Next Article in Journal
Historical Changes in Agricultural Systems and the Current Greenhouse Gas Emissions in Southern Chile
Next Article in Special Issue
Genetic Diversity of Colletotrichum spp. Causing Grape Anthracnose in Zhejiang, China
Previous Article in Journal
Determining Optimal Levels of Pruning in Hylocereus undatus [(Haw.) Britton and Rose] in Trellis Systems
Previous Article in Special Issue
Identification, Pathogenicity, and Sensitivity to Fungicide of Colletotrichum Species That Causes Walnut Anthracnose in Beijing
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Involvement of CYP51A and CYP51B in Growth, Reproduction, Pathogenicity, and Sensitivity to Fungicides in Colletotrichum siamense

1
College of Advanced Agricultural Sciences, Zhejiang A&F University, Lin’an, Hangzhou 311300, China
2
Research Institute for the Agriculture Science of Hangzhou, Hangzhou 310013, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2023, 13(1), 239; https://doi.org/10.3390/agronomy13010239
Submission received: 8 December 2022 / Revised: 4 January 2023 / Accepted: 11 January 2023 / Published: 13 January 2023
(This article belongs to the Special Issue Plant Anthracnose: Etiology and Current Management Options)

Abstract

Strawberry crown rot is a serious fungal disease that poses a great threat to strawberry production in the growth cycle. The dominant pathogens of strawberry crown rot pathogens were different in different periods. The main pathogen of strawberry crown rot at the seedling stage is unclear. In this study, 74 Colletotrichum spp. were isolated from 100 strawberry plants at the seedling stage. Based on the morphological observations and phylogenetic analysis of multiple genes (ACT, CAL, CHS, GAPDH, and ITS), all 74 tested isolates were identified as C. gloeosporioides species complex, including 69 isolates of C. siamense and 5 isolates of C. fructicola. Colletotrichum siamense is the main pathogen of strawberry crown rot at the seedling stage in Zhejiang, China. The sterol demethylation inhibitors (DMIs) were used to control strawberry crown rot, and their target was the CYP51 gene. The role of the homologous CYP51 gene in growth, reproduction, pathogenicity, and sensitivity to DMI fungicides in C. siamense has not been determined. Our study found that the pathogenicity of CsCYP51A deletion mutants to strawberry leaves and stems was weakened. The hyphae growth rate of CsCYP51B deletion mutants was significantly slower than that of the wild type, but the sporulation and appressorium production rates increased. CsCYP51B deletion mutants had significantly increased pathogenicity to the stem. Deletion of CsCYP51A led to increased sensitivity to prothioconazole, ipconazole, hexaconazole, triadimefon, prochloraz, tebuconazole, metconazole, propiconazole, and difenoconazole. CsCYP51B deletion mutants were more insensitive. Our results indicate that the effect of the homologous CsCYP51 gene on hyphae growth, pathogenicity, and sensitivity to DMI fungicides differs.

1. Introduction

Strawberry (Fragaria × ananassa Duch.) is a small berry and has the largest planted and cultivated area in the world [1]. In recent years, strawberry crown rot has become a destructive disease in strawberry production. When the vascular bundle is infected, it becomes brown; strawberries eventually wilt due to the inability to absorb water and nutrients, causing considerable economic damage [2]. The main pathogens of strawberry crown rot reported worldwide are the Colletotrichum gloeosporioides complex species and C. acutatum complex species [3,4,5]. In China, C. gloeosporioides complex species is the main pathogens of strawberry crown rot [6]. However, the dominant pathogen of strawberry crown rot pathogens were different in different periods [7]. C. siamense is the main pathogen of strawberry crown rot in transplanting period. C. siamense belong to C. gloeosporioides complex species and is important hemibiotrophic fungus pathogen that affects a wide range of crops, including fruit and vegetables, and can infect the leaves, stems, fruit, and other parts of host plants [8]. The main pathogen of strawberry crown rot in the Zhejiang Province at the seedling stage is unclear.
The sterol demethylation inhibitors (DMIs) are widely used to control strawberry crown rot in production. DMI fungicides disturb fungal growth by inhibiting cytochrome 14-alpha-demethylases (CYP51) [9]. At present, the mechanism of resistance of pathogenic fungi to DMI fungicides has been reported mainly in three ways: (i) CYP51 gene point mutation reduces the affinity between the fungicide and the target protein [10,11], (ii) overexpression of the CYP51 gene [12,13], and (iii) increased efflux pump activity [14]. With the extensive use of DMIs, Colletotrichum spp. have become less sensitive to DMI fungicides and have developed resistance over the past few decades [15,16]. However, the mechanism by which Colletotrichum spp. are resistant to DMI fungicides is unclear.
Most ascomycetes only carry two copies of CYP51 gene: CYP51A and CYP51B [17]. Thus far, CYP51C has only been reported in Fusarium spp. [18]. The effects of the homologous CYP51 gene on hyphae growth, reproduction, pathogenicity, and sensitivity to DMI fungicides have been previously reported. The CYP51 deletion mutants of Fusarium spp. had no effect on hyphae growth and sensitivity to DMI fungicides [19,20]. Similarly, the role of the homologous CYP51 gene may differ among Colletotrichum spp. [21]. In C.gloeosporioides, CYP51A deletion mutants led to attenuated growth on PDA medium, whereas CYP51B deletion caused enhanced growth. The deletion mutants of CYP51A and CYP51B failed to produce spores and showed decreased virulence. CYP51A deletion mutants became more sensitive to DMI fungicides, but not CYP51B deletion mutants [22]. CYP51A deletion mutants of C. nymphaeae have increased sensitivity to propiconazole, diniconazole, prothioconazole, cyproconazole, epoxiconazole, flutriafol, and prochloraz. However, CYP51A deletion mutants of C. fioriniae did not change their sensitivity to prochloraz. Hyphae growth and virulence of CYP51 deletion mutants were not changed in C. nymphaeae or C. fioriniae [23].
The function of two homologous CYP51 genes in C. siamense remains unclear. The objective of this study was to investigate the effects of CYP51A and CYP51B genes on hyphae growth, reproduction, pathogenicity, and sensitivity to DMI fungicides in C. siamense. The findings of this study will improve our understanding of the biology of CYP51 genes in fungi.

2. Materials and Methods

2.1. Isolation of Colletotrichum spp.

Crown rot samples were collected from plants with a brown vascular bundle and wilting from 10 greenhouses in Jiande, Zhejiang Province (27°02′ to 31°11′ N, 118°01′ to 119°28′ E) from July to September 2021. The diseased tissues from the infected plants were washed with tap water, cut into 5 × 5 mm pieces using sterilized scissors, soaked in 75% alcohol for 30 s, soaked in 3% sodium hypochlorite solution for 1 min, washed with sterile distilled water three times, and dried on sterile filter paper. Each tissue piece was placed on a plate containing potato dextrose agar (PDA) medium supplemented with kanamycin sulfate and streptomycin sulfate (100 mg/L) and incubated at 28 °C. After 3–5 days of incubation, the mycelia were transferred to a new PDA plate [24,25]. The single-conidium isolates were stored on PDA slants at 4 °C.

2.2. Morphological Characterization

Morphological and cultural characterizations were performed according to previously described methods [26]. Mycelia plugs (5 mm in diameter) were taken from the edges of 5-day-old colonies of tested isolates and transferred to new PDA plates. The mycelium diameter was measured and the growth rate was calculated after incubation at 28 °C for 7 days. The colony morphology and color of aerial mycelia were recorded [26,27]. Each isolate was repeated 3 times. Moreover, the shape and color of the conidia and appressoria were observed using a light microscope, and 50 conidia and appressoria were randomly selected and measured to determine their size by ZEN V.6.0 software (Zeiss, Jena, Germany).

2.3. Molecular Identification and Phylogenetic Analysis

The total DNA of each tested isolate was extracted using a fungi genomic DNA rapid extraction kit (B518229-0100; Sangon Biotech, Shanghai, China). The actin (ACT), calmodulin (CAL), chitin synthase (CHS), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and internal transcribed spacer (ITS) genes were amplified using the primer pairs ACT-512F/ACT-783R [28], CL1C/CL2C [29], CHS-79F/CHS-354R [30], GDF/GDR [31], and ITS-1F/ITS4 [32]. Molecular identification was performed according to the method described previously [33]. The referenced standard isolates used in this study are listed in Supplementary Table S1. Colletotrichum boninense (CBS: 123755) was used as the outgroup [33]. All sequences were compared and corrected in MEGA 5.0 [34]. The modified sequences were concatenated in Sequence Martix 1.8. Modeltest3.7.win, Win paup4b10-console, and Mrmodeltest2, as implemented in MrMTgui, were used to estimate the best model of nucleotide substitution [35]. Bayesian inference (BI) phylogenies were constructed using Mr. Bayes v. 3.1.2 [36]. Six simultaneous Markov chains were run for 300,000 generations each. Phylogenetic trees were drawn using treeView [37]. The alignments and trees were deposited in treeBase.

2.4. Construction of CsCYP51A and CsCYP51B Deletion Mutants

The double-joint (DJ) PCR approach [38] was used to generate the gene replacement construct for each target gene. Briefly, two primer pairs (CYP51a-UP-F/CYP51a-UP-R and CYP51a-DOWN-F/CYP51a-DOWN-R) (Table 1) were used to amplify the upstream and downstream sequences of CsCYP51A from the genome of the wild-type JD-A-12 strain. The primers HPH-F/HPH-R were used to amplify a 1349-bp fragment encoding the HPH cassette containing the hygromycin-resistant gene and the trpC promoter. The three amplicons (upstream, HPH cassette, and downstream) were fused by a second round of DJ PCR. Based on the fused fragment, the final PCR products with an overlapping part of 3188 and 3090 bp were amplified by the nested primer pair CYP51a-Nest-F/CYP51a-Nest-R (Table 1). The CsCYP51B deletion mutants were constructed using the same protocols.

2.5. Transformation of C. siamense

Protoplast transformation of C. siamense was carried out using a previously described protocol [38,39]. The mycelia on the edge of the colony was crushed and placed in 30 mL YEPD medium and shaken at 180 rpm for 36 h at 28 °C. To prepare protoplasts, mycelia were collected by filtration and washed with 0.7 M NaCl buffer. The cell wall lysate contained 0.3 g cellulase, 0.3 g lysozyme, and 0.1 g collapse enzyme in 10 mL of 0.7 M NaCl buffer as the enzyme mixture, which was filtered through a 0.22-µm MILLEX GP sterile filter membrane.
A flask with 10 mL of filter-sterilized enzyme mixture and 1 g of mycelia was incubated at 100 rpm for 3 h at 28 °C. The resulting protoplasts were filtered through three layers of lens cleaning tissue and collected by centrifugation at 5000 rpm for 5 min. They were then washed twice in 1 mL of sorbitol-Tris-calcium (STC) buffer. The protoplasts were precipitated with 750 μL STC solution, and the final PCR product, heparin sodium and SPTC were added in turn, mixed and left on ice for 30 min. SPTC was added, left to stand for 20 min and transferred to 20 mL RM medium at 28 °C and 100 rpm for 12 h. RM medium was added to 200 µg/mL hygromycin modified with PDA overnight. After 2–4 days of incubation, hygromycin-resistant colonies (transformants) were transferred onto fresh PDA medium amended with 200 µg/mL hygromycin for two generations to confirm resistance. The total DNA of the transformants was extracted using a fungi genomic DNA rapid extraction kit (B518229-0100; Sangon Biotech, Shanghai, China). Putative gene deletion mutants were identified using PCR assays with relevant primers (CYP51a-ID-F/CYP51a-ID-R, CYP51b-ID-F/CYP51b-ID-R) (Table 1).

2.6. Phenotype Analysis

The mycelia plugs (5 mm in diameter) were transferred to the new PDA plates and incubated at 28 °C. After 7 days, the hyphae growth rate, sporulation and appressorium production rate were calculated, and colony morphology was described [26,27]. For each deletion genotype, three mutants were measured. For appressorial formation assays, the conidial suspension was adjusted to a concentration of 1 × 106 conidia/mL, and 10 µL was placed onto a plastic cover slip (Thermo Fisher Scientific, Waltham, MA, USA) and incubated at 28 °C for 16 h. Conidial germination and appressorial formation rates were quantified microscopically.

2.7. Pathogenicity Assays

We tested the pathogenicity of each deletion genotype to the leaves and stems of 8-week-old strawberry. Before inoculation, the leaves and stems were surface sterilized by dipping in 1% sodium hypochlorite for 30 s and then in 70% ethanol. They were then washed three times with distilled water and left to dry on sterile paper. The wounded condition was determined using the pin-pricking method [40]. Depending on the size of the leaves, a sterile sharp needle was used to prick 4–8 wounds on the adaxial surface of each leaf. For the stem, 5 wounds were pricked in the middle of each 8-cm stem. Spores were collected and adjusted to 1.0 × 106 conidia/mL using a hemocytometer. Three mutants were inoculated for each deletion genotype, and three leaves and stems of each mutant were inoculated. Sterile water was used for inoculation as a blank control. The diameter of the lesions on the leaves and stems was measured 3 days after inoculation. One-way ANOVA was performed to analyze the significance difference using IBM SPSS Statistics V22 software, and the least significant difference (LSD) test was applied to separated mean values for different species in the pathogenicity test at p = 0.05 level.

2.8. Determination of Sensitivity to DMI Fungicides

To evaluate the sensitivity of CsCYP51A and CsCYP51B mutants to nine DMI fungicides, namely prothioconazole, ipconazole, hexaconazole, triadimefon, prochloraz, tebuconazole, metconazole, propiconazole, and difenoconazole, we first measured the EC50 of wild-type JD-A-12 to nine DMI fungicides according to the mycelial growth rate method [41]. Each active component was added at concentrations of 0, 0.3125, 0.625, 1.25, and 2.5 μg/mL in the microbicide-modified PDA plates. The EC50 value was used as the concentration to determine the sensitivity of each deletion genotype to nine DMI fungicides. The mycelia plugs (5 mm in diameter) were transferred to the PDA medium treated with different concentrations of fungicides, and the wild type was used as the control. Three mutants were tested for each deletion genotype, and each mutant was repeated on three plates. After being cultured at 28 °C for 7 days, the colony diameter was determined, and the inhibition rate was calculated.

3. Results

3.1. Isolation and Identification of Colletotrichum spp.

A total of 74 Colletotrichum spp. were isolated from 100 strawberry plants. Pathogenicity was determined according to Koch’s postulate, and all isolates were pathogenic. According to morphological and cultural characterization, all 74 isolates were grouped into two Colletotrichum species: C. siamense and C. fructicola. The proportion of C. siamense was 93.24%.
Colletotrichum siamense colonies were medium gray, and the back surface was gray-green in the middle and white at the edges. Colletotrichum fructicola colonies were gray-green in the middle and white at the edges (Figure 1). The two Colletotrichum species had similar conidia and appressorium morphology. The spores and appressoria of C. fructicola were larger than those of C. siamense (Table 2). There were no significant differences in mycelial growth rates. Phylogenetic trees were constructed using combined ACT, GADPH, CHS, CAL and ITS datasets consisting of 74 Colletotrichum isolates with C. boninense (CBC 123755) as the outgroup taxa. The concatenated alignment included 1356 characters. The boundaries of the loci used in the alignment were as follows: ACT: 1–152; CAL: 153–549; CHS: 550–761; GADPH: 762–965; and ITS: 966–1356. The GenBank no. of tested isolates are listed in Supplementary Table S1. All isolates were identified as C. gloeosporioides species complex and fell into two clades, with 69 isolates clustered in C. siamense and 5 isolates clustered in C. fructicola (Figure 2).

3.2. Deletion of CsCYP51 in C. siamense

Three CsCYP51A gene deletion mutants were obtained and identified using PCR analysis with the primer pair CYP51a-ID-F/CYP51a-ID-R. This primer pair amplified 1649-bp fragments from the CsCYP51A mutants (Figure 3B). Three CsCYP51B gene deletion mutants were obtained. The primer pair CYP51b-ID-F/ CYP51b-ID-R amplified 1541 bp from CsCYP51B (Figure 3D).

3.3. Biological Characteristics of CsCYP51 Mutants

The colony morphology of the CsCYP51A deletion mutants was not significantly different from that of wild-type JD-A-12 on PDA plates. The mycelium was gray-white, and the back surface was gray-green in the middle and gray-white at the margin (Figure 4). The hyphae of the CsCYP51B deletion mutant were denser and produced orange-red precipitates on the PDA plate (Figure 4). The growth rates of CsCYP51A and CsCYP51B deletion mutants were significantly lower than that of wild-type JD-A-12, and the growth rates of the two mutants were 10.39 ± 0.10 mm/d and 7.28 ± 0.09 mm/d, respectively. Sporulation and the appressorium production rate of CsCYP51B deletion mutants were significantly higher than those of the wild-type JD-A-12 (Table 3).

3.4. Effect of CYP51 on Pathogenicity

The disease spot diameter was measured 3 days after inoculation. CsCYP51A deletion mutants significantly reduced the pathogenicity to the stem and leaves (Figure 5), and the lesion diameters were 3.4 ± 0.4 mm and 1.9 ± 0.2 mm, respectively. The CsCYP51B deletion mutants significantly increased pathogenicity to the stem, with a diameter of 10.8 ± 0.6 mm. However, there was no significant difference in leaf pathogenicity between the wild type and CsCYP51B deletion mutants (Figure 5).

3.5. Effects of CYP51 Gene Deletion on the Sensitivity of C. siamense to DMIs

The EC50 values of wild-type JD-A-12 for prothioconazole, ipconazole, hexaconazole, triadimefon, prochloraz, tebuconazole, metconazole, propiconazole, and difenoconazole were 2.27, 0.1, 1.07, 19.26, 0.2, 0.85, 0.36, 0.36, and 0.47 μg/mL, respectively. According to the EC50 values, we determined the sensitivity of the CsCYP51A and CsCYP51B deletion mutants to nine DMI fungicides. The mycelium growth on the PDA plate was shown in Figure 6A. CsCYP51A deletion mutants were more sensitive to all tested DMI fungicides. Compared with the wild type JD-A-12, the inhibition rate of nine DMI fungicides to CsCYP51A deletion mutants was significantly increased (Figure 6B), especially for hexaconazole and triadimefon, whose inhibition rates reached 86.60% and 91.06%. The growth rates of CsCYP51B deletion mutants were lower than that of wild type JD-A-12. According to the results of statistical analysis, the inhibition rate of nine DMI fungicides to CsCYP51A deletion mutants was significantly reduced compared with the wild type (Figure 6B). This means that CsCYP51B deletion mutants were less sensitive to the nine DMI fungicides than wild-type JD-A-12.

4. Discussion

Strawberry crown rot caused by Colletotrichum spp. causes serious economic losses [6]. Based on morphological and phylogenetic analyses, 74 isolates of Colletotrichum spp. were isolated from 100 infected strawberry plants at the seedling stage in Jiande, Zhejiang Province. All Colletotrichum spp., namely C. siamense and C. fructicola belonged to the C. gloeosporioides species complex, in which C. siamense was the main species, accounting for 93.24%. It is reported that C. siamense and C. fructicola were the most prevailing pathogens causing strawberry crown rot in the Asia–Pacific region [42]. Our research also confirms this. Of course, other Colletotrichum species also can cause strawberry crown rot [43,44].Our study indicates that C. siamense was the dominant species of strawberry crown rot at different periods in Zhejiang province [7]. There was no significant difference in spore morphology and mycelial growth rate between C. siamense and C. fructicola; the spores and appressoria of C. fructicola were larger than those of C. siamense. This is also consistent with previous research [45].
C. siamense is the main pathogen of strawberry crown rot at the seedling stage in Zhejiang Province. This disease is mainly controlled by fungicides, such as DMI, whose target gene is CYP51. With the extensive use of DMI fungicides, the sensitivity of C. siamense decreased and resistance was developed [19,46]. Therefore, we explored the involvement of CYP51 with growth, reproduction, pathogenicity, and sensitivity to fungicides in C. siamense. In this study, CsCYP51A deletion mutants had no significant effect on hyphae growth and sporulation. The CsCYP51B deletion mutants significantly slowed the mycelial growth rate but did not affect the production of spores and appressoria. Sporulation and appressorium production rates were significantly higher than those of wild-type JD-A-12. This suggests that neither CYP51A nor CYP51B is necessary for fungal growth [47]. CYP51B deletion in C. nymphaeae and C. fioriniae had no effect on hyphae growth, which further indicated that CYP51B was not necessary for the growth of Colletotrichum spp. [48]. The CsCYP51A deletion mutant had reduced pathogenicity to stems and leaves, while the CsCYP51B deletion mutant had increased pathogenicity to stems. In C. gloeosporioides, CYP51A deletion mutant also reduced pathogenicity [22]. CYP51A may play an important role in the infection process [26]. The differential pathogenicity of the CsCYP51B deletion mutant on stems and leaves may be due to host site specialization in strawberry plant infection [42]. The pathogenicity of Colletotrichum spp. is closely related to appressorium production, which may also be associated with an increased rate of appressorium production in CsCYP51B deletion mutants [49]. The CYP51B gene may negatively regulate pathogenicity in C. siamense.
Different DMI fungicides have different binding affinities with the CYP51 protein due to their different chemical structures [50]. In this study, we determined the sensitivity of CsCYP51A and CsCYP51B deletion mutants to nine DMI fungicides. CsCYP51A deletion mutants were more sensitive to the nine DMI fungicides and CsCYP51B deletion mutants was insensitive. In other words, CYP51A in C. siamense may be the main target for these nine DMI fungicides. This phenomenon has also been observed in C. gloeosporioides [22]. CYP51B deletion mutants showed similar sensitivity to nine DMI fungicides. The CYP51A gene was found to be more variable than CYP51B [51]. The conservation of CYP51B may explain why CYP51B deletion mutants are mostly similarly sensitive to all tested fungicides. When two fungicides with different primary targets are used in combination, a synergistic effect can be achieved in disease control [48]. We can also continue to screen DMI fungicides targeting CYP51B. In our study, the expression and function of CYP51 gene in the mycelium growth, sporulation, and pathogenicity of C. siamense need to be further verified. In general, the CYP51 gene in C. siamense differentially affected growth, reproduction, pathogenicity, and sensitivity to DMI fungicides. Our findings provide novel insights into understanding the resistance mechanism to DMIs.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy13010239/s1, Table S1: Colletotrichum spp. used in multi-gene analysis in this study.

Author Contributions

Conceptualization, J.W. and C.Z.; methodology, J.W., H.Y., and C.Z.; software, S.H. and X.Y; validation, H.Y. and C.Z.; formal analysis, J.W., X.Y., and S.H.; investigation, W.X. and S.H.; writing—original draft preparation, J.W. and S.H.; writing—review and editing, H.Y. and C.Z.; visualization, J.W. and S.H.; supervision, H.Y. and C.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Agriculture and Social Development Research Project of Hangzhou (202203A07), the Science Technology Department of Zhejiang Province (LGN20C140002), and Joint-extension Project of important Agriculture Technology in Zhejiang Province (2021XTTGSC02-4), the Postdoctoral Science Foundation of Zhejiang Province, China (ZJ2021121).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Barbey, C.R.; Lee, S.; Verma, S.; Bird, K.A.; Yocca, A.E.; Edger, P.P.; Knapp, S.J.; Whitaker, V.M.; Folta, K.M. Disease resistance genetics and genomics in octoploid strawberry. G3 Genes Genom. Genet. 2019, 9, 3315–3332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Paynter, M.; Gomez, A.; Ko, L.; Herringtonet, M.E. Research into crown rot and wilt diseases of strawberries in Queensland. Acta Hortic. 2016, 1117, 163–170. [Google Scholar] [CrossRef] [Scilit]
  3. Jacobs, R.L.; Adhikari, T.B.; Pattison, J.; Yencho, G.C.; Fernandez, G.E.; Louws, F.J. Assessing rate-reducing foliar resistance to anthracnose crown rot and fruit rot in strawberry. Plant Dis. 2020, 104, 398–407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Howard, C.M.; Maas, J.L.; Chandler, C.K.; Albregts, E.E. Anthracnose of strawberry caused by the Colletotrichum complex in Florida. Plant Dis. 1992, 76, 976–981. [Google Scholar] [CrossRef] [Scilit]
  5. Peres, N.; Timmer, L.; Adaskaveg Je Correll, J. Lifestyles of Colletotrichum acutatum. Plant Dis. 2005, 89, 784–796. [Google Scholar] [CrossRef] [Scilit]
  6. Zhang, Y.T.; Yu, H.; Hu, M.H.; Wu, J.Y.; Zhang, C.Q. Fungal pathogens associated with strawberry crown rot disease in China. J. Fungi 2022, 8, 1161. [Google Scholar] [CrossRef] [Scilit]
  7. Chen, X.Y.; Dai, D.J.; Zhao, S.F.; Shen, Y.; Wang, H.D.; Zhang, C.Q. Genetic diversity of Colletotrichum spp. causing strawberry anthracnose in Zhejiang, China. Plant Dis. 2020, 104, 1351–1357. [Google Scholar] [CrossRef] [Scilit]
  8. Baroncelli, R.; Zapparata, A.; Sarrocco, S.; Sukno, S.A.; Lane, C.R.; Thon, M.R.; Vannacci, G.; Holub, E.; Sreenivasaprasad, S. Molecular diversity of anthracnose pathogen populations associated with UK strawberry production suggests multiple introductions of three different Colletotrichum species. PLoS ONE 2015, 10, e0129140. [Google Scholar] [CrossRef] [Scilit]
  9. Fernández-Ortuño, D.; Loza-Reyes, E.; Atkins, S.L.; Fraaije, B.A. The CYP51C gene, a reliable marker to resolve interspecific phylogenetic relationships within the Fusarium species complex and a novel target for species-specific PCR. Int. J. Food Microbiol. 2010, 144, 301–309. [Google Scholar] [CrossRef] [Scilit]
  10. D’elye, C.; Bousset, L.; Corio-Costet, M.F. PCR cloning and detection of point mutations in the eburicol 14a-demethylase (CYP51) gene from Erysiphe graminis f. sp. hordei, a “recalcitrant” fungus. Curr. Genet. 1998, 34, 399–403. [Google Scholar]
  11. Dudakova, A.; Spiess, B.; Tangwattanachuleeporn, M.; Sasse, C.; Buchheidt, D.; Weig, M.; Groß, U.; Bader, O. Molecular tools for the detection and deduction of azole antifungal drug resistance phenotypes in Aspergillus species. Clin. Microbiol. Rev. 2017, 30, 1065–1091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Ma, Z.; Proffer, T.J.; Jacobs, J.L.; Sundin, G.W. Overexpression of the 14a-demethylase target gene (CYP51) mediates fungicide resistance in Blumeriella jaapii. Appl. Environ. Microbiol. 2006, 72, 2581–2585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Hamamoto, H.; Hasegawa, K.; Nakaune, R.; Lee, Y.J.; Makizumi, Y.; Akutsu, K.; Hibi, T. Tandem repeat of a transcriptional enhancer upstream of the sterol 14a-demethylase gene (CYP51) in Penicillium digitatum. Appl. Environ. Microbiol. 2000, 66, 3421–3426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Kretschmer, M.; Leroch, M.; Mosbach, A.; Walker, A.S.; Fillinger, S.; Mernke, D.; Schoonbeek, H.J.; Pradier, J.M.; Leroux, P.; De Waard, M.A. Fungicide-driven evolution and molecular basis of multidrug resistance in field populations of the grey mould fungus Botrytis cinerea. PLoS Pathog. 2009, 5, e1000696. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Wei, L.L.; Chen, W.C.; Zhao, W.C.; Wang, J.; Wang, B.R.; Li, F.J.; Wei, M.D.; Guo, J.; Chen, C.J.; Zhang, J.Q.; et al. Mutations and overexpression of CYP51 associated with DMI-resistance in Colletotrichum gloeosporioides from chili. Plant Dis. 2020, 104, 668–676. [Google Scholar] [CrossRef] [Scilit]
  16. Chen, F.; Liu, X.; Chen, S.; Schnabel, E.; Schnabel, G. Characterization of Monilinia fructicola strains resistant to both propiconazole and boscalid. Plant Dis. 2013, 97, 645–651. [Google Scholar] [CrossRef] [Scilit]
  17. Mellado, E.; Diaz-Guerra, T.M.; Cuenca-Estrella, M.; Rodriguez-Tudela, J.L. Identification of two different 14-α sterol demethylase-related genes (cyp51A and cyp51B) in Aspergillus fumigatus and other Aspergillus species. J. Clin. Microbiol. 2001, 39, 2431–2438. [Google Scholar] [CrossRef] [Scilit]
  18. Lu, C.; Zhang, H.; Wang, Y.; Zheng, X. Rapid diagnosis of Fusarium root rot in soybean caused by Fusarium equiseti or Fusarium graminearum using loop-mediated isothermal amplification (LAMP) assays. Australas. Plant Path. 2015, 44, 437–443. [Google Scholar] [CrossRef] [Scilit]
  19. Liu, X.; Yu, F.; Schnabel, G.; Wu, J.; Wang, Z.; Ma, Z. Paralogous cyp51 genes in Fusarium graminearum mediate differential sensitivity to sterol demethylation inhibitors. Fungal Genet. Biol. 2011, 48, 113–123. [Google Scholar] [CrossRef] [Scilit]
  20. Zheng, B.; Yan, L.; Liang, W.; Yang, Q. 2019. Paralogous Cyp51s mediate the differential sensitivity of Fusarium oxysporum to sterol demethylation inhibitors. Pest Manag. Sci. 2019, 75, 396–404. [Google Scholar] [CrossRef] [Scilit]
  21. Zhang, C.; Diao, Y.; Wang, W.; Hao, J.; Imran, M.; Duan, H.; Liu, X. Assessing the risk for resistance and elucidating the genetics of Colletotrichum truncatum that is only sensitive to some DMI fungicides. Front. Microbiol. 2017, 8, 1779. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Wang, J.; Shi, D.; Wei, L.; Chen, W.; Ma, W.; Chen, C.; Wang, K. Mutations at sterol 14α-demethylases (CYP51A &B) confer the DMI resistance in Colletotrichum gloeosporioides from grape. Pest Manag. Sci. 2020, 76, 4093–4103. [Google Scholar] [PubMed]
  23. Chen, S.; Wang, Y.; Schnabel, G.; Peng, C.A.; Lagishetty, S.; Smith, K.; Luo, C.; Yuan, H. Inherent Resistance to 14a-Demethylation Inhibitor Fungicides in Colletotrichum truncatum Is Likely Linked to CYP51A and/or CYP51B Gene Variants. Phytopathology 2018, 108, 1263–1275. [Google Scholar] [CrossRef] [Scilit]
  24. Phoulivong, S.; Cai, L.; Chen, H.; Mckenzie, E.H.C.; Abdelsalam, K.; Chukeatirote, E. Colletotrichum gloeosporioides is not a common pathogen on tropical fruits. Fungal Divers. 2020, 44, 33–43. [Google Scholar] [CrossRef] [Scilit]
  25. Noman, E.; Al-Gheethi, A.A.; Rahman, N.K.; Talip, B.; Mohamed, R.; Kadir, O.A. Single spore isolation as a simple and efficient technique to obtain fungal pure culture. Earth Environ. Sci. 2018, 140, 10255. [Google Scholar] [CrossRef] [Scilit]
  26. Cai, L.; Hyde, K.D.; Taylor, P.; Weir, B.S.; Waller, J.M.; Abang, M.M.; Zhang, J.Z.; Yang, Y.L.; Phoulivong, S.; Liu, Z.Y.; et al. A polyphasic approach for studying Colletotrichum. Fungal Divers. 2009, 39, 183–204. [Google Scholar]
  27. Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef] [Scilit]
  28. Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef] [Scilit]
  29. O’Donnell, K.; Nirenberg, H.I.; Aoki, T.; Cigelnik, E. A multigene phylogeny of the Gibberella fujikuroi species complex: Detection of additional phylogenetically distinct species. Mycoscience 2000, 41, 61–78. [Google Scholar] [CrossRef] [Scilit]
  30. Damm, U.; Woudenberg, J.H.C.; Cannon, P.F.; Crous, P.W. Colletotrichum species with curved conidia from herbaceous hosts. Fungal Divers 2009, 39, 45. [Google Scholar]
  31. Templeton, M.D.; Rikkerink, E.H.; Solon, S.L.; Crowhurst, R.N. Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata. Gene 1992, 122, 225–230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes-application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Crous, P.W. The Colletotrichum acutatum species complex. Stud. Mycol. 2012, 73, 37–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA 5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [Scilit]
  35. Vaidya, G.; Lohman, D.J.; Meier, R. Sequence matrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 2011, 27, 171–180. [Google Scholar] [CrossRef] [Scilit]
  36. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Page, R.D. Tree view: An application to display phylogenetic trees on personal computers. Bioinformatics 1996, 12, 357–358. [Google Scholar] [CrossRef] [Scilit]
  38. Chen, S.; Yuan, N.; Schnabel, G.; Luo, C. Function of the genetic element ‘Mona’associated with fungicide resistance in Monilinia fructicola. Mol. Plant Pathol. 2017, 18, 90–97. [Google Scholar] [CrossRef] [Scilit]
  39. Lee, M.H.; Bostock, R.M. Agrobacterium T-DNA-mediated integration and gene replacement in the brown rot pathogen Monilinia fructicola. Curr. Genet. 2006, 49, 309–322. [Google Scholar] [CrossRef] [Scilit]
  40. Karimi, K.; Arzanlou, M.; Pertot, I. Weeds as potential inoculum reservoir for Colletotrichum nymphaeae causing strawberry anthracnose in Iran and Rep-PCR fingerprinting as useful marker to differentiate C. acutatum complex on strawberry. Front. Microbiol. 2019, 10, 129. [Google Scholar] [CrossRef] [Scilit]
  41. Zhang, Y.; Mao, C.X.; Zhai, X.Y.; Jamieson, P.A.; Zhang, C.Q. Mutation in cyp51b and overexpression of cyp51a and cyp51b confer multiple resistant to DMIs fungicide prochloraz in Fusarium fujikuroi. Pest. Manag. Sci. 2021, 77, 824–833. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Talhinhas, P.; Baroncelli, R. Colletotrichum species and complexes: Geographic distribution, host range and conservation status. Fungal Divers. 2021, 110, 109–198. [Google Scholar]
  43. Oliveira, M.S.; Wang, N.Y.; Peres, N.A. Multilocus phylogenetic analyses of Colletotrichum gloeosporioides species complex causing crown rot on strawberry in Florida. Phytopathology 2022, 112, 898–906. [Google Scholar] [CrossRef] [Scilit]
  44. Nam, M.H.; Park, M.S.; Lee, H.D.; Yu, S.H. Taxonomic re-evaluation of Colletotrichum gloeosporioides isolated from strawberry in Korea. Plant Pathol. J. 2013, 29, 317–322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Hu, S.D.; Zhang, Y.T.; Yu, H.; Zhou, J.Y.; Hu, M.H.; Liu, A.C.; Zhang, C.Q. Colletotrichum spp. diversity between leaf anthracnose and crown rot from the same strawberry plant. Front. Microbiol. 2022, 14, 860694. [Google Scholar] [CrossRef] [Scilit]
  46. Zhang, L.; Song, L.; Xu, X.; Zou, X.; Duan, K.; Gao, Q. Characterization and fungicide sensitivity of Colletotrichum species causing strawberry anthracnose in eastern China. Plant Dis. 2020, 104, 1960–1968. [Google Scholar] [CrossRef] [Scilit]
  47. Hu, W.; Sillaots, S.; Lemieux, S.; Davison, J.; Kauffman, S.; Breton, A. Essential gene identification and drug target prioritization in Aspergillus fumigatus. PLoS Pathog. 2007, 3, e24. [Google Scholar] [CrossRef] [Scilit]
  48. Chen, S.; Hu, M.; Schnabel, G.; Yang, D.; Yan, X.; Yuan, H. Paralogous CYP51 genes of Colletotrichum spp. mediate differential sensitivity to sterol demethylation inhibitors. Phytopathology 2020, 110, 615–625. [Google Scholar] [CrossRef] [Scilit]
  49. Fang, Y.L.; Xia, L.M.; Wang, P.; Zhu, L.H.; Ye, J.R.; Huang, L. The MAPKKK CgMck1 is required for cell wall integrity, appressorium development, and pathogenicity in Colletotrichum gloeosporioides. Genes 2018, 9, 543. [Google Scholar] [CrossRef] [Scilit]
  50. Ishii, H.; Bryson, P.K.; Kayamori, M.; Miyamoto, T.; Yamaoka, Y.; Schnabel, G. Cross-resistance to the new fungicide mefentri fluconazole in DMI-resistant fungal pathogens. Pestic. Biochem. Phys. 2021, 171, 104737. [Google Scholar] [CrossRef] [Scilit]
  51. Ohno, S. The enormous diversity in genome sizes of fish as a reflection of nature’s extensive experiments with gene duplication. Trans. Am. Fish. Soc. 1970, 99, 120–130. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Colony morphology of Colletotrichum siamense and C. fructicola from the top of the PDA plate (a1–b1), from the underside of the PDA plate (a2–b2), conidia (a3–b3), and appressoria (a4–b4), scale bar: (a3–b3, a4–b4) = 20 µm.
Figure 1. Colony morphology of Colletotrichum siamense and C. fructicola from the top of the PDA plate (a1–b1), from the underside of the PDA plate (a2–b2), conidia (a3–b3), and appressoria (a4–b4), scale bar: (a3–b3, a4–b4) = 20 µm.
Agronomy 13 00239 g001
Figure 2. Bayesian inference phylogenetic tree of Colletotrichum gloeosporioides species complex isolated from strawberry. The tree was constructed based on ACT, CAL, CHS, GAPDH and ITS genes. Colletotrichum boninense was used as an outgroup. The scale bar shows 0.07 expected changes per site.
Figure 2. Bayesian inference phylogenetic tree of Colletotrichum gloeosporioides species complex isolated from strawberry. The tree was constructed based on ACT, CAL, CHS, GAPDH and ITS genes. Colletotrichum boninense was used as an outgroup. The scale bar shows 0.07 expected changes per site.
Agronomy 13 00239 g002
Figure 3. Generation and identification of CsCYP51A and CsCYP51B deletion mutants by gene replacement. (A) Schematic representation of the CsCYP51A replacement strategy. (B) PCR verification of the CsCYP51A deletion mutation. (C) Schematic representation of the CsCYP51B replacement strategy. (D) PCR verification of the CsCYP51B deletion mutation.
Figure 3. Generation and identification of CsCYP51A and CsCYP51B deletion mutants by gene replacement. (A) Schematic representation of the CsCYP51A replacement strategy. (B) PCR verification of the CsCYP51A deletion mutation. (C) Schematic representation of the CsCYP51B replacement strategy. (D) PCR verification of the CsCYP51B deletion mutation.
Agronomy 13 00239 g003
Figure 4. Colony morphology of wild-type JD-A-12 and CsCYP51A and CsCYP51B deletion mutants from the top of the PDA plate (a1–c1, from the underside of the PDA plate (a2–c2), conidia (a3–c3) and appressoria (a4–c4), scale bar: (a3–c3, a4–b4) = 20 µm.
Figure 4. Colony morphology of wild-type JD-A-12 and CsCYP51A and CsCYP51B deletion mutants from the top of the PDA plate (a1–c1, from the underside of the PDA plate (a2–c2), conidia (a3–c3) and appressoria (a4–c4), scale bar: (a3–c3, a4–b4) = 20 µm.
Agronomy 13 00239 g004
Figure 5. Pathogenicity of CsCYP51A and CsCYP51B mutants to strawberry leaves and stems. (A) JD-A-12, CsCYP51A, and CsCYP51B caused disease spots on the stem and leaf. (B) Pathogenicity difference analysis of JD-A-12, CsCYP51A, and CsCYP51B. Values with the same letters were not statistically different (p > 0.05) according to the least significant difference (LSD) Test.
Figure 5. Pathogenicity of CsCYP51A and CsCYP51B mutants to strawberry leaves and stems. (A) JD-A-12, CsCYP51A, and CsCYP51B caused disease spots on the stem and leaf. (B) Pathogenicity difference analysis of JD-A-12, CsCYP51A, and CsCYP51B. Values with the same letters were not statistically different (p > 0.05) according to the least significant difference (LSD) Test.
Agronomy 13 00239 g005
Figure 6. Using the EC50 value as concentration to determine sensitivities of wide type JD-A-12, CsCYP51A and CsCYP51B deletion mutants to nine DMI fungicides. (A) The mycelium growth on a PDA plate. (B) Inhibition rate of nine DMI fungicides to CsCYP51A and CsCYP51B deletion mutants. Values with the same letters were not statistically different (p > 0.05) according to the least significant difference (LSD) Test.
Figure 6. Using the EC50 value as concentration to determine sensitivities of wide type JD-A-12, CsCYP51A and CsCYP51B deletion mutants to nine DMI fungicides. (A) The mycelium growth on a PDA plate. (B) Inhibition rate of nine DMI fungicides to CsCYP51A and CsCYP51B deletion mutants. Values with the same letters were not statistically different (p > 0.05) according to the least significant difference (LSD) Test.
Agronomy 13 00239 g006
Table 1. Primers used in this study.
Table 1. Primers used in this study.
PrimersDirectionLength (bp)Sequence (5′→3′)
CYP51a-UP-FForward987GGAGTCCTCGAATCTGAGTTC
CYP51a-UP-RReverse AAAATAGGCATTGATGTGTTGACTCCCTCGG
AAGTTCTATGCCTTC
CYP51a-DOWN-FForward1017CTCGTCCGAGGGCAAAGGAATAGAGTAGCTGATGGCGACATGAACCGTG
CYP51a-DOWN-RReverse CATGCTGGCAACGGAAGTG
CYP51a-ID-FForward1649GGAAGCCATTATATGAGAAG
CYP51a-ID-RReverse CATGCTGGCAACGGAAGTG
CYP51a-Nest-FForward3188GGTGTCCATCTAAGGAATTGG
CYP51a-Nest-RReverse CATGCTGGCAACGGAAGTG
CYP51b-UP-FForward949GCAATTGCGAGCATGTGAGTG
CYP51b-UP-RReverse AAAATAGGCATTGATGTGTTGACCTCCGCTGGTAGTGTGAAGGGAAG
CYP51b-DOWN-FForward1016CTCGTCCGAGGGCAAAGGAATAGAGTAGGGGAATGTATATTGTAAGCC
CYP51b-DOWN-RReverse CTTCTGCATCATGAGCTGGAC
CYP51b-ID-FForward1541CTCTCTCGCGCCACTGCTG
CYP51b-ID-RReverse GTGATGTCATAACGTCTTTTG
CYP51b-Nest-FForward3096CTAGCGAATCGAAGACGGAG
CYP51b-Nest-RReverse GCGCCGTCGACTCAGGGTAGG
HPH-FForward1349GGAGGTCAACACATCAATGCCTATT
HPH-RReverse CTACTCTATTCCTTTGCCCT
Table 2. Size of spores and appressoria, growth rates, and sporulation of Colletotrichum siamense and C. fructicola.
Table 2. Size of spores and appressoria, growth rates, and sporulation of Colletotrichum siamense and C. fructicola.
SpeciesStrain NumberConidia yAppresoria yGrowth Rate (mm/Day) ySporulation (×106) y
Length (μm)Width (μm)Length (μm)Width (μm)
C. siamenseJD-A-1214.17 ± 0.63 b5.64 ± 0.46 b6.97 ± 0.45 b6.36 ± 0.70 ab13.54 ± 0.37 a21.06 ± 5.71 a
JD-A-2615.57 ± 0.21 b6.87 ± 0.19 a7.10 ± 0.25 b5.69 ± 0.66 ab13.42 ± 0.08 a20.20 ± 2.44 ab
C. fructicolaJD-A-1417.14 ± 0.59 a6.21 ± 0.19 a8.19 ± 0.15 a6.83 ± 0.43 b13.48 ± 0.04 a16.36 ± 3.72 b
JD-A-2216.68 ± 0.30 a6.63 ± 0.13 a8.90 ± 0.72 a7.03 ± 0.19 a13.51 ± 0.07 a14.53 ± 3.15 b
y Data are the mean ± standard error. Mean values with the same letters were not statistically different (p > 0.05) according to the least significant difference (LSD) test.
Table 3. The growth rate, sporulation, and appressorium production rate of wild-type JD-A-12 and CsCYP51A and CsCYP51B deletion mutants.
Table 3. The growth rate, sporulation, and appressorium production rate of wild-type JD-A-12 and CsCYP51A and CsCYP51B deletion mutants.
SpeciesGrowth Rate (mm/Day) ySporulation (×106) yAppressorium Production Rate (%) y
JD-A-1211.56 ± 0.07 a1.3 ± 0.09 b13.82 ± 1.74 b
∆CsCYP51A10.39 ± 0.10 b1.7 ± 0.13 b14.47 ± 1.22 b
∆CsCYP51B7.28 ± 0.09 c4.33 ± 0.30 a17.80 ± 1.25 a
y Data are the mean ± standard error. Mean values with the same letters were not statistically different (p > 0.05) according to the least significant difference (LSD) test.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hu, S.; Wu, J.; Yang, X.; Xiao, W.; Yu, H.; Zhang, C. Involvement of CYP51A and CYP51B in Growth, Reproduction, Pathogenicity, and Sensitivity to Fungicides in Colletotrichum siamense. Agronomy 2023, 13, 239. https://doi.org/10.3390/agronomy13010239

AMA Style

Hu S, Wu J, Yang X, Xiao W, Yu H, Zhang C. Involvement of CYP51A and CYP51B in Growth, Reproduction, Pathogenicity, and Sensitivity to Fungicides in Colletotrichum siamense. Agronomy. 2023; 13(1):239. https://doi.org/10.3390/agronomy13010239

Chicago/Turabian Style

Hu, Shuodan, Jianyan Wu, Xiaoqi Yang, Wenfei Xiao, Hong Yu, and Chuanqing Zhang. 2023. "Involvement of CYP51A and CYP51B in Growth, Reproduction, Pathogenicity, and Sensitivity to Fungicides in Colletotrichum siamense" Agronomy 13, no. 1: 239. https://doi.org/10.3390/agronomy13010239

APA Style

Hu, S., Wu, J., Yang, X., Xiao, W., Yu, H., & Zhang, C. (2023). Involvement of CYP51A and CYP51B in Growth, Reproduction, Pathogenicity, and Sensitivity to Fungicides in Colletotrichum siamense. Agronomy, 13(1), 239. https://doi.org/10.3390/agronomy13010239

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop