Next Article in Journal
Identification and Characterization of Fungal Pathogens Causing Trunk and Branch Cankers of Almond Trees in Morocco
Next Article in Special Issue
Rice Genomics Research, Gene Mining and Utilization: A Themed Issue Dedicated to Academician/Prof. Yingguo Zhu
Previous Article in Journal
Phylogenetic Analysis of Wild Pomegranate (Punica granatum L.) Based on Its Complete Chloroplast Genome from Tibet, China
Previous Article in Special Issue
Identification of a New Wide-Compatibility Locus in Inter-Subspecific Hybrids of Rice (Oryza sativa L.)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

OsChlC1, a Novel Gene Encoding Magnesium-Chelating Enzyme, Affects the Content of Chlorophyll in Rice

1
Hubei Provincial Key Laboratory for Protection and Application of Special Plants in Wuling Area of China, College of Life Science, South-Central Minzu University, Wuhan 430074, China
2
Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, China
3
College of Life Science, South-Central Minzu University, Wuhan 430074, China
*
Author to whom correspondence should be addressed.
Agronomy 2023, 13(1), 129; https://doi.org/10.3390/agronomy13010129
Submission received: 24 November 2022 / Revised: 27 December 2022 / Accepted: 28 December 2022 / Published: 30 December 2022
(This article belongs to the Special Issue A Themed Issue in Memory of Academician Zhu Yingguo (1939–2017))

Abstract

Leaf-color mutants in rice (Oryza sativa L.) are excellent models for studying chlorophyll biosynthesis and chloroplast development. In this study, a yellow-green-leaf mutant generated by 60Co irradiation, ygl9311, was isolated: it displayed a yellow-green leaf phenotype during the complete growth cycle. Compared with the wild type, the photosynthetic pigment contents of leaves in ygl9311 were significantly reduced, and chloroplast development was retarded. Genetic analysis indicated that the ygl9311 phenotype was controlled by a single recessive nuclear gene. Map-based cloning and transcriptome sequencing analysis suggested that the candidate gene was OsChlC1 (BGIOSGA012976), which encodes a Mg-chelatase I subunit. The results of CRISPR/Cas9 system and RNAi knockout tests show that mutation of OsChlC1 could reproduce the phenotype of yellow-green leaves of the mutant ygl9311. In conclusion, the novel rice leaf-color gene OsChlC1 affects the content of chlorophyll in rice, showing a relatively conserved function in indica and japonica rice cultivars.

1. Introduction

Leaf-color mutants are often generated due to disorders in chlorophyll (Chl) metabolism during plant development [1,2,3]. The molecular mechanism of leaf-color mutant generation remains unclear because Chl metabolism involves complex biochemical reactions [4]. Rice (Oryza sativa L.) is an important food crop and also one of the most widely studied model plants. For this reason, many scholars have studied rice leaf-color mutants.
So far, hundreds of rice leaf-color mutants have been identified, and more than 30 leaf-color mutant genes have been cloned [5,6]. These genes are involved mostly in the metabolic pathway of photosynthetic pigments and can be assigned into three categories. The first category refers to genes that are directly involved in the synthesis of photosynthetic pigments and whose mutation hinders this synthesis. For instance, OsCHLH is a gene encoding the H subunit of magnesium ion (Mg2+) chelatase during Chl synthesis, and its complete knockout kills mutants [7]. OsCAO encodes Chl oxygenase, and its mutation leads to the delayed development of rice plants and grayish-green leaves [8]. YGL1 encodes Chl synthase, and its mutation makes rice leaves yellow-green in the seedling stage but normal green in the grain-filling stage [9]. OsDVR, a gene encoding α-8-vinyl reductase, catalyzes the reduction of divinyl Chl to vinyl Chl [10]. YGL22 encodes a chloroplast protein, and its knockout results in the yellow-green leaf phenotype in the seedling stage [11]. The second category comprises genes involved mainly in the degradation of Chl and whose mutation makes rice leaves keep the evergreen phenotype. For example, SGR mutations hinder the degradation of Chl and pigment-related proteins in rice [12]. NYC1 encodes Chl b reductase, and its mutation represses the degradation of chloroplast grana allowing rice leaves to remain green at harvest time [13,14]. NYC3 mediates the degradation of the light-harvesting chromoprotein composites [15]. NYC4 also participates in the degradation of Chl-protein composites. The third category represents genes that are involved mainly in the synthesis of photosynthetic pigments other than Chl [16]. For instance, OsPDS and β-OsLCY are key enzymes for the synthesis of carotenoid precursors [17].
Chl synthesis comprises two parts: biosynthesis of protoporphyrin IX from L-glutamyl-tRNA and then synthesis of Chl a and Chl b from protoporphyrin IX [18,19,20,21]. Mg-chelatase is one of the key rate-limiting enzymes for the synthesis of Chl from protoporphyrin IX, chelating Mg2+ to protoporphyrin IX to generate magnesium protoporphyrin IX [18]. Mg-chelatase is composed of three different subunits, namely CHLI (38–46 kDa), CHLD (60–87 kDa), and CHLH (140–155 kDa) [22,23,24]. Mg-chelatase has been proved in in vivo and in vitro recombination experiments to play its role only when all three subunits are present [22,25]. It is speculated that Mg-chelatase works through the following mechanism: Firstly, the CHLI subunit possesses ATPase activity [26]. Then, the CHLD subunit contains a protein-binding domain able to form the CHLD/CHLI complex with the CHLI subunit [26]. Finally, with the energy from ATP hydrolysis, the CHLH subunit chelates Mg2+ to protoporphyrin IX [27]. However, a detailed molecular mechanism of Mg-chelatase remains to be clarified. More Mg-chelatase-related genes need to be cloned to accelerate this process.
In this study, a yellow-green leaf mutant (ygl9311) was identified, with leaves showing the yellow-green phenotype during the complete growth cycle. Leaves of ygl9311 had a significantly decreased content of photosynthetic pigments in contrast with the wild type. Transmission electron microscopy (TEM) observations showed small and distorted chloroplasts in the leaves of ygl9311, and the grana and lamellae in chloroplasts became less abundant, with blurred granum lamellae. Moreover, the candidate gene (named OsChlC1 in this study) of ygl9311 was located in a 403.1 kb physical interval on chromosome 3 as determined by map-based cloning in this study. The analysis showed that OsChlC1 encoded the subunit I of Mg-chelatase, playing a key role in the Chl synthesis in rice.

2. Materials and Methods

2.1. Plant Materials and Inherited Pattern Analysis

Previously, Teng et al. obtained a yellow-green leaf mutant (ygl9311) by 60Co-γ-ray mutagenesis from normal green leaf indica cultivar 9311 [28]. Normal indica cultivar Gangzao was crossed with mutant ygl9311 to obtain the F1 generation, and the F2 population for gene mapping was obtained by selfing the F1 plants.
The reciprocal cross experiment between mutant ygl9311 and the indica cultivar Gangzao was carried out to study the genetic pattern of the yellow leaf mutant. The reciprocal cross between the cultivar 9311 and the indica cultivar Gangzao was taken as control. The phenotypes of the F1 and F2 generations were investigated, and the trait segregation ratio in F2 generation was calculated and analyzed by chi square test.
All rice materials were planted under natural field conditions in either Wuhan, Hubei Province, China, or Lingshui, Hainan Province, China.

2.2. Measurement of Major Agronomic Traits

The mutant ygl9311 and indica cultivar 9311 were planted to measure the major agronomic traits. After maturation, plant height, number of effective tillers, number of productive panicles per plant, and number of spikelets per panicle were recorded. Data of the mutant ygl9311 and cultivar 9311 were analyzed in Microsoft Excel, and significance of difference between them was assessed using the t-test.

2.3. Quantitative Analysis of Chlorophyll Content

For pigment extraction, fresh leaves (second from the top) from three biological replicates were taken in the three-leaf stage, middle of tillering stage, and flowering stage. An amount of 0.15 g of fresh leaf per sample was homogenized and centrifuged in ice-cold 80% v/v acetone. The concentrations of chlorophyll a and b and carotenoids were calculated by measuring the absorbance of the supernatant at wavelengths 663 nm, 645 nm, and 470 nm, respectively, using the equation of Lichtenthaler [29]. All procedures were carried out under dim green light to avoid the degradation of photosynthetic pigments.

2.4. Observations of Chloroplast Structure

Leaf samples of the mutant ygl9311 and indica cultivar 9311 were harvested from the second leaf from the top of seedlings in the 1-core 2-leaf stage. The samples were fixed with 0.1 mol/L phosphate buffer (pH 7.2) containing 3% w/v glutaraldehyde for 4 h. They were post-fixed with 1% v/v osmium acid (pH 7.2) for 4 h. The samples were dehydrated with 30%, 50%, 70%, 80%, 90%, and 100% acetone and then embedded in epoxy resin SPURR. The samples were cut into approximately 1 μm thick sections with a freezing microtome. After staining, the ultrathin sections were observed under a transmission electron microscope (H-600IV, Hitachi, Tokyo, Japan).

2.5. Measurement of Total SOD Activity

Total superoxide dismutase (SOD) activity of the mutant ygl9311 and indica cultivar 9311 was measured with an SOD enzyme activity assay kit from Nanjing Jiancheng Company. The kit used the xanthine oxidase method to determine the activity of SOD. Five biological replicates, each containing 0.1 g of fresh leaves from a mature plant, were analyzed.

2.6. Initial Mapping of the Mutant ygl9311 Locus with Genome Re-Sequence

Mixed-genome DNA pools of mutant ygl9311 and indica cultivar 9311 were built, consisting of 100 individual genome DNA. Re-sequence of the two pools was carried out on an Illumina Hiseq2000. The re-sequence data were aligned with the japonica reference genomic sequence (EnsemblPlants, http://plants.ensembl.org/Oryza_sativa/Info/Index, accessed on 21 May 2018) to remove low-quality data. Softs of GATK and annovar were used to align and annotate SNPs and small indels. Then, initial mapping was conducted by screening homozygous mutation sites where the mutant ygl9311 was not consistent with indica cultivar 9311.

2.7. Fine Mapping of the Mutant ygl9311 Locus and Prediction of Candidate Genes

A total of 1325 recessive F2 plants derived from more than 5300 plants of (the mutant ygl9311/indica cultivar Gangzao) F2 population were selected for fine mapping. According to the result of the initial mapping, seven simple sequence repeat (SSR) markers (Table 1) located on chromosome 3 were used for making the linkage map for ygl9311 locus. Marker information was provided from a web server, Gramene (http://www.gramene.org/bd/markers/, accessed on 5 June 2018). Transcriptome data between mutant ygl9311 and indica cultivar 9311 were used to predict candidate genes. Those genes located within the mapping interval and expressed differentially were considered as candidate genes. The function of candidate genes was predicted with EnsemblPlants.

2.8. Validation of the Function of Candidate Gene

To validate the function of candidate gene (OsChlC1), the knockout construct of OsChlC1 was built through the gene-editing vector CRISPR/Cas9 [30]. Two specific editing fragments were amplified with the primers F1 5′-GGCAGCACCGTGTCGAGCGCGTA-3′ and 5′-AAACTACGCGCTCGACACGGTGC-3′ and F2 5′-GGCAGCCGCCGTGTACCCTTCTA-3′ and 5′-AAACTAGAAGGGTACACGGCGGC-3′. The two specific editing sites were then inserted into the entry vector SK-gRNA. The gRNA-F1 and gRNA-F2 fragments were cloned into the binary vector pCAMBIA1300-Cas9. The resulting construct was designated as pCAMBIA1300-Cas9-OsChlC1 and was transformed into japonica cultivar Nipponbare by Agrobacterium-mediated transformation. Primers 5′-GAATCCCTCAGCATTGTTC-3′ and 5′-TTGCGTCGTGCAGTCTGT-3′ were designed to detect the editing sites in the positive transgenic plants.
The RNAi construct of OsChlC1 was also built in the vector DS1301. The specific interference fragment was amplified with the primers 5′-TAAACTAGTGGTACCGAACGCCTTGACACCATCGG-3′ and 5′-TAAGAGCTCGGATCCAATCCCTTCGAGACTTGGGTG-3′. The forward primer contained a KpnI and an SpeI site, and the reverse primer contained an SacI and a BamHI site. The resulting construct was designated as pDS1301-OsChlC1-RNAi and was transformed into indica cultivar 9311 by Agrobacterium-mediated transformation.

3. Results

3.1. Inheritance Pattern of the ygl9311 Mutant

The leaf-color mutant ygl9311 in rice was induced by 60Co-γ-ray mutagenesis from indica rice cultivar 9311; it had yellow-green leaves during the whole growth cycle (Figure 1). To analyze the genetic pattern of the mutant ygl9311, direct and reciprocal crosses with the mutant ygl9311 and indica rice cultivar Gangzao as parents were conducted in this study. It was found that the leaves of both direct and reciprocal cross F1 generations were all green (Figure 1B), but both direct and reciprocal cross F2 generations showed trait segregation of yellow-green and normal green leaves. According to statistics, 926 seedlings with green leaves and 301 seedlings with yellow-green leaves were found in the direct cross F2 generation, and 1087 green seedlings and 349 yellow-green seedlings were identified in the reciprocal cross F2 generation. The segregation ratio of green leaf seedlings to yellow-green leaf seedlings in direct cross (926 green: 301 yellow-green, x2 = 0.144 < x20.05,1 = 3.84) and reciprocal cross (1087 green: 349 yellow-green, x2 = 0.379 < x20.05,1 = 3.84) F2 generations is consistent with the Mendelian single-gene segregation rule of 3:1. These results indicate that the mutant ygl9311 is a recessive inheritance controlled by a single gene.

3.2. Characteristics of the Mutant ygl9311

Several groups of major agronomic traits of the mutant ygl9311 and wild indica cultivar 9311 were assessed in this study to explore the influence of the mutation site on the agronomic traits of rice. When planted in Wuhan, Hubei Province, China, the plant height, number of productive panicles per plant, and number of spikelets per panicle of the mutant ygl9311 were 31.1%, 53.2%, and 20.5%, respectively, lower than those of the wild-type indica cultivar 9311, but the number of effective tillers per plant showed no significant difference between the mutant ygl9311 and the indica cultivar 9311 (Figure 2). However, when planted in Lingshui, Hainan Province, China, the mutant ygl9311 grew well and displayed agronomic traits, such as the plant height, comparable to the indica cultivar 9311. The above results signify that the mutation site affected the agronomic traits of rice plants planted in Wuhan, but they exerted less effect on agronomic traits when rice plants were planted in Hainan.
The total superoxide dismutase (SOD) activity in the mutant ygl9311 was detected to assess the effects of the mutation site on the stress resistance and antioxidant capacity of rice. The results indicate that the total SOD activity of mutant plants was 1474 U/g, slightly higher than that of the wild type (Figure 3), implying that the mutation site did not weaken the stress resistance and antioxidant capacity of rice plants.
Additionally, the photosynthetic pigment content in the leaves of the mutant ygl9311 and indica cultivar 9311 was measured in this study at the one-core three-leaf stage, middle tillering stage, and heading stage, to investigate the physiological causes of the mutant ygl9311. At the above three stages, the content of Chl a in the mutant was, respectively, 58%, 80%, and 83% lower than that in the indica cultivar 9311, that of Chl b in the mutant was, respectively, 86%, 96%, and 99% lower than that in the indica cultivar 9311, and the carotenoid content in the mutant was, respectively, 58%, 77%, and 79% lower than that in the indica cultivar 9311 (Figure 4). The content of photosynthetic pigments was significantly lower in the mutant than in the indica cultivar 9311 in both the seedling stage and at maturity, consistent with the mutant keeping yellow-green leaves during the whole growth cycle. The above results demonstrate that the change in the leaf color of the mutant is attributed mainly to decreased pigment content in mutant plants.
To analyze further the effect of the mutation site on chloroplast development, the structure and morphology of chloroplasts in the mutant ygl9311 and indica cultivar 9311 were examined by TEM (Figure 5). The results reveal that chloroplasts in the leaves of the mutant had a small size, distorted shape, and abnormal structure, in which the abundance of grana and lamellae declined, with blurred granum lamellae, fewer cristae, and obviously more osmiophilic granules. These results indicate that the mutant ygl9311 has abnormal chloroplast development.

3.3. Map-Based Cloning of Locus of the Mutant ygl9311

In the present study, homozygous mutation sites between the mutant and the wild cultivar genome were screened out using the genome re-sequencing method to locate the mutation site of mutant ygl9311. According to re-sequencing results, 114,186,956 and 113,101,763 high-quality sequences with a reading length of over 100 bp were obtained in the mutant mixed pool and indica cultivar 9311 mixed pool, respectively. Next, the above sequences were processed with GATA software, and 4,820,964 single-nucleotide polymorphism (SNP) sites and 136,678 small InDel sites were identified. Importantly, homozygous mutation sites in the genome of the mutant were located on rice chromosomes. It was discovered that there was a SNP peak (at 20,546–21,231 Kb) on chromosome 3 (Figure 6). Therefore, it was speculated that the mutation site was located in the physical interval (20,546–21,231 Kb) on chromosome 3.
Thereafter, a F2 population was constructed with the mutant ygl9311 and indica cultivar Gangzao as parents to verify the above location results and obtain the fine-mapping of the mutant site. In brief, 1325 homozygous and recessive F2 yellow-green leaf plants were screened using SSR primers within the initial mapping interval and in both flanking regions, on chromosome 3. The results show that the mutation site was located in the genetic interval of 7.77 cM on chromosome 3 based on seven SSR markers (Figure 7A). The ygl9311 locus was finally narrowed to two SSR markers RM15303 and RM15313. We analyzed the sequences of these two SSR markers on the EnsemblPlants database and found that the mutation site was located at the physical interval (22,403,557–22,833,663 bp) on chromosome 3, between RM15303 (366.5 kb) and RM15313 (62.2 kb), in the genome of indica cultivar 9311. This physical interval has a length of 430.1 kb, covering 27 encoding genes (Figure 7B).
Transcriptome sequencing was performed between the mutant ygl9311 and the indica cultivar 9311 in this study to determine the candidate gene of the mutation site. It was found that there were 217 differentially expressed genes (data not shown) between the mutant ygl9311 and the indica cultivar 9311. Among these differentially expressed genes, two genes were in the physical interval of the yellow-green leaf mutation site (Table S1). Bioinformatics analysis manifested that among these differentially expressed genes, both BGIOSGA012976 and BGIOSGA010427 were encoding the Mg-chelatase I subunit and were implicated in chlorophyll content. However, only BGIOSGA012976 showed sequence differences between indica cultivar 9311 and the mutant ygl9311. Therefore, it was considered in the present study that BGIOSGA012976 was the candidate gene of the mutation ygl9311, and we named it OsChlC1.
OsChlC1 is composed of two exons and one intron and has an open reading frame of 1152 bp, which can encode a polypeptide molecule consisting of 383 aa residues. In the present study, it was predicted that this gene has a chloroplast signal peptide (http://www.cbs.dtu.dk/services/TargetP/, accessed on 23 September 2020; Figure S1) at its N-terminus. According to sequence analysis, OsChlC1 has a deletion mutation, and the first 640 bases of CDS of OsChlC1 are absent in the genome of mutant ygl9311.

3.4. Validating the Function of OsChlC1

To validate the function of the candidate gene (OsChlC1), the knockout vector PC1300-CAS9-OsChlC1 was constructed with the CRISPR-Cas9 technology, and genetic transformation was carried out on the indica cultivar 9311 with normal leaf color. Next, phenotypic identification was conducted on five transgenic rice plants that had OsChlC1 successfully knocked out. It was uncovered that the leaf color of these rice plants with OsChlC1 knocked out was yellow-green, consistent with that of the mutant ygl9311 (Figure 8). Therefore, it was confirmed that the phenotype of yellow-green leaves of the mutant ygl9311 was due to the mutation of the OsChlC1 gene.

4. Discussion

In this study, the indica cultivar 9311 was subjected to mutation with 60Co-γ-rays, and the mutant ygl9311 with yellow-green leaves was then screened out. Next, the leaf-color gene was located by the map-based cloning strategy, cloned, and named OsChlC1. The results of knockout tests show that the mutant of OsChlC1 could reproduce the phenotype of yellow-green leaves of the mutant ygl9311. Therefore, a new rice leaf-color gene OsChlC1 was cloned in this study.

4.1. Chlorina Phenotype of Mutant ygl9311 Results from the Impaired Photosynthetic Pigment Synthesis

The contents of Chl a, Chl b, and carotene were significantly lower in the leaves of the mutant ygl9311 than the indica cultivar 9311 in the seedling, tillering, and heading stages (Figure 4). Such a change in photosynthetic pigment content is consistent with the fact that the mutant has the traits of yellow-green leaves during the whole growth cycle. Under the catalysis of chlorophyllin a oxidase, chlorophyllin is converted into Chl b. The ratio Chl a/Chl b was significantly higher in the mutant ygl9311 than the indica cultivar 9311 (Table S2), indicating an effect on the conversion of Chl a to Chl b. However, the ratio of total Chl content to carotene content exhibited no obvious difference between the two genotypes.
Photosynthesis-enabling protein complexes are embedded in the thylakoid membrane of chloroplasts [31,32,33]. The ultrastructural observation of chloroplasts revealed that the chloroplasts of the mutant ygl9311 became smaller in size and distorted in shape, with an obviously decreased number of grana and lamellae (Figure 5). The above results indicate that the decrease in photosynthetic pigment content in the mutant ygl9311 is the key factor leading to the phenotype of yellow-green leaves during the whole growth cycle. Moreover, the decrease in photosynthetic pigment content in the mutant ygl9311 was associated with the defective development of chloroplasts.

4.2. The Mutation of OsChlC1 Results in Decreased Photosynthetic Pigment Content in ygl9311

Using a F2 mapping population, the mutant gene was localized on chromosome 3, and its candidate gene BGIOSGA012976 was cloned. The results of function prediction revealed that the gene encoded the Mg-chelatase I subunit; hence, the gene was named OsChlC1. The CRISPR-Cas9 technique was employed to create a mutant of the indica cultivar 9311 with OsChlC1 knocked out. These transgenic indica rice plants showed the same yellow-green leaf phenotype as that of the yellow-leaf mutant (Figure 8). In addition, the knockout vector was transformed into the japonica rice cultivar Nipponbare, and these transgenic japonica rice plants also had the yellow-green leaf phenotype as that of the mutant ygl9311 (Figure S2). The results of these two knockout experiments suggest a conserved function of OsChlC1 in indica and japonica rice cultivars. Moreover, the knockout tests in both indica and japonica rice cultivars fully proved that OsChlC1 mutation gives rise to the phenotype of yellow-green leaves.

4.3. OsChlC1 Is a Novel Mg-Chelatase Gene

As one of the key rate-limiting enzymes in chloroplast synthesis, Mg-chelatase binds Mg2+ to protoporphyrin IX to generate magnesium protoporphyrin IX [34,35]. Mg-chelatase is a complex protein composed of I, D, and H subunits [36]. Subunit I is a member of the AAA+ superfamily and has ATPase activity, whereas subunit D can form a binary complex with subunit I and interact with subunit H to insert Mg into protoporphyrin IX [37]. The Chl I subunit, an AAA+ ATPase, is responsible for the hydrolysis of ATP [38], with two very conserved domains, walker A and walker B, at its N-terminus, with walker A binding stably to ATP and walker B promoting the hydrolysis of ATP [39,40].
Many CHLI genes have been cloned in green plants. Two CHLI genes, namely CHLI1 and CHLI2, exist in Arabidopsis. AtCHLI1 mutation leads to the phenotype of gray-green leaves [41]. In rice, a point mutation on the third exon in the OsCHLI gene in the Chlorina-9 mutant weakens the Mg-chelatase activity [42]. A follow-up study showed that in the Chlorina-9 mutant, the CHLI subunit could not bind to the CHLD subunit to trigger the synthesis of Mg protoporphyrin IX. OsCHLI comprises three exons and two introns and encodes 415 Aa residues. The Chlorina-9 mutant of rice has the phenotype of yellow-green leaves at the three-leaf stage, but its leaf color returns to normal green in the heading stage [42]. In the present study, OsChlC1, a new Mg-chelatase I subunit gene, was cloned in the mutant ygl9311. OsChlC1 encoded 383 aa residues and was composed of exons and one intron. The mutant ygl9311 exhibited the phenotype of yellow-green leaves during the whole growth cycle of rice. In conclusion, OsChlC1 is a newly cloned Mg-chelatase I subunit gene in rice, and its mutation reduces the content of chlorophyll in rice, leading to the phenotype of yellow-green leaves.
Although a series of results were obtained in this study, there are still some studies to be further improved. We constructed the ectopic expression vector of the OsChlC1 gene, and genetic transformation is already in progress. However, no positive plants have been obtained from the complementary assay. On the other hand, CRISPR/Cas9 system and RNAi knockout tests showed that the mutant of OsChlC1 could reproduce the phenotype of yellow-green leaves of the mutant ygl9311, but we still need to determine the content of chlorophyll in the above mutant leaves. Gene function prediction indicates that OsChlC1 encodes Mg-chelatase subunit I. In order to verify the function of OsChlC1, we need to detect the activity of magnesium ion chelatase in different mutants.

5. Conclusions

In this study, the candidate gene OsChlC1 of the rice yellow-green leaf mutant ygl9311 was cloned. According to the sequence analysis and function prediction, OsChlC1 encoding 383 aa residues is a new Mg-chelatase I subunit gene. In addition, OsChlC1 knockout in the indica rice cultivar 9311 and the japonica rice cultivar Nipponbare had the phenotype of yellow-green leaves of the mutant ygl9311. Therefore, we conclude that OsChlC1 mutation in the genome of the indica rice cultivar 9311 leads to a decrease in chlorophyll content in rice leaves, affects chloroplast development, and results in the phenotype of yellow-green leaves of the mutant ygl9311. The OsChlC1 exerts a relatively conserved function in indica and japonica rice cultivars.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy13010129/s1, Figure S1: Chloroplast Signal Peptide Prediction of OsChlC1 Gene, Figure S2: The Phenotypes of the wild-type parent 9311 (WT), mutant ygl9311, knockout transgenic plant (KO), and transgenic recipient parent Nipponbare (NIP) at seedling stage, Table S1: Differentially expressed genes within the physical location of the ygl9311 mutation site, Table S2: Pigment content and ratio at various stages between ygl9311 and wild type.

Author Contributions

Conceptualization, W.L., Y.T. (Yantong Teng) and F.H.; Data curation, W.L.; Investigation, G.C.; Methodology, W.L., Y.T. (Yantong Teng) and X.W.; Resources, C.W.; Software, Y.T. (Yantong Teng); Supervision, Y.T. (Yanping Tan); Validation, W.L., Y.Q. and X.X.; Writing—original draft, W.L.; Writing—review and editing, W.L. and Y.T. (Yanping Tan). All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

The datasets generated during the current study are available from the corresponding author on reasonable request.

Acknowledgments

The authors extend their appreciation for the support from the Hubei Provincial Key Laboratory for Protection and Application of Special Plants in Wuling Area of China, College of Life Science, South-Central Minzu University.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Khan, A.; Jalil, S.; Cao, H.; Tsago, Y.; Sunusi, M.; Chen, Z.; Shi, C.; Jin, X. The Purple Leaf (pl6) Mutation Regulates Leaf Color by Altering the Anthocyanin and Chlorophyll Contents in Rice. Plants 2020, 9, 1477. [Google Scholar] [CrossRef] [Scilit]
  2. Wang, Y.; Wang, J.; Chen, L.; Meng, X.; Zhen, X.; Liang, Y.; Han, Y.; Li, H.; Zhang, B. Identification and function analysis of yellow-leaf mutant (YX-yl) of broomcorn millet. BMC Plant Biol. 2022, 22, 463. [Google Scholar] [CrossRef] [Scilit]
  3. Chen, T.; Huang, L.; Wang, M.; Huang, Y.; Zeng, R.; Wang, X.; Wang, L.; Wan, S.; Zhang, L. Ethyl Methyl Sulfonate-Induced Mutagenesis and Its Effects on Peanut Agronomic, Yield and Quality Traits. Agronomy 2020, 10, 655. [Google Scholar] [CrossRef] [Scilit]
  4. Yan, J.; Sun, P.; Liu, W.; Xie, D.; Wang, M.; Peng, Q.; Sun, Q.; Jiang, B. Metabolomic and Transcriptomic Analyses Reveal Association of Mature Fruit Pericarp Color Variation with Chlorophyll and Flavonoid Biosynthesis in Wax Gourd (Benincasa hispida). Agronomy 2022, 12, 2045. [Google Scholar] [CrossRef] [Scilit]
  5. Deng, X.-J.; Zhang, H.-Q.; Wang, Y.; He, F.; Liu, J.-L.; Xiao, X.; Shu, Z.-F.; Li, W.; Wang, G.-H.; Wang, G.-L. Mapped clone and functional analysis of leaf-color gene Ygl7 in a rice hybrid (Oryza sativa L. ssp. indica). PLoS ONE 2014, 9, e99564. [Google Scholar] [CrossRef] [Scilit]
  6. Wan, C.; Li, C.; Ma, X.; Wang, Y.; Sun, C.; Huang, R.; Zhong, P.; Gao, Z.; Chen, D.; Xu, Z.; et al. GRY79 encoding a putative metallo-β-lactamase-trihelix chimera is involved in chloroplast development at early seedling stage of rice. Plant Cell Rep. 2015, 34, 1353–1363. [Google Scholar] [CrossRef] [Scilit]
  7. Jung, K.-H.; Hur, J.; Ryu, C.-H.; Choi, Y.; Chung, Y.-Y.; Miyao, A.; Hirochika, H.; An, G. Characterization of a rice chlorophyll-deficient mutant using the T-DNA gene-trap system. Plant Cell Physiol. 2003, 44, 463–472. [Google Scholar] [CrossRef] [Scilit]
  8. Lee, S.; Kim, J.-H.; Yoo, E.-S.; Lee, C.-H.; Hirochika, H.; An, G. Differential regulation of chlorophyll a oxygenase genes in rice. Plant Mol. Biol. 2005, 57, 805–818. [Google Scholar] [CrossRef] [Scilit]
  9. Wu, Z.; Zhang, X.; He, B.; Diao, L.; Sheng, S.; Wang, J.; Guo, X.; Su, N.; Wang, L.; Jiang, L.; et al. A chlorophyll-deficient rice mutant with impaired chlorophyllide esterification in chlorophyll biosynthesis. Plant Physiol. 2007, 145, 29–40. [Google Scholar] [CrossRef] [Scilit]
  10. Wang, P.; Gao, J.; Wan, C.; Zhang, F.; Xu, Z.; Huang, X.; Sun, X.; Deng, X. Divinyl chlorophyll(ide) a can be converted to monovinyl chlorophyll(ide) a by a divinyl reductase in rice. Plant Physiol. 2010, 153, 994–1003. [Google Scholar] [CrossRef] [Scilit]
  11. Zhu, Y.; Yan, P.; Dong, S.; Hu, Z.; Wang, Y.; Yang, J.; Xin, X.; Luo, X. Map-based cloning and characterization of YGL22, a new yellow-green leaf gene in rice (Oryza sativa). Crop Sci. 2020, 61, 529–538. [Google Scholar] [CrossRef] [Scilit]
  12. Jiang, H.; Li, M.; Liang, N.; Yan, H.; Wei, Y.; Xu, X.; Liu, J.; Xu, Z.; Chen, F.; Wu, G. Molecular cloning and function analysis of the stay green gene in rice. Plant J. 2007, 52, 197–209. [Google Scholar] [CrossRef] [Scilit]
  13. Kusaba, M.; Ito, H.; Morita, R.; Iida, S.; Sato, Y.; Fujimoto, M.; Kawasaki, S.; Tanaka, R.; Hirochika, H.; Nishimura, M.; et al. Rice NON-YELLOW COLORING1 is involved in light-harvesting complex II and grana degradation during leaf senescence. Plant Cell 2007, 19, 1362–1375. [Google Scholar] [CrossRef] [Scilit]
  14. Sato, Y.; Morita, R.; Katsuma, S.; Nishimura, M.; Tanaka, A.; Kusaba, M. Two short-chain dehydrogenase/reductases, NON-YELLOW COLORING 1 and NYC1-LIKE, are required for chlorophyll b and light-harvesting complex II degradation during senescence in rice. Plant J. 2007, 57, 120–131. [Google Scholar] [CrossRef] [Scilit]
  15. Morita, R.; Sato, Y.; Masuda, Y.; Nishimura, M.; Kusaba, M. Defect in non-yellow coloring 3, an α/β hydrolase-fold family protein, causes a stay-green phenotype during leaf senescence in rice. Plant J. 2009, 59, 940–952. [Google Scholar] [CrossRef] [Scilit]
  16. Yamatani, H.; Sata, Y.; Masuda, Y.; Kato, Y.; Morita, R.; Fukunaga, K.; Nagamura, Y.; Nishimura, M.; Sakamoto, W.; Tanaka, A.; et al. NYC4, the rice ortholog of Arabidopsis THF1, is involved in the degradation of chlorophyll-protein complexes during leaf senescence. Plant J. 2013, 74, 652–662. [Google Scholar] [CrossRef] [Scilit]
  17. Fang, J.; Chai, C.; Qian, Q.; Li, C.; Tang, J.; Sun, L.; Huang, Z.; Guo, X.; Sun, C.; Liu, M.; et al. Mutations of genes in synthesis of the carotenoid precursors of ABA lead to pre-harvest sprouting and photo-oxidation in rice. Plant J. 2008, 54, 177–189. [Google Scholar] [CrossRef] [Scilit]
  18. Beale, S.I. Green genes gleaned. Trends Plant Sci. 2005, 10, 309–312. [Google Scholar] [CrossRef] [Scilit]
  19. Bollivar, D.W. Recent advances in chlorophyll biosynthesis. Photosynth. Res. 2006, 90, 173–194. [Google Scholar] [CrossRef] [Scilit]
  20. Qiu, N.; Jiang, D.; Wang, X.; Wang, B.; Zhou, F. Advances in the members and biosynthesis of chlorophyll family. Photosynthetica 2019, 57, 974–984. [Google Scholar] [CrossRef] [Scilit]
  21. Zhang, H.; Liu, L.; Cai, M.; Zhu, S.; Zhao, J.; Zheng, T.; Xu, X.; Zeng, Z.; Niu, J.; Jiang, L.; et al. A point mutation of magnesium chelatase OsCHLI gene dampens the interaction between CHLI and CHLD subunits in rice. Plant Mol. Biol. Rep. 2015, 33, 1975–1987. [Google Scholar] [CrossRef] [Scilit]
  22. Willows, R.D.; Gibson, L.C.; Kanangara, C.G.; Hunter, C.N.; von Wettstein, D. Three separate proteins constitute the magnesium chelatase of Rhodobacter sphaeroides. Eur. J. Biochem. 1996, 15, 438–443. [Google Scholar] [CrossRef] [Scilit]
  23. Kannangara, C.G.; Vothknecht, U.C.; Hansson, M.; von Wettstein, D. Magnesium chelatase: Association with ribosomes and mutant complementation studies identify barley subunit Xantha-G as a functional counterpart of Rhodobacter subunit BchD. Mol. Gen. Genet. MGG 1997, 18, 85–92. [Google Scholar] [CrossRef] [Scilit]
  24. Davison, P.A.; Schubert, H.L.; Reid, J.D.; Iorg, C.D.; Heroux, A.; Hill, C.P.; Hunter, C.N. Structural and biochemical characterization of Gun4 suggests a mechanism for its role in chlorophyll biosynthesis. Biochemistry 2005, 31, 7603–7612. [Google Scholar] [CrossRef] [Scilit]
  25. Gibson, L.C.; Willows, R.D.; Kannangara, C.G.; von Wettstein, D.; Hunter, C.N. Magnesium-protoporphyrin chelatase of Rhodobacter sphaeroides: Reconstitution of activity by combining the products of the bchH, -I, and -D genes expressed in Escherichia coli. Proc. Natl. Acad. Sci. USA 1995, 92, 1941–1944. [Google Scholar] [CrossRef] [Scilit]
  26. Sirijovski, N.; Olsson, U.; Lundqvist, J.; Al-Karadaghi, S.; Willows, R.D.; Hansson, M. ATPase activity associated with the magnesium chelatase H-subunit of the chlorophyll biosynthetic pathway is an artefact. Biochem. J. 2006, 400, 477–484. [Google Scholar] [CrossRef] [Scilit]
  27. Gräfe, S.; Saluz, H.-P.; Grimm, B.; Hänel, F. Mg-chelatase of tobacco: The role of the subunit CHL D in the chelation step of protoporphyrin IX. Proc. Natl. Acad. Sci. USA 1999, 96, 1941–1946. [Google Scholar] [CrossRef] [Scilit]
  28. Teng, Y.; Ye, L.; He, F.; Chu, W.; Wang, C.; Tan, Y. Expression Analysis of Key Genes of Chlorophyll Synthesis in A Yellow Leaves Mutant of Oryza sativa. Chin. Agric. Sci. Bull. 2017, 33, 30–35. [Google Scholar]
  29. Lichtenthaler, H.K. [34] Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. Methods Enzymol. 1987, 148, 350–382. [Google Scholar]
  30. He, F.; Shao, M.; Chen, T.; Wang, C.; Xu, X.; Tan, Y. Knockout of a magnesium chelating enzyme gene in rice using CRISPR-Cas9 system. Fenzi Zhiwu Yuzhong (Mol. Plant Breed.) 2019, 17, 5674–5680. [Google Scholar]
  31. Pipitone, R.; Eicke, S.; Pfister, B.; Glauser, G.; Falconet, D.; Uwizeye, C.; Pralon, T.; Zeeman, S.C.; Kessler, F.; Demarsy, E. A multifaceted analysis reveals two distinct phases of chloroplast biogenesis during de-etiolation in Arabidopsis. Elife 2021, 10, e62709. [Google Scholar] [CrossRef] [Scilit]
  32. Sandoval-Ibáñez, O.; Sharma, A.; Bykowski, M.; Borràs-Gas, G.; Behrendorff, J.B.Y.H.; Mellor, S.; Qvortrup, K.; Verdonk, J.C.; Bock, R.; Kowalewska, Ł.; et al. Curvature thylakoid 1 proteins modulate prolamellar body morphology and promote organized thylakoid biogenesis in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 2021, 118, e2113934118. [Google Scholar] [CrossRef] [Scilit]
  33. Allen, J.F.; de Paula, W.B.; Puthiyaveetil, S.; Nield, J. A structural phylogenetic map for chloroplast photosynthesis. Trends Plant Sci. 2011, 16, 645–655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Wang, Z.; Hong, X.; Hu, K.; Wang, Y.; Wang, X.; Du, S.; Li, Y.; Hu, D.; Cheng, K.; An, B.; et al. Impaired Magnesium Protoporphyrin IX Methyltransferase (ChlM) Impedes Chlorophyll Synthesis and Plant Growth in Rice. Front Plant Sci. 2017, 8, 1694. [Google Scholar] [CrossRef] [Scilit]
  35. Sawicki, A.; Willows, R.D. S-adenosyl-L-methionine:magnesium-protoporphyrin IX O-methyltransferase from Rhodobacter capsulatus: Mechanistic insights and stimulation with phospholipids. Biochem. J. 2007, 406, 469–478. [Google Scholar] [CrossRef] [Scilit]
  36. Adhikari, N.D.; Froehlich, J.E.; Strand, D.D.; Buck, S.M.; Kramer, D.M.; Larkin, R.M. GUN4-porphyrin complexes bind the ChlH/GUN5 subunit of Mg-Chelatase and promote chlorophyll biosynthesis in Arabidopsis. Plant Cell 2011, 23, 1449–1467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Farmer, D.A.; Brindley, A.A.; Hitchcock, A.; Jackson, P.J.; Johnson, B.; Dickman, M.J.; Hunter, C.N.; Reid, J.D.; Adams, N.B.P. The ChlD subunit links the motor and porphyrin binding subunits of magnesium chelatase. Biochem. J. 2019, 476, 1875–1887. [Google Scholar] [CrossRef] [PubMed]
  38. Lundqvist, J.; Elmlund, H.; Wulff, R.P.; Berglund, L.; Elmlund, D.; Emanuelsson, C.; Hebert, H.; Willows, R.D.; Hansson, M.; Lindahl, M.; et al. ATP-induced conformational dynamics in the AAA+ motor unit of magnesium chelatase. Structure 2010, 18, 354–365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Jessop, M.; Felix, J.; Gutsche, I. AAA+ ATPases: Structural insertions under the magnifying glass. Curr. Opin. Struct. Biol. 2021, 66, 119–128. [Google Scholar] [CrossRef] [Scilit]
  40. Miller, J.M.; Enemark, E.J. Fundamental characteristics of AAA+ protein family structure and function. Archaea 2016, 2016, 9294307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Koncz, C.; Mayerhofer, R.; Koncz-Kalman, Z.; Nawrath, C.; Reiss, B.; Redei, G.P.; Schell, J. Isolation of a gene encoding a novel chloroplast protein by T-DNA tagging in Arabidopsis thaliana. EMBO J. 1990, 9, 1337–1346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Zhang, H.; Li, J.; Yoo, J.H.; Yoo, S.C.; Cho, S.H.; Koh, H.J.; Seo, H.S.; Paek, N.C. Rice Chlorina-1 and Chlorina-9 encode ChlD and ChlI subunits of Mg-chelatase, a key enzyme for chlorophyll synthesis and chloroplast development. Plant Mol. Biol. 2006, 62, 325–337. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Phenotypic characterization of the mutant ygl9311. (A) Plants at seedling stage. (B) Plants at mature stage grown in Hainan.
Figure 1. Phenotypic characterization of the mutant ygl9311. (A) Plants at seedling stage. (B) Plants at mature stage grown in Hainan.
Agronomy 13 00129 g001
Figure 2. Comparison of major agronomic traits between mutant ygl9311 and the wild-type parent 9311. Bars represent standard deviations of ten independent measurements. Significant differences were determined by Duncan′s Multiple Range test.
Figure 2. Comparison of major agronomic traits between mutant ygl9311 and the wild-type parent 9311. Bars represent standard deviations of ten independent measurements. Significant differences were determined by Duncan′s Multiple Range test.
Agronomy 13 00129 g002
Figure 3. SOD enzyme activity in mutant ygl9311 and the wild-type parent 9311. Bars represent standard deviations of three independent measurements. Significant differences were determined by Duncan′s Multiple Range test.
Figure 3. SOD enzyme activity in mutant ygl9311 and the wild-type parent 9311. Bars represent standard deviations of three independent measurements. Significant differences were determined by Duncan′s Multiple Range test.
Agronomy 13 00129 g003
Figure 4. Photosynthetic pigment contents in leaves of the mutant ygl9311 and the wild-type parent 9311. Bars represent standard deviations of three independent experiments. Significant differences were determined by Duncan′s Multiple Range test.
Figure 4. Photosynthetic pigment contents in leaves of the mutant ygl9311 and the wild-type parent 9311. Bars represent standard deviations of three independent experiments. Significant differences were determined by Duncan′s Multiple Range test.
Agronomy 13 00129 g004
Figure 5. Electron microscope images of the mutant ygl9311 and the wild-type plant at seedling stage. (A,B) Mesophyll cells of the wild type and ygl9311, respectively. (C,D) Chloroplasts of the wild type and ygl9311, respectively. Scale bar equals 1 μm.
Figure 5. Electron microscope images of the mutant ygl9311 and the wild-type plant at seedling stage. (A,B) Mesophyll cells of the wild type and ygl9311, respectively. (C,D) Chloroplasts of the wild type and ygl9311, respectively. Scale bar equals 1 μm.
Agronomy 13 00129 g005
Figure 6. Distribution of SNP loci on chromosome 3. Peak at the position of 20,546–21,231 Kb on the chromosome 3 of indica cultivar 9311.
Figure 6. Distribution of SNP loci on chromosome 3. Peak at the position of 20,546–21,231 Kb on the chromosome 3 of indica cultivar 9311.
Agronomy 13 00129 g006
Figure 7. Molecular mapping of the ygl9311 locus. (A) OsChlC1 was narrowed between SSR markers RM15303 and RM15313 basing on analysis of 1325 recessive F2 plants. (B) Total of 2 differentially expressed genes were found in the region between RM15303 and RM15313. (C) Candidate gene OsChlC1 comprises two exons and one intron.
Figure 7. Molecular mapping of the ygl9311 locus. (A) OsChlC1 was narrowed between SSR markers RM15303 and RM15313 basing on analysis of 1325 recessive F2 plants. (B) Total of 2 differentially expressed genes were found in the region between RM15303 and RM15313. (C) Candidate gene OsChlC1 comprises two exons and one intron.
Agronomy 13 00129 g007
Figure 8. The phenotypes of the transgenic receptor parent indica 9311 (WT), mutant ygl9311, and knockout transgenic plant (KO) at seedling stage.
Figure 8. The phenotypes of the transgenic receptor parent indica 9311 (WT), mutant ygl9311, and knockout transgenic plant (KO) at seedling stage.
Agronomy 13 00129 g008
Table 1. Primer sequences of SSR markers used in the mapping of ygl9311 locus.
Table 1. Primer sequences of SSR markers used in the mapping of ygl9311 locus.
SSR MarkersForward Primer (5′-3′)Reverse Primer (5′-3′)
RM15177TCCTGTGTTGGACGGAGTATGCGCCTCAGAGGTTAGAAGACAGACAGC
RM15189GGTATCTCCCAGACACACATAGTGGGATTGTCTCCATATCTCAGCATCC
RM15217AAGAACCCACCTGCGGTTAGC CTACAGCTTTCTTGATTCGCTTGG
RM15245AGGATTTACACGCGCTTTGAGCCATCAACGGCAGTAGAAGGTTTCC
RM15303GAATCGGGTCTACGGTTTAGG AAAGGAAGAGAAGAGGCAACG
RM15313GATAAGGACATGGTGTGGTCACGGGCCAACTAAGCACAACAAATACC
RM15355GTAGGAAATTCTTCGCCAGATGCCCGAGACTTGGAACAATCTTAGGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lu, W.; Teng, Y.; He, F.; Wang, X.; Qin, Y.; Cheng, G.; Xu, X.; Wang, C.; Tan, Y. OsChlC1, a Novel Gene Encoding Magnesium-Chelating Enzyme, Affects the Content of Chlorophyll in Rice. Agronomy 2023, 13, 129. https://doi.org/10.3390/agronomy13010129

AMA Style

Lu W, Teng Y, He F, Wang X, Qin Y, Cheng G, Xu X, Wang C, Tan Y. OsChlC1, a Novel Gene Encoding Magnesium-Chelating Enzyme, Affects the Content of Chlorophyll in Rice. Agronomy. 2023; 13(1):129. https://doi.org/10.3390/agronomy13010129

Chicago/Turabian Style

Lu, Wei, Yantong Teng, Fushou He, Xue Wang, Yonghua Qin, Gang Cheng, Xin Xu, Chuntai Wang, and Yanping Tan. 2023. "OsChlC1, a Novel Gene Encoding Magnesium-Chelating Enzyme, Affects the Content of Chlorophyll in Rice" Agronomy 13, no. 1: 129. https://doi.org/10.3390/agronomy13010129

APA Style

Lu, W., Teng, Y., He, F., Wang, X., Qin, Y., Cheng, G., Xu, X., Wang, C., & Tan, Y. (2023). OsChlC1, a Novel Gene Encoding Magnesium-Chelating Enzyme, Affects the Content of Chlorophyll in Rice. Agronomy, 13(1), 129. https://doi.org/10.3390/agronomy13010129

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop