Development of Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Pyrenophora graminea in Barley Seeds
Abstract
1. Introduction
2. Materials and Methods
2.1. Fungal Cultures and DNA Extraction
2.2. Primer Design
2.3. LAMP Reaction Mixture and Amplicon Detection
2.4. Optimization of the LAMP Reaction
2.5. Conventional PCR
2.6. Test of Analytical Sensitivity of LAMP Assay
2.7. Experimental Study on the Specificity of LAMP Reaction
2.8. Application of LAMP Assay for Detecting P. graminea in Barley Seeds
2.8.1. Preparation of Artificially Inoculated Barley Seeds
2.8.2. DNA isolation from P. graminea in Artificially Inoculated Barley Seeds
2.8.3. Detection of P. graminea in Naturally Diseased Barley Seeds
2.9. Experiment on Stability of LAMP Reagent
3. Results
3.1. The Optimum Conditions of LAMP Reaction
3.2. Comparison of Sensitivity between LAMP Reaction and Conventional PCR Reaction
3.3. The Specificity of LAMP Assay
3.4. Detection of P. graminea in Artificially Infected Barley Seeds
3.5. Detection of P. graminea in Barley Seeds from a Naturally Infected Field
3.6. Stability of LAMP Reagents
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAOSTAT.UN Food and Agriculture Organization Corporate Statistical Database. Available online: http://www.fao.org/faostat/en/#data/QC (accessed on 3 November 2021).
- Zohary, D.; Hopf, M. Domestication of Plants in the Old World: The Origin and Spread of Cultivated Plants in West Asia, Europe and the Nile Valley, 3rd ed.; Oxford University Press: Oxford, UK, 2000; pp. 59–69. [Google Scholar]
- Wu, K. Highland barley, a miraculous crop on the Qinghai-Tibet Plateau. For. Hum. 2009, 7, 50–59. [Google Scholar]
- Wei, C.; Yao, X.H.; Yao, Y.H.; An, L.K.; Wu, K.L. Isolation and expression analysis of HvnRPS2 in hulless barley under leaf stripe stress. Acta Bot. Boreali-Occident. Sin. 2021, 41, 2021–2029. [Google Scholar]
- Yao, X.H.; Wang, Y.; Yao, Y.H.; An, L.K.; Wang, Y.K.; Wu, K.L. Isolation and expression of a new gene HVMEL1 AGO in Tibetan hulless barley under leaf stripe stress. Acta Agron. Sin. 2022, 48, 1181–1190. [Google Scholar] [CrossRef] [Scilit]
- Benkorteby-Lyazidi, H.; Zeghar, I.; Hanifi-Mekliche, L.; Bouznad, Z. Barley leaf stripe disease in Algeria: Evaluation of virulent P. graminea isolates and identification of resistant Algerian barley genotypes. J. Agric. Sci. 2019, 25, 367–372. [Google Scholar] [CrossRef] [Scilit]
- Cockerell, V.; Rennie, W.J.; Jacks, M. Incidence and control of barley leaf stripe (P. graminea) in Scottish barley during the period 1987–1992. Plant Pathol. 1995, 44, 655–661. [Google Scholar] [CrossRef] [Scilit]
- Dokhanchi, H.; Babai-Ahari, A.; Arzanlou, M. Distribution of mating type alleles in Iranian populations of Pyrenophora graminea, the causal agent of barley leaf stripe disease, using a multiplex PCR approach. Eur. J. Plant Pathol. 2020, 156, 343–354. [Google Scholar] [CrossRef] [Scilit]
- Tekauz, A.; Chiko, A.W. Leaf stripe of barley caused by Pyrenophora graminea: Occurrence in Canada and comparisons with barley stripe mosaic. Can. J. Plant Pathol. 1980, 2, 152–158. [Google Scholar] [CrossRef] [Scilit]
- Porta-Puglia, A.; Delogu, G.; Vannacci, G. Pyrenophora graminea on winter barley seed: Effect on disease incidence and yield losses. J. Phytopathol. 2010, 117, 26–33. [Google Scholar] [CrossRef] [Scilit]
- Yan, J.H.; Yao, Q.; Chen, H.M. Identification of resistance of major barley cultivars (lines) to leaf stripe and leaf scald in Qinghai Province. Plant Prot. 2016, 42, 212–214. [Google Scholar]
- Hou, J.J. Functional Analysis of Pathogenic Candidate gene Pgmiox in Pyrenophora graminea. Master Thesis, Gansu Agricultural University, Lanzhou, China, 2020. [Google Scholar]
- Yang, R. Study of Pathogen and Chemical Control of Barley Leaf Stripe. Master Thesis, Gansu Agricultural University, Lanzhou, China, 2010. [Google Scholar]
- Zheng, G. Study of Pathogenic and Chemical Control of Barley Leaf Stripe. Doctoral Dissertation, Gansu Agricultural University, Lanzhou, China, 2011. [Google Scholar]
- Platenkamp, R. Investigation on the infection pathway of Drechslera graminea in germinating barley. K. Vet. -Og Landbohoeiskoles Aarsskrift 1976, 19761332098. [Google Scholar]
- Mathre, D.E. Compendium of Barley Diseases; The American Phytopathology Society: Saint Paul, MN, USA, 1982. [Google Scholar]
- Johnston, R.H.; Metz, S.G.; Riesselman, J.H. Seed treatment for control of Pyrenophora leaf stripe of barley. Plant Dis. 1982, 66, 1122–1124. [Google Scholar] [CrossRef] [Scilit]
- Du, W.F.; Zuo, L.L.; He, M.; Li, Y.Q. Control efficiency of fungicides by seed dressing on barley stripe disease. Plant Prot. 2013, 39, 190–192. [Google Scholar]
- Yang, L.; Zhang, L.; Cao, J.; Wang, L.; Shi, H.; Zhu, F.; Ji, Z. Rapid Detection of Peach Shoot Blight Caused by Phomopsis amygdali Utilizing a New Target Gene Identified from Genome Sequences Within Loop-Mediated Isothermal Amplification. Plant Dis. 2022, 106, 669–675. [Google Scholar] [CrossRef] [Scilit]
- Liu, B.; Li, Z.; Du, J.; Zhang, W.; Che, X.; Zhang, Z.; Chen, P.; Wang, Y.; Li, Y.; Wang, S.; et al. Loop-Mediated Isothermal Amplification (LAMP) for the Rapid and Sensitive Detection of Alternaria alternata (Fr.) Keissl in Apple Alternaria Blotch Disease with Aapg-1 Encoding the Endopolygalacturonase. Pathogens 2022, 11, 1221. [Google Scholar] [CrossRef] [Scilit]
- Shu, R.; Yin, X.; Long, Y.; Yuan, J.; Zhou, H. Detection and Control of Pantoea agglomerans Causing Plum Bacterial Shot-Hole Disease by Loop-Mediated Isothermal Amplification Technique. Front. Microbiol. 2022, 13, 896567. [Google Scholar] [CrossRef] [Scilit]
- Sun, H.T.; Sun, L.; Yang, L.; Wang, Z.; Xia, Z.; Yang, X.; Jiao, Z.; Feng, J.; Liang, Y. Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Phoma macdonaldii, the Causal Agent of Sunflower Black Stem. Plant Dis. 2022, 106, 260–265. [Google Scholar] [CrossRef] [Scilit]
- Ficsor, A.; Bakonyi, J.; Csosz, M.; Tomcsanyi, A.; Varga, J.; Toth, B. Occurrence of barley pathogenic Pyrenophora species and their mating types in Hungary. Cereal Res. Commun. 2014, 42, 612–619. [Google Scholar] [CrossRef] [Scilit]
- Lu, C.; Dai, T.; Zhang, H.; Zeng, D.; Wang, Y.; Yang, W.; Zheng, X. A novel LAMP assay using hot water in vacuum insulated bottle for rapid detection of the soybean red crown rot pathogen Calonectria ilicicola. Australas. Plant Pathol. 2022, 51, 251–259. [Google Scholar] [CrossRef] [Scilit]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef] [Scilit]
- Gomez-Gutierrez, S.V.; Goodwin, S.B. Loop-Mediated Isothermal Amplification for Detection of Plant Pathogens in Wheat (Triticum aestivum). Front. Plant Sci. 2022, 13, 857673. [Google Scholar] [CrossRef] [Scilit]
- Fan, F.; Yin, W.X.; Li, G.Q.; Lin, Y.; Guo, C.X. Development of a LAMP method for detecting SDHI fungicide resistance in Botrytis cinerea. Plant Dis. 2018, 102, 1612–1618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deng, S.; Ma, X.; Chen, Y.; Feng, H.; Zhou, D.; Wang, X.; Zhang, Y.; Zhao, M.; Zhang, J.; Daly, P.; et al. LAMP Assay for Distinguishing Fusarium oxysporum and Fusarium commune in Lotus (Nelumbo nucifera) Rhizomes. Plant Dis. 2022, 106, 231–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lakshmi, K.R.S.; Kamalakannan, A.; Gopalakrishnan, C.; Rajesh, S.; Panneerselvam, S.; Ganapati, P.S. Loop-mediated isothermal amplification assay: A specific and sensitive tool for the detection of Bipolaris oryzae causing brown spot disease in rice. Phytoparasitica 2022, 50, 543–553. [Google Scholar] [CrossRef] [Scilit]
- Ortega, S.F.; Tomlinson, J.; Hodgetts, J.; Spadaro, D.; Gullino, M.L.; Boonham, N. Development of loop-mediated isothermal amplification assays for the detection of seed-borne fungal pathogens F. fujikuroi and P. oryzae in rice seed. Plant Dis. 2018, 102, 1549–1558. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Gleason, C. Loop-mediated isothermal amplification for the diagnostic detection of Meloidogyne chitwoodi and M. fallax. Plant Dis. 2019, 103, 12–18. [Google Scholar] [CrossRef] [Scilit]
- Pieczul, K.; Perek, A.; Kubiak, K. Detection of Tilletia caries, Tilletia laevis and Tilletia controversa wheat grain contamination using loop-mediated isothermal DNA amplification (LAMP). J. Microbiol. Methods 2018, 154, 141–146. [Google Scholar] [CrossRef] [Scilit]
- Sedaghatjoo, S.; Forster, M.K.; Niessen, L.; Karlovsky, P.; Killermann, B.; Maier, W. Development of a loop-mediated isothermal amplification assay for the detection of Tilletia controversa based on genome comparison. Sci. Rep. 2021, 11, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Jorgensen, J. Comparative testing of barley seed for inoculum of Pyrenophora graminea and Pyrenophora teres in greenhouse and field. Seed Sci. Technol. 1980, 8, 377–381. [Google Scholar]
- Douillet, A.; Laurent, B.; Beslay, J.; Massot, M.; Raynal, M.; Delmotte, F. LAMP for in-field quantitative assessments of airborne grapevine downy mildew inoculum. J. Appl. Microbiol. 2022, 133, 3404–3412. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Wang, C.; Ma, Y.; Zhang, X.; Yang, H.; Li, G.; Li, X.; Wang, M.; Zhao, X.; Wang, J.; et al. Rapid and specific detection of Fusarium acuminatum and Fusarium solani associated with root rot on Astragalus membranaceus using loop-mediated isothermal amplification (LAMP). Eur. J. Plant Pathol. 2022, 163, 305–320. [Google Scholar] [CrossRef] [Scilit]












| Primer Name. | R5′ to 3′oligonucleotide Sequence | Length (bp) |
|---|---|---|
| Pig 14-F3 | CAGAATAAGGGCCGTCTTGG | 21 |
| Pig 14-B3 | AGGACCACACATTCAACCAA | 21 |
| Pig 14-F2 | CTTCGACATTTTGCGATCCG | 20 |
| Pig 14-B2 | AGTCGATCGTCTCATCCCGAT | 21 |
| Pig 14-FIP(F1c-F2) | GCCAGAACTGAACCAGGCAGTA_CTTCGACATTTTGCGATCCG | 43 |
| Pig 14-BIP(B1c-B2) | CCGCACGACACCTGGGAAAT_AGTCGATCGTCTCATCCGAT | 41 |
| Pig 14-LB | CGAGTCTCCCTGCGGGACAA | 20 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, Z.; Chen, L.; Du, C.; Liu, Y.; Yan, J.; Guo, Q.; Yao, Q. Development of Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Pyrenophora graminea in Barley Seeds. Agronomy 2023, 13, 62. https://doi.org/10.3390/agronomy13010062
Hu Z, Chen L, Du C, Liu Y, Yan J, Guo Q, Yao Q. Development of Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Pyrenophora graminea in Barley Seeds. Agronomy. 2023; 13(1):62. https://doi.org/10.3390/agronomy13010062
Chicago/Turabian StyleHu, Zhangwei, Liyifan Chen, Chunmei Du, Yaoxia Liu, Jiahui Yan, Qingyun Guo, and Qiang Yao. 2023. "Development of Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Pyrenophora graminea in Barley Seeds" Agronomy 13, no. 1: 62. https://doi.org/10.3390/agronomy13010062
APA StyleHu, Z., Chen, L., Du, C., Liu, Y., Yan, J., Guo, Q., & Yao, Q. (2023). Development of Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Pyrenophora graminea in Barley Seeds. Agronomy, 13(1), 62. https://doi.org/10.3390/agronomy13010062

