OsChlC1, a Novel Gene Encoding Magnesium-Chelating Enzyme, Affects the Content of Chlorophyll in Rice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials and Inherited Pattern Analysis
2.2. Measurement of Major Agronomic Traits
2.3. Quantitative Analysis of Chlorophyll Content
2.4. Observations of Chloroplast Structure
2.5. Measurement of Total SOD Activity
2.6. Initial Mapping of the Mutant ygl9311 Locus with Genome Re-Sequence
2.7. Fine Mapping of the Mutant ygl9311 Locus and Prediction of Candidate Genes
2.8. Validation of the Function of Candidate Gene
3. Results
3.1. Inheritance Pattern of the ygl9311 Mutant
3.2. Characteristics of the Mutant ygl9311
3.3. Map-Based Cloning of Locus of the Mutant ygl9311
3.4. Validating the Function of OsChlC1
4. Discussion
4.1. Chlorina Phenotype of Mutant ygl9311 Results from the Impaired Photosynthetic Pigment Synthesis
4.2. The Mutation of OsChlC1 Results in Decreased Photosynthetic Pigment Content in ygl9311
4.3. OsChlC1 Is a Novel Mg-Chelatase Gene
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Khan, A.; Jalil, S.; Cao, H.; Tsago, Y.; Sunusi, M.; Chen, Z.; Shi, C.; Jin, X. The Purple Leaf (pl6) Mutation Regulates Leaf Color by Altering the Anthocyanin and Chlorophyll Contents in Rice. Plants 2020, 9, 1477. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, J.; Chen, L.; Meng, X.; Zhen, X.; Liang, Y.; Han, Y.; Li, H.; Zhang, B. Identification and function analysis of yellow-leaf mutant (YX-yl) of broomcorn millet. BMC Plant Biol. 2022, 22, 463. [Google Scholar] [CrossRef]
- Chen, T.; Huang, L.; Wang, M.; Huang, Y.; Zeng, R.; Wang, X.; Wang, L.; Wan, S.; Zhang, L. Ethyl Methyl Sulfonate-Induced Mutagenesis and Its Effects on Peanut Agronomic, Yield and Quality Traits. Agronomy 2020, 10, 655. [Google Scholar] [CrossRef]
- Yan, J.; Sun, P.; Liu, W.; Xie, D.; Wang, M.; Peng, Q.; Sun, Q.; Jiang, B. Metabolomic and Transcriptomic Analyses Reveal Association of Mature Fruit Pericarp Color Variation with Chlorophyll and Flavonoid Biosynthesis in Wax Gourd (Benincasa hispida). Agronomy 2022, 12, 2045. [Google Scholar] [CrossRef]
- Deng, X.-J.; Zhang, H.-Q.; Wang, Y.; He, F.; Liu, J.-L.; Xiao, X.; Shu, Z.-F.; Li, W.; Wang, G.-H.; Wang, G.-L. Mapped clone and functional analysis of leaf-color gene Ygl7 in a rice hybrid (Oryza sativa L. ssp. indica). PLoS ONE 2014, 9, e99564. [Google Scholar] [CrossRef] [Green Version]
- Wan, C.; Li, C.; Ma, X.; Wang, Y.; Sun, C.; Huang, R.; Zhong, P.; Gao, Z.; Chen, D.; Xu, Z.; et al. GRY79 encoding a putative metallo-β-lactamase-trihelix chimera is involved in chloroplast development at early seedling stage of rice. Plant Cell Rep. 2015, 34, 1353–1363. [Google Scholar] [CrossRef]
- Jung, K.-H.; Hur, J.; Ryu, C.-H.; Choi, Y.; Chung, Y.-Y.; Miyao, A.; Hirochika, H.; An, G. Characterization of a rice chlorophyll-deficient mutant using the T-DNA gene-trap system. Plant Cell Physiol. 2003, 44, 463–472. [Google Scholar] [CrossRef] [Green Version]
- Lee, S.; Kim, J.-H.; Yoo, E.-S.; Lee, C.-H.; Hirochika, H.; An, G. Differential regulation of chlorophyll a oxygenase genes in rice. Plant Mol. Biol. 2005, 57, 805–818. [Google Scholar] [CrossRef]
- Wu, Z.; Zhang, X.; He, B.; Diao, L.; Sheng, S.; Wang, J.; Guo, X.; Su, N.; Wang, L.; Jiang, L.; et al. A chlorophyll-deficient rice mutant with impaired chlorophyllide esterification in chlorophyll biosynthesis. Plant Physiol. 2007, 145, 29–40. [Google Scholar] [CrossRef] [Green Version]
- Wang, P.; Gao, J.; Wan, C.; Zhang, F.; Xu, Z.; Huang, X.; Sun, X.; Deng, X. Divinyl chlorophyll(ide) a can be converted to monovinyl chlorophyll(ide) a by a divinyl reductase in rice. Plant Physiol. 2010, 153, 994–1003. [Google Scholar] [CrossRef]
- Zhu, Y.; Yan, P.; Dong, S.; Hu, Z.; Wang, Y.; Yang, J.; Xin, X.; Luo, X. Map-based cloning and characterization of YGL22, a new yellow-green leaf gene in rice (Oryza sativa). Crop Sci. 2020, 61, 529–538. [Google Scholar] [CrossRef]
- Jiang, H.; Li, M.; Liang, N.; Yan, H.; Wei, Y.; Xu, X.; Liu, J.; Xu, Z.; Chen, F.; Wu, G. Molecular cloning and function analysis of the stay green gene in rice. Plant J. 2007, 52, 197–209. [Google Scholar] [CrossRef]
- Kusaba, M.; Ito, H.; Morita, R.; Iida, S.; Sato, Y.; Fujimoto, M.; Kawasaki, S.; Tanaka, R.; Hirochika, H.; Nishimura, M.; et al. Rice NON-YELLOW COLORING1 is involved in light-harvesting complex II and grana degradation during leaf senescence. Plant Cell 2007, 19, 1362–1375. [Google Scholar] [CrossRef] [Green Version]
- Sato, Y.; Morita, R.; Katsuma, S.; Nishimura, M.; Tanaka, A.; Kusaba, M. Two short-chain dehydrogenase/reductases, NON-YELLOW COLORING 1 and NYC1-LIKE, are required for chlorophyll b and light-harvesting complex II degradation during senescence in rice. Plant J. 2007, 57, 120–131. [Google Scholar] [CrossRef]
- Morita, R.; Sato, Y.; Masuda, Y.; Nishimura, M.; Kusaba, M. Defect in non-yellow coloring 3, an α/β hydrolase-fold family protein, causes a stay-green phenotype during leaf senescence in rice. Plant J. 2009, 59, 940–952. [Google Scholar] [CrossRef]
- Yamatani, H.; Sata, Y.; Masuda, Y.; Kato, Y.; Morita, R.; Fukunaga, K.; Nagamura, Y.; Nishimura, M.; Sakamoto, W.; Tanaka, A.; et al. NYC4, the rice ortholog of Arabidopsis THF1, is involved in the degradation of chlorophyll-protein complexes during leaf senescence. Plant J. 2013, 74, 652–662. [Google Scholar] [CrossRef]
- Fang, J.; Chai, C.; Qian, Q.; Li, C.; Tang, J.; Sun, L.; Huang, Z.; Guo, X.; Sun, C.; Liu, M.; et al. Mutations of genes in synthesis of the carotenoid precursors of ABA lead to pre-harvest sprouting and photo-oxidation in rice. Plant J. 2008, 54, 177–189. [Google Scholar] [CrossRef] [Green Version]
- Beale, S.I. Green genes gleaned. Trends Plant Sci. 2005, 10, 309–312. [Google Scholar] [CrossRef]
- Bollivar, D.W. Recent advances in chlorophyll biosynthesis. Photosynth. Res. 2006, 90, 173–194. [Google Scholar] [CrossRef]
- Qiu, N.; Jiang, D.; Wang, X.; Wang, B.; Zhou, F. Advances in the members and biosynthesis of chlorophyll family. Photosynthetica 2019, 57, 974–984. [Google Scholar] [CrossRef]
- Zhang, H.; Liu, L.; Cai, M.; Zhu, S.; Zhao, J.; Zheng, T.; Xu, X.; Zeng, Z.; Niu, J.; Jiang, L.; et al. A point mutation of magnesium chelatase OsCHLI gene dampens the interaction between CHLI and CHLD subunits in rice. Plant Mol. Biol. Rep. 2015, 33, 1975–1987. [Google Scholar] [CrossRef]
- Willows, R.D.; Gibson, L.C.; Kanangara, C.G.; Hunter, C.N.; von Wettstein, D. Three separate proteins constitute the magnesium chelatase of Rhodobacter sphaeroides. Eur. J. Biochem. 1996, 15, 438–443. [Google Scholar] [CrossRef]
- Kannangara, C.G.; Vothknecht, U.C.; Hansson, M.; von Wettstein, D. Magnesium chelatase: Association with ribosomes and mutant complementation studies identify barley subunit Xantha-G as a functional counterpart of Rhodobacter subunit BchD. Mol. Gen. Genet. MGG 1997, 18, 85–92. [Google Scholar] [CrossRef]
- Davison, P.A.; Schubert, H.L.; Reid, J.D.; Iorg, C.D.; Heroux, A.; Hill, C.P.; Hunter, C.N. Structural and biochemical characterization of Gun4 suggests a mechanism for its role in chlorophyll biosynthesis. Biochemistry 2005, 31, 7603–7612. [Google Scholar] [CrossRef]
- Gibson, L.C.; Willows, R.D.; Kannangara, C.G.; von Wettstein, D.; Hunter, C.N. Magnesium-protoporphyrin chelatase of Rhodobacter sphaeroides: Reconstitution of activity by combining the products of the bchH, -I, and -D genes expressed in Escherichia coli. Proc. Natl. Acad. Sci. USA 1995, 92, 1941–1944. [Google Scholar] [CrossRef] [Green Version]
- Sirijovski, N.; Olsson, U.; Lundqvist, J.; Al-Karadaghi, S.; Willows, R.D.; Hansson, M. ATPase activity associated with the magnesium chelatase H-subunit of the chlorophyll biosynthetic pathway is an artefact. Biochem. J. 2006, 400, 477–484. [Google Scholar] [CrossRef] [Green Version]
- Gräfe, S.; Saluz, H.-P.; Grimm, B.; Hänel, F. Mg-chelatase of tobacco: The role of the subunit CHL D in the chelation step of protoporphyrin IX. Proc. Natl. Acad. Sci. USA 1999, 96, 1941–1946. [Google Scholar] [CrossRef] [Green Version]
- Teng, Y.; Ye, L.; He, F.; Chu, W.; Wang, C.; Tan, Y. Expression Analysis of Key Genes of Chlorophyll Synthesis in A Yellow Leaves Mutant of Oryza sativa. Chin. Agric. Sci. Bull. 2017, 33, 30–35. [Google Scholar]
- Lichtenthaler, H.K. [34] Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. Methods Enzymol. 1987, 148, 350–382. [Google Scholar]
- He, F.; Shao, M.; Chen, T.; Wang, C.; Xu, X.; Tan, Y. Knockout of a magnesium chelating enzyme gene in rice using CRISPR-Cas9 system. Fenzi Zhiwu Yuzhong (Mol. Plant Breed.) 2019, 17, 5674–5680. [Google Scholar]
- Pipitone, R.; Eicke, S.; Pfister, B.; Glauser, G.; Falconet, D.; Uwizeye, C.; Pralon, T.; Zeeman, S.C.; Kessler, F.; Demarsy, E. A multifaceted analysis reveals two distinct phases of chloroplast biogenesis during de-etiolation in Arabidopsis. Elife 2021, 10, e62709. [Google Scholar] [CrossRef]
- Sandoval-Ibáñez, O.; Sharma, A.; Bykowski, M.; Borràs-Gas, G.; Behrendorff, J.B.Y.H.; Mellor, S.; Qvortrup, K.; Verdonk, J.C.; Bock, R.; Kowalewska, Ł.; et al. Curvature thylakoid 1 proteins modulate prolamellar body morphology and promote organized thylakoid biogenesis in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 2021, 118, e2113934118. [Google Scholar] [CrossRef]
- Allen, J.F.; de Paula, W.B.; Puthiyaveetil, S.; Nield, J. A structural phylogenetic map for chloroplast photosynthesis. Trends Plant Sci. 2011, 16, 645–655. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Hong, X.; Hu, K.; Wang, Y.; Wang, X.; Du, S.; Li, Y.; Hu, D.; Cheng, K.; An, B.; et al. Impaired Magnesium Protoporphyrin IX Methyltransferase (ChlM) Impedes Chlorophyll Synthesis and Plant Growth in Rice. Front Plant Sci. 2017, 8, 1694. [Google Scholar] [CrossRef] [Green Version]
- Sawicki, A.; Willows, R.D. S-adenosyl-L-methionine:magnesium-protoporphyrin IX O-methyltransferase from Rhodobacter capsulatus: Mechanistic insights and stimulation with phospholipids. Biochem. J. 2007, 406, 469–478. [Google Scholar] [CrossRef] [Green Version]
- Adhikari, N.D.; Froehlich, J.E.; Strand, D.D.; Buck, S.M.; Kramer, D.M.; Larkin, R.M. GUN4-porphyrin complexes bind the ChlH/GUN5 subunit of Mg-Chelatase and promote chlorophyll biosynthesis in Arabidopsis. Plant Cell 2011, 23, 1449–1467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Farmer, D.A.; Brindley, A.A.; Hitchcock, A.; Jackson, P.J.; Johnson, B.; Dickman, M.J.; Hunter, C.N.; Reid, J.D.; Adams, N.B.P. The ChlD subunit links the motor and porphyrin binding subunits of magnesium chelatase. Biochem. J. 2019, 476, 1875–1887. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lundqvist, J.; Elmlund, H.; Wulff, R.P.; Berglund, L.; Elmlund, D.; Emanuelsson, C.; Hebert, H.; Willows, R.D.; Hansson, M.; Lindahl, M.; et al. ATP-induced conformational dynamics in the AAA+ motor unit of magnesium chelatase. Structure 2010, 18, 354–365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jessop, M.; Felix, J.; Gutsche, I. AAA+ ATPases: Structural insertions under the magnifying glass. Curr. Opin. Struct. Biol. 2021, 66, 119–128. [Google Scholar] [CrossRef]
- Miller, J.M.; Enemark, E.J. Fundamental characteristics of AAA+ protein family structure and function. Archaea 2016, 2016, 9294307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koncz, C.; Mayerhofer, R.; Koncz-Kalman, Z.; Nawrath, C.; Reiss, B.; Redei, G.P.; Schell, J. Isolation of a gene encoding a novel chloroplast protein by T-DNA tagging in Arabidopsis thaliana. EMBO J. 1990, 9, 1337–1346. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Li, J.; Yoo, J.H.; Yoo, S.C.; Cho, S.H.; Koh, H.J.; Seo, H.S.; Paek, N.C. Rice Chlorina-1 and Chlorina-9 encode ChlD and ChlI subunits of Mg-chelatase, a key enzyme for chlorophyll synthesis and chloroplast development. Plant Mol. Biol. 2006, 62, 325–337. [Google Scholar] [CrossRef] [PubMed]
SSR Markers | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
RM15177 | TCCTGTGTTGGACGGAGTATGC | GCCTCAGAGGTTAGAAGACAGACAGC |
RM15189 | GGTATCTCCCAGACACACATAGTGG | GATTGTCTCCATATCTCAGCATCC |
RM15217 | AAGAACCCACCTGCGGTTAGC | CTACAGCTTTCTTGATTCGCTTGG |
RM15245 | AGGATTTACACGCGCTTTGAGC | CATCAACGGCAGTAGAAGGTTTCC |
RM15303 | GAATCGGGTCTACGGTTTAGG | AAAGGAAGAGAAGAGGCAACG |
RM15313 | GATAAGGACATGGTGTGGTCACG | GGCCAACTAAGCACAACAAATACC |
RM15355 | GTAGGAAATTCTTCGCCAGATGC | CCGAGACTTGGAACAATCTTAGGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, W.; Teng, Y.; He, F.; Wang, X.; Qin, Y.; Cheng, G.; Xu, X.; Wang, C.; Tan, Y. OsChlC1, a Novel Gene Encoding Magnesium-Chelating Enzyme, Affects the Content of Chlorophyll in Rice. Agronomy 2023, 13, 129. https://doi.org/10.3390/agronomy13010129
Lu W, Teng Y, He F, Wang X, Qin Y, Cheng G, Xu X, Wang C, Tan Y. OsChlC1, a Novel Gene Encoding Magnesium-Chelating Enzyme, Affects the Content of Chlorophyll in Rice. Agronomy. 2023; 13(1):129. https://doi.org/10.3390/agronomy13010129
Chicago/Turabian StyleLu, Wei, Yantong Teng, Fushou He, Xue Wang, Yonghua Qin, Gang Cheng, Xin Xu, Chuntai Wang, and Yanping Tan. 2023. "OsChlC1, a Novel Gene Encoding Magnesium-Chelating Enzyme, Affects the Content of Chlorophyll in Rice" Agronomy 13, no. 1: 129. https://doi.org/10.3390/agronomy13010129
APA StyleLu, W., Teng, Y., He, F., Wang, X., Qin, Y., Cheng, G., Xu, X., Wang, C., & Tan, Y. (2023). OsChlC1, a Novel Gene Encoding Magnesium-Chelating Enzyme, Affects the Content of Chlorophyll in Rice. Agronomy, 13(1), 129. https://doi.org/10.3390/agronomy13010129