Figure 6a,b). Slightly faint bands were observed in agarose gel detection when incubated for 70 min. Robust bands were observed in gel electrophoresis after incubation for 60 min. Therefore, the optimal reaction time in the LAMP assay was 60 min to ensure amplification efficiency.
After testing five factors affecting the LAMP reaction at different levels, the optimal LAMP conditions were determined using: a 25 μL reaction volume containing 8.0 U of Bst DNA polymerase, 2.5 μL of 10× isothermal amplification buffer, 10 mM of MgSO4 solution, 1.0 mM of dNTPs, 1.6 mM each of FIP and BIP, 0.4 mM each of F3 and B3, 0.2 mM of LB, 0.8 M of betaine, and 2.0 μL of the target DNA template (10 pg to 100 ng), and the reaction mixture was incubated at 63 °C for 60 min.

3.2. Comparison of Sensitivity between LAMP Reaction and Conventional PCR Reaction

In the LAMP assay, both SYBR Green staining and gel electrophoresis produced positive bands at 1 × 10−2 ng/μL of P. graminea genomic DNA (Figure 7a,b). In contrast, the conventional PCR produced robust bands with template DNA between 1.0 and 1.0 × 102 ng/μL and a faint band with 1.0 × 10−1 ng/μL (Figure 7c). Therefore, the LAMP assay was 10 times more sensitive than the conventional PCR assay.

3.3. The Specificity of LAMP Assay

The genomic DNA of P. graminea and eight other plant-pathogenic fungi, including P. avena, U. hordei, U. nuda, D. graminicola, A. alternata, F. graminearum, P. oryzae, and P. striiformis, and the negative control (ddH2O) were tested under the optimal LAMP conditions. The positive LAMP product of P. graminea was properly detected by both agarose gel electrophoresis and SYBR Green I staining. In contrast, no amplification was detected using the DNA of the eight other fungal species (Figure 8). In addition, all 39 P. graminea isolates showed positive results with LAMP (Figure 9). These results indicate that the LAMP primers had high specificity for P. graminea.
Two methods were used to detect P. graminea in seeds of susceptible barley 1141 from the storehouse. After DNA from the nine seeds was incubated at 22 °C for 3 d, the DNA of each seed was divided into two sets: one for the conventional PCR with specific primers PG-2 R/F, and the other for the LAMP assay. The test results showed consistency, indicating that the LAMP assay can effectively and specifically detect P. graminea in barley seeds (Figure 10).

3.4. Detection of P. graminea in Artificially Infected Barley Seeds

Using DNA solution from barley seeds of P. graminea after artificial inoculation at 22 °C for 3 d, the P. graminea DNA solution, healthy highland barley seeds and ddH2O were used as controls. The LAMP assay of infected seeds and P. graminea DNA solution generated a positive reaction (Figure 11).

3.5. Detection of P. graminea in Barley Seeds from a Naturally Infected Field

The LAMP assay detected P. graminea in the DNA solution from barley seeds collected from naturally infected barley fields. Among 30 seeds of each cultivar, 22 seeds (73.3%) of barley cultivar 1141 and 13 seeds (43.3%) of barley cultivar BDM02-13 showed positive reactions (Figure 12).

3.6. Stability of LAMP Reagents

Robust and positive reactions in LAMP were generated from the pre-mixed reagents A and B over a storage period of either 1 d or 7 d at −20 °C (Figure 10). The results of the conventional PCR amplification showed that no bands were amplified from the intact seeds or broken seeds. The DNA solution from either smashed seeds or non-smashed seeds used as a template produced similar results, indicating that the seed contents had less effect on the LAMP assay.

4. Discussion

In this study, we developed and validated a LAMP assay to detect P. graminea, the seed-borne causal agent of barley leaf stripe. The specificity of the LAMP test correctly distinguishes the seed-borne pathogen P. graminea from other fungi, which is essential for formulating an appropriate management strategy to control the stripe virus. During crop growth, harvest, threshing, transportation, or storage, barley seeds may carry various pathogenic or saprophytic fungi. We confirmed the specificity of the LAMP assay on P. graminea, and no cross-reaction was observed with the DNA of other fungal species, i.e., P. avena, U. hordei, U. nuda, D. graminicola, A. alternata, F. graminearum, P. oryzae, and P. striiformis. Another species closely related to P. graminea, namely, P. avena, from oat was tested in this study, and the LAMP assay could differentiate P. graminea from P. avena. It also distinguished P. graminea from the other six pathogens (U. hordei, U. nuda, D. graminicola, A. alternata, F. graminearum, and P. striiformis) associated with barley. Therefore, the LAMP assay developed in this study is a reliable diagnostic tool for detecting P. graminea in barley seeds from Qinghai Province.
Compared with the conventional morphological identification of P. graminea, the LAMP assay significantly reduced the diagnostic time. Usually, the conventional morphological test using the freeze blotter or agar plate method requires about 7 d for incubation of the barley seeds on the blotter or agar plate before the microscopic observation by well-trained technicians [14,34]. Sometimes the fungal species cannot be determined by the freeze blotter method, and the biological assay must be carried out in a laboratory, which takes over one month to complete [34]. In contrast, this LAMP assay can be completed within two hours, and technicians are able to grasp the skill within a short time of training. This rapid, simple, and specific LAMP assay is a better alternative to the traditional diagnostic method.
We optimized the LAMP reaction time, temperature, and concentration of three reagents in the reaction mixture. The reaction is relatively stable for a wide temperature range because the products can be detected both in the gel images and in SYBR Green staining between 58 and 65 °C. The concentration of dNTPs and Bst DNA polymerase had fewer effects on the LAMP products in a wide range. Comparing the LAMP products from different reagent concentrations, no clear difference was observed for dNTP concentrations between 0.6 and 1.8 mM, and Bst DNA polymerase concentrations between 2.0 and 14.0 U/L. Meanwhile, lower (2.0 mM) and higher (14.0 mM) concentrations of MgSO4 solution in the reaction impacted the detection of LAMP products in SYBR Green staining. The product was not detectable in the gel image for the reaction at a lower (2.0 mM) MgSO4 solution concentration. The reaction time had a significant effect on the LAMP assay. It was possible to detect LAMP products between 50 and 60 min. The products were not detectable when the reaction time was too short or too long. Overall, the concentration of MgSO4 solution and reaction time were critical for the LAMP assay, while the dNTP and Bst DNA polymerase concentrations and the reaction temperature were relatively stable in a wide range of test values.
The LAMP assay only needs a small amount of fungal DNA as the template [27,29,30,32,33]. Douillet adapted an existing LAMP protocol based on ITS2 sequences, coupled with a rotating-arm sampler and simple cell lysis, for the in-field measurement of airborne sporangia of Plasmopara viticola [35]. We found that Pyrenophora graminea could be detected from a small amount of genomic DNA, about ~10 pg, in a 25 µL reaction system. The conventional PCR methods need 10 times the amount of genomic DNA compared this LAMP assay, as shown in this study. In contrast, 2.5–25 ng genomic DNA was required to detect P. graminea in the SCAR assay [22], which was used as a standard technique to monitor P. graminea in other studies [8,23]. For detecting P. graminea in infected barley seed samples, 2 µL of DNA extracts was sufficient to correctly identify the pathogen in this study. Using a commercial one-step DNA extraction kit, DNA isolation could be carried out with an easier operation and simpler equipment. Since polysaccharides, proteins, and other seed contents in the DNA solution may potentially inhibit the PCR, we compared DNA extracts from smashed barley seeds (containing some seed contents) and non-smashed seeds (without seed contents) and found that both DNA extracts generated similar LAMP results (Figure 10).
Therefore, it is necessary to develop a LAMP assay with high specificity. In the research, two new LAMP assays were developed to detect Fusarium acuminatum and F. solani based on the partial translation elongation factor-1 alpha (TEF-1 alpha) gene region [36]. These two rapid and specific LAMP assays could be applied for direct detection of F. acuminatum and F. solani on Astragalus membranaceus [36].

5. Conclusions

We developed a LAMP assay to detect P. graminea in barley seeds. The specificity, sensitivity, efficiency, and simplicity of the LAMP assay were confirmed with tests of samples of single barley seeds. LAMP detection technology can detect single seed lysates of infected P. graminea, but ordinary PCR detection technology cannot detect whether one seed carries fungus. This technology can accurately detect target fungus sources. For the future application of this technique to the diagnosis of P. graminea onsite, particularly for the larger quantities of seed lots in farm seed storages, the efficiency should be improved. DNA extracts from samples of multiple seeds instead of single seeds will be evaluated in future LAMP assays. Investigations rational sampling size and DNA isolation method for LAMP are underway.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy13010062/s1, Table S1: Fungal species, host, origin and the test results in loop-mediated isothermal amplification (LAMP) assay.

Author Contributions

Conceptualization, Z.H. and Q.Y.; methodology, Z.H., L.C., C.D. and Q.Y.; validation, Z.H. and Q.Y.; formal analysis, Z.H. and L.C.; investigation, J.Y., Q.G. and Q.Y.; resources, Q.G. and Q.Y.; data curation, Z.H., L.C. and Y.L.; writing—original draft preparation, Z.H.; writing—review and editing, L.C., Y.L. and Q.Y.; visualization, Z.H.; supervision, Q.Y.; project administration, Q.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financially supported by the Applied Basic Research Project of Qinghai, China (2020-ZJ-748; 2022-ZJ-Y10), and partially funded by the CAS “Light of West China” Program (2021) and the Open Project (CSBAAKF2021011) of the State Key Laboratory of Crop Stress Biology for Arid Areas.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors are grateful for the critical review of the manuscript by Meinan Wang. We thank Guiqin Zhao (Gansu Agricultural University in China) for providing P. avenae isolates.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. FAOSTAT.UN Food and Agriculture Organization Corporate Statistical Database. Available online: http://www.fao.org/faostat/en/#data/QC (accessed on 3 November 2021).
  2. Zohary, D.; Hopf, M. Domestication of Plants in the Old World: The Origin and Spread of Cultivated Plants in West Asia, Europe and the Nile Valley, 3rd ed.; Oxford University Press: Oxford, UK, 2000; pp. 59–69. [Google Scholar]
  3. Wu, K. Highland barley, a miraculous crop on the Qinghai-Tibet Plateau. For. Hum. 2009, 7, 50–59. [Google Scholar]
  4. Wei, C.; Yao, X.H.; Yao, Y.H.; An, L.K.; Wu, K.L. Isolation and expression analysis of HvnRPS2 in hulless barley under leaf stripe stress. Acta Bot. Boreali-Occident. Sin. 2021, 41, 2021–2029. [Google Scholar]
  5. Yao, X.H.; Wang, Y.; Yao, Y.H.; An, L.K.; Wang, Y.K.; Wu, K.L. Isolation and expression of a new gene HVMEL1 AGO in Tibetan hulless barley under leaf stripe stress. Acta Agron. Sin. 2022, 48, 1181–1190. [Google Scholar] [CrossRef] [Scilit]
  6. Benkorteby-Lyazidi, H.; Zeghar, I.; Hanifi-Mekliche, L.; Bouznad, Z. Barley leaf stripe disease in Algeria: Evaluation of virulent P. graminea isolates and identification of resistant Algerian barley genotypes. J. Agric. Sci. 2019, 25, 367–372. [Google Scholar] [CrossRef] [Scilit]
  7. Cockerell, V.; Rennie, W.J.; Jacks, M. Incidence and control of barley leaf stripe (P. graminea) in Scottish barley during the period 1987–1992. Plant Pathol. 1995, 44, 655–661. [Google Scholar] [CrossRef] [Scilit]
  8. Dokhanchi, H.; Babai-Ahari, A.; Arzanlou, M. Distribution of mating type alleles in Iranian populations of Pyrenophora graminea, the causal agent of barley leaf stripe disease, using a multiplex PCR approach. Eur. J. Plant Pathol. 2020, 156, 343–354. [Google Scholar] [CrossRef] [Scilit]
  9. Tekauz, A.; Chiko, A.W. Leaf stripe of barley caused by Pyrenophora graminea: Occurrence in Canada and comparisons with barley stripe mosaic. Can. J. Plant Pathol. 1980, 2, 152–158. [Google Scholar] [CrossRef] [Scilit]
  10. Porta-Puglia, A.; Delogu, G.; Vannacci, G. Pyrenophora graminea on winter barley seed: Effect on disease incidence and yield losses. J. Phytopathol. 2010, 117, 26–33. [Google Scholar] [CrossRef] [Scilit]
  11. Yan, J.H.; Yao, Q.; Chen, H.M. Identification of resistance of major barley cultivars (lines) to leaf stripe and leaf scald in Qinghai Province. Plant Prot. 2016, 42, 212–214. [Google Scholar]
  12. Hou, J.J. Functional Analysis of Pathogenic Candidate gene Pgmiox in Pyrenophora graminea. Master Thesis, Gansu Agricultural University, Lanzhou, China, 2020. [Google Scholar]
  13. Yang, R. Study of Pathogen and Chemical Control of Barley Leaf Stripe. Master Thesis, Gansu Agricultural University, Lanzhou, China, 2010. [Google Scholar]
  14. Zheng, G. Study of Pathogenic and Chemical Control of Barley Leaf Stripe. Doctoral Dissertation, Gansu Agricultural University, Lanzhou, China, 2011. [Google Scholar]
  15. Platenkamp, R. Investigation on the infection pathway of Drechslera graminea in germinating barley. K. Vet. -Og Landbohoeiskoles Aarsskrift 1976, 19761332098. [Google Scholar]
  16. Mathre, D.E. Compendium of Barley Diseases; The American Phytopathology Society: Saint Paul, MN, USA, 1982. [Google Scholar]
  17. Johnston, R.H.; Metz, S.G.; Riesselman, J.H. Seed treatment for control of Pyrenophora leaf stripe of barley. Plant Dis. 1982, 66, 1122–1124. [Google Scholar] [CrossRef] [Scilit]
  18. Du, W.F.; Zuo, L.L.; He, M.; Li, Y.Q. Control efficiency of fungicides by seed dressing on barley stripe disease. Plant Prot. 2013, 39, 190–192. [Google Scholar]
  19. Yang, L.; Zhang, L.; Cao, J.; Wang, L.; Shi, H.; Zhu, F.; Ji, Z. Rapid Detection of Peach Shoot Blight Caused by Phomopsis amygdali Utilizing a New Target Gene Identified from Genome Sequences Within Loop-Mediated Isothermal Amplification. Plant Dis. 2022, 106, 669–675. [Google Scholar] [CrossRef] [Scilit]
  20. Liu, B.; Li, Z.; Du, J.; Zhang, W.; Che, X.; Zhang, Z.; Chen, P.; Wang, Y.; Li, Y.; Wang, S.; et al. Loop-Mediated Isothermal Amplification (LAMP) for the Rapid and Sensitive Detection of Alternaria alternata (Fr.) Keissl in Apple Alternaria Blotch Disease with Aapg-1 Encoding the Endopolygalacturonase. Pathogens 2022, 11, 1221. [Google Scholar] [CrossRef] [Scilit]
  21. Shu, R.; Yin, X.; Long, Y.; Yuan, J.; Zhou, H. Detection and Control of Pantoea agglomerans Causing Plum Bacterial Shot-Hole Disease by Loop-Mediated Isothermal Amplification Technique. Front. Microbiol. 2022, 13, 896567. [Google Scholar] [CrossRef] [Scilit]
  22. Sun, H.T.; Sun, L.; Yang, L.; Wang, Z.; Xia, Z.; Yang, X.; Jiao, Z.; Feng, J.; Liang, Y. Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Phoma macdonaldii, the Causal Agent of Sunflower Black Stem. Plant Dis. 2022, 106, 260–265. [Google Scholar] [CrossRef] [Scilit]
  23. Ficsor, A.; Bakonyi, J.; Csosz, M.; Tomcsanyi, A.; Varga, J.; Toth, B. Occurrence of barley pathogenic Pyrenophora species and their mating types in Hungary. Cereal Res. Commun. 2014, 42, 612–619. [Google Scholar] [CrossRef] [Scilit]
  24. Lu, C.; Dai, T.; Zhang, H.; Zeng, D.; Wang, Y.; Yang, W.; Zheng, X. A novel LAMP assay using hot water in vacuum insulated bottle for rapid detection of the soybean red crown rot pathogen Calonectria ilicicola. Australas. Plant Pathol. 2022, 51, 251–259. [Google Scholar] [CrossRef] [Scilit]
  25. Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef] [Scilit]
  26. Gomez-Gutierrez, S.V.; Goodwin, S.B. Loop-Mediated Isothermal Amplification for Detection of Plant Pathogens in Wheat (Triticum aestivum). Front. Plant Sci. 2022, 13, 857673. [Google Scholar] [CrossRef] [Scilit]
  27. Fan, F.; Yin, W.X.; Li, G.Q.; Lin, Y.; Guo, C.X. Development of a LAMP method for detecting SDHI fungicide resistance in Botrytis cinerea. Plant Dis. 2018, 102, 1612–1618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Deng, S.; Ma, X.; Chen, Y.; Feng, H.; Zhou, D.; Wang, X.; Zhang, Y.; Zhao, M.; Zhang, J.; Daly, P.; et al. LAMP Assay for Distinguishing Fusarium oxysporum and Fusarium commune in Lotus (Nelumbo nucifera) Rhizomes. Plant Dis. 2022, 106, 231–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Lakshmi, K.R.S.; Kamalakannan, A.; Gopalakrishnan, C.; Rajesh, S.; Panneerselvam, S.; Ganapati, P.S. Loop-mediated isothermal amplification assay: A specific and sensitive tool for the detection of Bipolaris oryzae causing brown spot disease in rice. Phytoparasitica 2022, 50, 543–553. [Google Scholar] [CrossRef] [Scilit]
  30. Ortega, S.F.; Tomlinson, J.; Hodgetts, J.; Spadaro, D.; Gullino, M.L.; Boonham, N. Development of loop-mediated isothermal amplification assays for the detection of seed-borne fungal pathogens F. fujikuroi and P. oryzae in rice seed. Plant Dis. 2018, 102, 1549–1558. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Zhang, L.; Gleason, C. Loop-mediated isothermal amplification for the diagnostic detection of Meloidogyne chitwoodi and M. fallax. Plant Dis. 2019, 103, 12–18. [Google Scholar] [CrossRef] [Scilit]
  32. Pieczul, K.; Perek, A.; Kubiak, K. Detection of Tilletia caries, Tilletia laevis and Tilletia controversa wheat grain contamination using loop-mediated isothermal DNA amplification (LAMP). J. Microbiol. Methods 2018, 154, 141–146. [Google Scholar] [CrossRef] [Scilit]
  33. Sedaghatjoo, S.; Forster, M.K.; Niessen, L.; Karlovsky, P.; Killermann, B.; Maier, W. Development of a loop-mediated isothermal amplification assay for the detection of Tilletia controversa based on genome comparison. Sci. Rep. 2021, 11, 1–13. [Google Scholar] [CrossRef] [Scilit]
  34. Jorgensen, J. Comparative testing of barley seed for inoculum of Pyrenophora graminea and Pyrenophora teres in greenhouse and field. Seed Sci. Technol. 1980, 8, 377–381. [Google Scholar]
  35. Douillet, A.; Laurent, B.; Beslay, J.; Massot, M.; Raynal, M.; Delmotte, F. LAMP for in-field quantitative assessments of airborne grapevine downy mildew inoculum. J. Appl. Microbiol. 2022, 133, 3404–3412. [Google Scholar] [CrossRef] [Scilit]
  36. Wang, Y.; Wang, C.; Ma, Y.; Zhang, X.; Yang, H.; Li, G.; Li, X.; Wang, M.; Zhao, X.; Wang, J.; et al. Rapid and specific detection of Fusarium acuminatum and Fusarium solani associated with root rot on Astragalus membranaceus using loop-mediated isothermal amplification (LAMP). Eur. J. Plant Pathol. 2022, 163, 305–320. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Sequence and orientation of primers in gene pig 14 (GenBank: AJ277800.1) used to develop LAMP and conventional PCR to detect P. graminea. Binding sites for outer primers in LAMP are highlighted in yellow, inner primers in green, and LB primers in blue. Binding sites for primers of conventional PCR are marked in purple.
Figure 1. Sequence and orientation of primers in gene pig 14 (GenBank: AJ277800.1) used to develop LAMP and conventional PCR to detect P. graminea. Binding sites for outer primers in LAMP are highlighted in yellow, inner primers in green, and LB primers in blue. Binding sites for primers of conventional PCR are marked in purple.
Agronomy 13 00062 g001
Figure 2. Profiles of LAMP reactions for P. graminea with serial concentrations of MgSO4 solution. Assessments of LAMP products based on SYBR Green I visualization of color change (a) or agarose gel electrophoresis (b). Lane M, DNA ladder; tubes and lanes 1 to 7, LAMP reaction with MgSO4 solution concentrations of 2.0, 4.0, 6.0, 8.0, 10.0, 12.0, and 14.0 mM, respectively; tube and lane 8, negative control with ddH2O.
Figure 2. Profiles of LAMP reactions for P. graminea with serial concentrations of MgSO4 solution. Assessments of LAMP products based on SYBR Green I visualization of color change (a) or agarose gel electrophoresis (b). Lane M, DNA ladder; tubes and lanes 1 to 7, LAMP reaction with MgSO4 solution concentrations of 2.0, 4.0, 6.0, 8.0, 10.0, 12.0, and 14.0 mM, respectively; tube and lane 8, negative control with ddH2O.
Agronomy 13 00062 g002
Figure 3. Profiles of LAMP reactions for P. graminea with serial concentrations of dNTPs. Assessments of LAMP products based on SYBR Green I visualization of color change (a) or agarose gel electrophoresis (b). Lane M, DNA ladder; tubes and lanes 1 to 7, LAMP reaction with dNTP concentrations of 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, and 1.8 mM, respectively; tube and lane 8, negative control with ddH2O.
Figure 3. Profiles of LAMP reactions for P. graminea with serial concentrations of dNTPs. Assessments of LAMP products based on SYBR Green I visualization of color change (a) or agarose gel electrophoresis (b). Lane M, DNA ladder; tubes and lanes 1 to 7, LAMP reaction with dNTP concentrations of 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, and 1.8 mM, respectively; tube and lane 8, negative control with ddH2O.
Agronomy 13 00062 g003
Figure 4. Profiles of LAMP reactions for P. graminea with serial concentrations of Bst DNA polymerase. Assessments of LAMP products based on SYBR Green I visualization of color change (a) or agarose gel electrophoresis (b). Lane M, DNA ladder; tubes and lanes 1 to 7, LAMP reaction with Bst DNA polymerase concentrations of 2.0, 4.0, 6.0, 8.0, 10.0, 12.0, and 14.0 U, respectively; tube and lane 8, negative control with ddH2O.
Figure 4. Profiles of LAMP reactions for P. graminea with serial concentrations of Bst DNA polymerase. Assessments of LAMP products based on SYBR Green I visualization of color change (a) or agarose gel electrophoresis (b). Lane M, DNA ladder; tubes and lanes 1 to 7, LAMP reaction with Bst DNA polymerase concentrations of 2.0, 4.0, 6.0, 8.0, 10.0, 12.0, and 14.0 U, respectively; tube and lane 8, negative control with ddH2O.
Agronomy 13 00062 g004
Figure 5. Profiles of LAMP reactions for P. graminea with different temperatures. Assessments of LAMP products based on SYBR Green I visualization of color change (a) or agarose gel electrophoresis (b). Lane M, DNA ladder; tubes and lanes 1 to 9, LAMP reaction with temperatures of 58, 59, 60, 61, 62, 63, 64, 65, and 66 °C, respectively; tube and lane 10, negative control with ddH2O at 65 °C.
Figure 5. Profiles of LAMP reactions for P. graminea with different temperatures. Assessments of LAMP products based on SYBR Green I visualization of color change (a) or agarose gel electrophoresis (b). Lane M, DNA ladder; tubes and lanes 1 to 9, LAMP reaction with temperatures of 58, 59, 60, 61, 62, 63, 64, 65, and 66 °C, respectively; tube and lane 10, negative control with ddH2O at 65 °C.
Agronomy 13 00062 g005
Figure 6. Profiles of LAMP reactions for P. graminea with different reaction times. Assessments of LAMP products based on SYBR Green I visualization of color change or agarose gel electrophoresis. Lane M, DNA ladder; tubes and lanes 1 to 7, LAMP reaction with reaction time of 10, 20, 30, 40, 50, 60, and 70 min, respectively; tube and lane 8, negative control with ddH2O for 60 min.
Figure 6. Profiles of LAMP reactions for P. graminea with different reaction times. Assessments of LAMP products based on SYBR Green I visualization of color change or agarose gel electrophoresis. Lane M, DNA ladder; tubes and lanes 1 to 7, LAMP reaction with reaction time of 10, 20, 30, 40, 50, 60, and 70 min, respectively; tube and lane 8, negative control with ddH2O for 60 min.
Agronomy 13 00062 g006
Figure 7. Comparisons of the sensitivity between loop-mediated isothermal amplification (LAMP) and conventional PCR for detecting P. graminea with serial DNA dilutions. Assessments of LAMP reactions based on SYBR Green I visualization of color change (a), agarose gel electrophoresis (b), and the conventional PCR products from agarose gel electrophoresis (c). Lane M, DNA ladder; tubes and lanes 1 to 7, reaction of serial P. graminea genomic DNA dilutions of 1 × 102, 1 × 101, 1 × 100, 1 × 10−1, 1 × 10−2, 1 × 10−3, and 1 × 10−4 ng/μL, respectively; tube and lane 8, reaction with ddH2O (negative control).
Figure 7. Comparisons of the sensitivity between loop-mediated isothermal amplification (LAMP) and conventional PCR for detecting P. graminea with serial DNA dilutions. Assessments of LAMP reactions based on SYBR Green I visualization of color change (a), agarose gel electrophoresis (b), and the conventional PCR products from agarose gel electrophoresis (c). Lane M, DNA ladder; tubes and lanes 1 to 7, reaction of serial P. graminea genomic DNA dilutions of 1 × 102, 1 × 101, 1 × 100, 1 × 10−1, 1 × 10−2, 1 × 10−3, and 1 × 10−4 ng/μL, respectively; tube and lane 8, reaction with ddH2O (negative control).
Agronomy 13 00062 g007
Figure 8. Specificity of loop-mediated isothermal amplification (LAMP) on different fungal species. The LAMP products were detected based on SYBR Green I staining (a) and agarose gel electrophoresis (b). Lane M, DNA ladder; tubes and lanes 1 to 10, LAMP products with genomic DNA of P. graminea isolate P.g-1, P. avena isolate P.a-1, U. hordei isolate U.h-1, U. nuda isolate U.n-1, D. graminicola isolate D.g-1, A. alternata isolate A.a-1, F. graminearum isolate F.g-1, P. oryzae isolate P.o-1, P. striiformis isolate P.s-1, and DNA-free ddH2O.
Figure 8. Specificity of loop-mediated isothermal amplification (LAMP) on different fungal species. The LAMP products were detected based on SYBR Green I staining (a) and agarose gel electrophoresis (b). Lane M, DNA ladder; tubes and lanes 1 to 10, LAMP products with genomic DNA of P. graminea isolate P.g-1, P. avena isolate P.a-1, U. hordei isolate U.h-1, U. nuda isolate U.n-1, D. graminicola isolate D.g-1, A. alternata isolate A.a-1, F. graminearum isolate F.g-1, P. oryzae isolate P.o-1, P. striiformis isolate P.s-1, and DNA-free ddH2O.
Agronomy 13 00062 g008
Figure 9. Profiles of loop-mediated isothermal amplification (LAMP) for 39 P. graminea isolates. Assessments of LAMP products based on SYBR Green I visualization of color change. Tubes 1 to 39, P. graminea isolates Pg-1 to Pg-39 isolated from 39 different barley-growing areas in Qinghai, China; tube 40, DNA-free ddH2O.
Figure 9. Profiles of loop-mediated isothermal amplification (LAMP) for 39 P. graminea isolates. Assessments of LAMP products based on SYBR Green I visualization of color change. Tubes 1 to 39, P. graminea isolates Pg-1 to Pg-39 isolated from 39 different barley-growing areas in Qinghai, China; tube 40, DNA-free ddH2O.
Agronomy 13 00062 g009
Figure 10. Loop-mediated isothermal amplification (LAMP) detection of P. graminea in barley tissues with reaction mix under different storage times. Assessment based on SYBR Green I visualization of color change. The mixed reagents A and B were stored at −20 °C for 1 d (a) and 7 d (b) and then transferred to a 4 °C refrigerator for 24 h. Tubes 1 to 6, DNA templates from P. graminea (positive control), smashed seeds infected with P. graminea, infected intact seeds, healthy seeds, healthy smashed seeds, and the negative control (H2O).
Figure 10. Loop-mediated isothermal amplification (LAMP) detection of P. graminea in barley tissues with reaction mix under different storage times. Assessment based on SYBR Green I visualization of color change. The mixed reagents A and B were stored at −20 °C for 1 d (a) and 7 d (b) and then transferred to a 4 °C refrigerator for 24 h. Tubes 1 to 6, DNA templates from P. graminea (positive control), smashed seeds infected with P. graminea, infected intact seeds, healthy seeds, healthy smashed seeds, and the negative control (H2O).
Agronomy 13 00062 g010
Figure 11. Loop-mediated isothermal amplification (LAMP) detection of P. graminea-infected seeds sampled from fields. Tube 1: DNA from P. graminea (positive control); tubes 2–9: DNA template from infected barely seeds after incubation at 22 °C for 3 days; tube 10: DNA from infected barley seed without incubation; tube 11: DNA from healthy barley seed (negative control); tube 12: ddH2O (negative control).
Figure 11. Loop-mediated isothermal amplification (LAMP) detection of P. graminea-infected seeds sampled from fields. Tube 1: DNA from P. graminea (positive control); tubes 2–9: DNA template from infected barely seeds after incubation at 22 °C for 3 days; tube 10: DNA from infected barley seed without incubation; tube 11: DNA from healthy barley seed (negative control); tube 12: ddH2O (negative control).
Agronomy 13 00062 g011
Figure 12. Loop-mediated isothermal amplification (LAMP) detection of P. graminea in barley seeds from naturally infected fields. Assessment based on SYBR Green I visualization of color change. Profiles in (a) are LAMP products with DNA from barley seeds of cultivar 1141, and profiles in (b) are those from cultivar BDM02-3. Tube 1, reaction with genomic DNA from P. graminea (positive control); tubes 2 to 31, reactions with DNA from naturally infected single barley seeds; tube 32, reaction with sterile ddH2O (negative control).
Figure 12. Loop-mediated isothermal amplification (LAMP) detection of P. graminea in barley seeds from naturally infected fields. Assessment based on SYBR Green I visualization of color change. Profiles in (a) are LAMP products with DNA from barley seeds of cultivar 1141, and profiles in (b) are those from cultivar BDM02-3. Tube 1, reaction with genomic DNA from P. graminea (positive control); tubes 2 to 31, reactions with DNA from naturally infected single barley seeds; tube 32, reaction with sterile ddH2O (negative control).
Agronomy 13 00062 g012
Table 1. Primer sequences used for LAMP assay in the detection of Pyrenophora graminea.
Table 1. Primer sequences used for LAMP assay in the detection of Pyrenophora graminea.
Primer Name.R5′ to 3′oligonucleotide SequenceLength (bp)
Pig 14-F3CAGAATAAGGGCCGTCTTGG21
Pig 14-B3AGGACCACACATTCAACCAA21
Pig 14-F2CTTCGACATTTTGCGATCCG20
Pig 14-B2AGTCGATCGTCTCATCCCGAT21
Pig 14-FIP(F1c-F2)GCCAGAACTGAACCAGGCAGTA_CTTCGACATTTTGCGATCCG43
Pig 14-BIP(B1c-B2)CCGCACGACACCTGGGAAAT_AGTCGATCGTCTCATCCGAT41
Pig 14-LBCGAGTCTCCCTGCGGGACAA20
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hu, Z.; Chen, L.; Du, C.; Liu, Y.; Yan, J.; Guo, Q.; Yao, Q. Development of Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Pyrenophora graminea in Barley Seeds. Agronomy 2023, 13, 62. https://doi.org/10.3390/agronomy13010062

AMA Style

Hu Z, Chen L, Du C, Liu Y, Yan J, Guo Q, Yao Q. Development of Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Pyrenophora graminea in Barley Seeds. Agronomy. 2023; 13(1):62. https://doi.org/10.3390/agronomy13010062

Chicago/Turabian Style

Hu, Zhangwei, Liyifan Chen, Chunmei Du, Yaoxia Liu, Jiahui Yan, Qingyun Guo, and Qiang Yao. 2023. "Development of Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Pyrenophora graminea in Barley Seeds" Agronomy 13, no. 1: 62. https://doi.org/10.3390/agronomy13010062

APA Style

Hu, Z., Chen, L., Du, C., Liu, Y., Yan, J., Guo, Q., & Yao, Q. (2023). Development of Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Pyrenophora graminea in Barley Seeds. Agronomy, 13(1), 62. https://doi.org/10.3390/agronomy13010062

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop