Next Article in Journal
Accumulation of Volatile Fatty Acids from Hydrothermally Treated Strawberry Extrudate through Anaerobic Fermentation at Different pH Values
Next Article in Special Issue
Genetic Diversity and Population Structure in Bread Wheat Germplasm from Türkiye Using iPBS-Retrotransposons-Based Markers
Previous Article in Journal
Contrasting Phenotypic Variability of Life-History Traits of Two Feral Populations of Macrolophus pygmaeus (Hemiptera: Miridae) under Two Alternative Diets
Previous Article in Special Issue
Evaluation of In Vitro Morphogenic Response of Triticum urartu, a Donor of Au Genome of Modern Wheat
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Physiological Analysis of Lignification, Anthocyanin Metabolism and Correlated Gene Expression in Red Toona sinensis Buds during Cold Storage

1
Key Laboratory of Plant Resource Conservation and Germplasm Innovation in Mountainous Region (Ministry of Education), College of Life Sciences/Institute of Agrobioengineering, Guizhou University, Guiyang 550025, China
2
Institute of Horticulture, Guizhou Academy of Agricultural Sciences/Horticultural Engineering Technology Research Center of Guizhou, Guiyang 550006, China
3
Faculty of Agronomy, Jilin Agricultural University, Changchun 130118, China
4
Department of Biology, University of British Columbia, Okanagan, Kelowna, BC V1V 1V7, Canada
*
Authors to whom correspondence should be addressed.
Agronomy 2023, 13(1), 119; https://doi.org/10.3390/agronomy13010119
Submission received: 14 November 2022 / Revised: 23 December 2022 / Accepted: 28 December 2022 / Published: 30 December 2022

Abstract

The characteristics of anthocyanin and lignin are important parameters in evaluating the quality of red Toona sinensis buds. Red T. sinensis buds are prone to senescence during postharvest storage, which subsequently affects their quality and sales. However, the mechanism of senescence in red T. sinensis buds under low-temperature conditions remains unclear. In this study, red T. sinensis buds were stored at 4 °C, and their anthocyanin and lignin contents as well as the enzyme activities of PAL (phenylalanine ammonia lyase), 4CL (4-coumarate-CoA ligase), CAD (cinnamyl alcohol dehydrogenase) and POD (peroxidase) were determined at 0, 1, 2 and 3 d after handing. Meanwhile, the cellular structure of postharvest red T. sinensis buds was observed by microscopy. The relative expression of lignin-related and anthocyanin-related genes was analyzed using qRT-PCR. The results show that the anthocyanin content of the leaves was higher than that of the petioles. After 3 d of storage, the anthocyanin content of the leaves was 4.66 times that of the petioles. Moreover, the lignin content of the red T. sinensis buds gradually increased. Compared with 0 d, the lignin content of the leaves and petioles increased by 331.8 and 94.14 mg·g−1, respectively. The enzyme activities of PAL, 4CL, CAD and POD increased during cold storage. The intercellular space and the arrangement of the palisade tissue and sponge tissue in the mesophyll of red T. sinensis buds became smaller and closer, respectively. The secondary cell wall of xylem cells thickened, the number of xylem cells increased, and the arrangement number of the xylem cells became closed in the leaf vein and petioles during red T. sinensis bud storage. The expression levels of anthocyanin-related (Except for TsCHS and TsANS) and lignin-related genes increased during red T. sinensis bud storage and are highly consistent with the accumulation patterns of anthocyanins and lignin. This study may serve as a reference for exploring the molecular mechanisms of senescence, regulating the quality and cultivating new varieties of red T. sinensis buds that have low lignin content but high anthocyanin content after harvest.

1. Introduction

Toona sinensis (A. Juss.) Roem. is a woody perennial deciduous plant belonging to the Meliaceae family [1]. T. sinensis originates from eastern and southeastern Asia and has a long cultivation history that can be traced back for more than 2000 years in China [2]. T. sinensis is classified into two types, namely, red T. sinensis and green T. sinensis, depending on the color of the leaves and petioles [3]. The buds of red T. sinensis are one of the most popular vegetables in China because of their unique aromatic flavor, large amount of oil, and abundance of proteins, amino acids, vitamins, soluble sugar and minerals [4]. Red T. sinensis buds also serve as a Chinese traditional herbal medicine for treating enteritis, dysentery, gastric ulcers, diabetes and cardiovascular diseases [5,6]. Numerous pharmacological studies have demonstrated that the T. sinensis leaf extracts exhibit antioxidant, antineoplastic, antiviral, antibacterial and anti-inflammatory properties [7].
As spring seasonal vegetables, red T. sinensis buds are usually picked before “Guyu” a day that signifies one of the 24 seasonal divisions of the solar year in the traditional Chinese calendar and generally occurs on April 20th or 21st of every year [8]. However, red T. sinensis buds exhibit rapid dehydration, wilting, vigorous breathing and transpiration after picking, and the stem sections are prone to browning. As a result, red T. sinensis buds are particularly difficult to store at room temperature. Thus, the best consumption period of postharvest T. sinensis buds is 1 d to 2 d at room temperature [9]. During storage, the color of red T. sinensis buds gradually changes from red to green, and the buds become lignified, which seriously reduces the quality of the buds and affects their taste [10,11].
Lignin and anthocyanins are important secondary metabolites and most direct indicators of plant aging [12]. Phenylalanine is catalyzed by phenylalanine ammonia lyase (PAL), cinnamate 4-hydroxylase (C4H), 4-coumarate-CoA ligase (4CL) to form coumaroyl-CoA. Subsequently, coumaroyl-CoA is catalyzed by cinnamoyl-CoA reductase (CCR), cinnamyl alcohol dehydrogenase (CAD), hydroxycinnamoyl-CoA shikimate/quinate hydroxycinnamoyl transferase (HCT), p-coumaroyl 3′-hydroxylase (C3′H), caffeoyl-CoA O-methyItransferase (CCoAOMT), ferulate 5-hydroxylase (F5H), caffeic acid O-methyItransferase (COMT), laccase (LAC) to form lignin [13,14,15]. In addition, coumaroyl-CoA is also catalyzed by chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), flavonoid 3′,5′-hydroxylase (F3′5′H), dihydroflavonol 4-reductase (DFR), anthocyanidin synthase (ANS) and anthocyanidin 3-O-glucosyltransferase (3GT) to form anthocyanin [16,17].
Given that red T. sinensis is an endemic woody plant in China, a series of studies on T. sinensis have mainly focused on China. In recent years, research on the storage and preservation of T. sinensis buds, including physical, chemical and biological storage methods has gradually increased, and refrigeration has been found to be the most direct method of storage [18,19,20,21]. To the best of our knowledge, few studies have been made on changes in the lignin and anthocyanin content of red T. sinensis buds during refrigeration. Moreover, the molecular mechanisms by which the lignin and anthocyanin content affect the lignification of red T. sinensis buds during refrigeration remains unknown.
In this study, red T. sinensis buds were picked before “Guyu” and stored at 4 °C in dark conditions. The anthocyanin and lignin contents during refrigeration were then determined along with the enzyme activities of PAL, 4CL, CAD, and POD and the expression levels of lignin-related and anthocyanin-related genes in the leaves and petioles of the red T. sinensis buds. Moreover, changes in xylem cells were observed using paraffin sections. This study provides a theoretical basis for exploring the molecular mechanisms of aging, regulating the quality, and cultivating new varieties of T. sinensis buds with low lignin content after harvest.

2. Materials and Methods

2.1. Plant Material and Experimental Design

Red T. sinensis was planted in Hongguang Village, Banqiao Town, Zhijin County, Guizhou Province (105.71° E, 26.79° N). Buds with consistent color and uniform length (8~10 cm) and had no mechanical damage, pests, or diseases were picked before “Guyu”, then immediately put in an ice box, and stored at 4 °C in the laboratory. The leaves and petioles were collected at 7 a.m. at 0, 1, 2, and 3 d of storage. Portions of the samples were frozen immediately in liquid nitrogen and then stored at −80 °C for RNA extraction and anthocyanin content determination. Some of the samples were dried in an oven at 80 °C to ensure constant weight for lignin content determination. At the same time, the same development stages of leaves and petioles during different storage periods were fixed with an FAA (formalin–acetic acid–alcohol: 70% alcohol 90 mL, formalin 5 mL, glacial acetic acid 5 mL) fixation solution for tissue sectioning experiments. Each experiment was performed using three biological replicates.

2.2. Anthocyanin and Lignin Content Determination

Fresh samples of red T. sinensis buds stored at −80 °C were ground into powder using liquid nitrogen. Not less than 0.5 g powder was then weighed and placed into test tubes, added with 20 mL 0.1% methanol, and extracted for 8 h in dark conditions at room temperature. The extract was filtered using a 0.25 µm filter, and the absorbance was measured at 530, 620 and 650 nm wavelengths using an ultraviolet spectrophotometer (Alpha-1860, Shanghai, China). Finally, the anthocyanin content of the leaves and petioles at different storage periods were determined using the formula: OD = (OD530 nm − OD620 nm) − 0.1(OD650 nm − OD620 nm).
Dried red T. sinensis buds were ground into powder in a clean mortar. The powder was then passed through 30–50 mesh sieve. Eventually, the lignin content of the leaves and petioles was determined and calculated at different storage periods according to the kit instructions (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China).

2.3. Enzyme Activity Determination

The PAL, 4CL, CAD and POD enzyme activities in the leaves and petioles of red T. sinensis buds at different storage periods were determined using kits (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). The reaction time required for the extraction and determination of enzyme activity was adjusted according to the quantity of the plant material.

2.4. Preparation and Histochemical Staining of Paraffin Sections

The same development stages of the leaves and petioles of red T. sinensis buds at different storage periods were fixed with an FAA fixative solution for 24 h and dehydrated using solutions of different ethanol gradients. Paraffin saturation and embedding were then performed. The samples were cut into 4 µm slices using a paraffin sectioning instrument. The sections were then stained with a safranin staining solution and then destained and dehydrated using different ethanol gradients. Finally, the sections were sealed, observed, and photographed.

2.5. Total RNA Extraction and cDNA Synthesis

Total RNA of red T. sinensis buds was extracted using a total RNA extraction kit (Hua Yueyang, Co., Ltd., Beijing, China) based on the manufacturer’s instructions. cDNA was obtained using HiScript® III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme Biotech Co., Ltd., Nanjing, China) according to the operation instructions.

2.6. Real-Time Quantitative PCR Analysis

According to the metabolic pathways of lignin and anthocyanin syntheses, 11 lignin-related (TsPAL, TsC4H, Ts4CL, TsCCR, TsCAD, TsHCT, TsC3′H, TsCOMT, TsF5H, TsCCoAOMT, and TsLAC) and 7 anthocyanin-related (TsCHS, TsCHI, TsF3H, TsF3’5’H, TsDFR, TsANS, and Ts3GT) genes were obtained from the red T. sinensis bud transcriptome database (Supplementary Data S1). Real-time quantitative PCR (RT-qPCR) was conducted to determine the expression levels of the lignin-related genes. Premier 6.0 software was used to design the primers (Table 1). The SYBR Premix Ex Taq (TaKaRa, Dalian, China) and Bio-Rad IQ5 real-time PCR System (Bio-Rad, Hercules, CA, USA) were used for the RT-qPCR experiments. TsActin gene was used as the internal standard. Each reaction set contains three biological replicates. The relative expression data were analyzed using the 2−ΔΔCt method.

2.7. Statistical Analysis

All data significant difference in the text were analyzed using SPSS software by one way ANOVA at 0.05 level.

3. Results

3.1. Changes in Skin Color Anthocyanins and Lignin Contents

As the storage time increased, the leaves of the red T. sinensis buds became dehydrated and wilted, and the color gradually became dull. Moreover, the color of the leaves and petioles of the buds changed from purple to green, with the most prominent color change occurring after 3 d of storage. However, defoliation and browning of the buds were not clearly observed during storage (Figure 1A-I–A-IV).
Lignin and anthocyanin contents are important indices that influence the aging of red T. sinensis buds. The lignin content of the leaves of red T. sinensis buds was lower than that of the petioles at 0 d of storage. During the storage process, the lignin content of the buds gradually increased, with the lignin content of the leaves higher than that of the petioles at 3 d of storage. Moreover, the lignin contents of leaves and petioles at 3 d of storage increased by 331.8 and 94.1 mg·g−1, respectively, compared with those at 0 d of storage (Figure 1B-I).
In this study, the anthocyanin content of the leaves was higher than that of petioles. Then, the anthocyanin content first increased and then decreased in red T. sinensis leaves during storage, and the anthocyanins content first decreased and then after increased in red T. sinensis petioles during storage. After bud storage for 2 d, the anthocyanin content of the leaves reached the maximum value at 0.8 mg·g−1. Meanwhile, the anthocyanin content of petioles reached its peak value of 0.1 mg·g−1 after 0 d storage. In summary, the anthocyanin content of the red T. sinensis buds decreased at 3 d compared with 0 d, and the anthocyanin content of the leaves was 4.66 times higher than that of the petioles when stored at 3 d (Figure 1B-II).

3.2. Analysis of Enzyme Activity of T. sinensis Buds during Storage

PAL, 4CL, CAD and POD are key enzymes in the lignin metabolic pathway, which is closely related to lignin synthesis. The enzyme activities of PAL, 4CL, CAD and POD in the leaves of red T. sinensis buds are higher than those in the petioles. Compared with 0 d, the enzyme activities of PAL, 4CL and POD significantly increased and that of CAD decreased in the leaves of red T. sinensis buds, but the difference was not significant after 3 d of storage. Of these changes, the ones in the 4CL and POD enzyme activities were more obvious, with values 12.6 and 4.9 times higher than those at 0 d storage, respectively. In the petioles, the enzyme activities of 4CL, CAD and POD increased, whereas that of PAL decreased; however, the difference was not significant after storage for 3 d. The changes in the POD enzyme activity were the most conspicuous, with the value increased by 110.5 U·g−1 during storage (Figure 2).

3.3. Anatomical Analysis of Red T. sinensis Buds during Storage

The results of paraffin sectioning show that the upper and lower epidermal cells of the mesophyll of red T. sinensis bud leaves are rectangular and arranged regularly and tightly without intercellular spaces. In addition, the upper epidermal cells are larger than the lower epidermal cells. The upper epidermal cells of the mesophyll became smaller and then larger as the storage time was prolonged, whereas the changes in the lower epidermal mesophyll cells of the leaves of red T. sinensis buds were not prominent. The palisade and sponge tissues in the mesophyll were arranged loosely, and the inter-cellular paces were large in the leaves of red T. sinensis buds stored for 0 d. As the storage time was extended, the palisade and sponge tissues of the leaves gradually became closely arranged (Figure 3A-I–A-IV).
The safranin staining solution can make the lignin in the cell wall appear red: the darker the red color, the higher the lignin content. In this study, the color of the leaf vein and petiole cell wall of the red T. sinensis buds changed from light red to crimson as the storage time increased. The number of xylem cells gradually increased, their arrangement increasingly tightened, and their secondary cell walls slowly ticked in the leaf vein and petiole during storage. In addition, the xylem cells in the leaf vein first became larger and then smaller as the storage time was prolonged, whereas those in the petiole gradually became larger. These results indicated that the xylem cells of the red T. sinensis buds further developed during the storage period. In addition, the transpiration in the leaves was stronger than those in the petioles, leading to the shrinking of the xylem cells of the leaf vein as a result of cell dehydration during storage for 3 d (Figure 3B-I–B-IV and C-I–C-IV).

3.4. Lignin-Related Gene Expression Analysis

The expression levels of lignin-related genes after storage for 0 d under different storage conditions were considered as controls. In the leaves of the red T. sinensis buds, the expression levels of TsPAL, TsHCT, TsC3’H, TsF5H, TsCCoAOMT and TsLAC decreased during refrigeration, whereas those of TsC4H, Ts4CL, TsCCR, TsCAD increased. The expression levels of TsC4H, TsCCR, TsCOMT and TsCCoAOMT reaches their maximum values after storage for 1 d, whereas Ts4CL and TsCAD reached their maximum expression values after 2 d storage.
In the petioles of the red T. sinensis buds, the expression of TsPAL showed a trend of first increasing and then decreasing, and the expression level after 3 d storage was not significant compared with that at 0 d. Meanwhile, the expression levels of TsHCT and TsF5H decreased significantly during storage. As the storage time was prolonged, the expression levels of TsC4H, Ts4CL, TsCCR, TsCAD, TsCOMT and TsLAC increased, and those of TsC4H, TsCCR TsC3′H, TsCOMT, and TsCCoAOMT increased significantly. The expression levels of TsC4H reached a maximum at 2 d storage, the expression levels of TsCOMT reached a maximum value at 1 d storage and the expression levels of Ts4CL, TsCCR, TsCAD, TsC3′H, TsCCoAOMT, and TsLAC reached a maximum value after 3 d of storage.
Meanwhile, the gene expression levels at different tissues showed discrepancies. For example, the gene expression levels of TsC3′H, TsCCoAOMT, and TsLAC of the red T. sinensis buds decreased in the leaves but increased in the petioles of red T. sinensis buds during storage. In conclusion, the expression levels of eight lignin-related genes in the red T. sinensis buds increased and those of three lignin-related genes decreased during storage (Figure 4).

3.5. Anthocyanin-related Gene Expression Analysis

The relative expression levels in the leaves and petioles of red T. sinensis buds were considered as 1 at stored for 0 d. In the leaves, the expression levels of TsCHS, TsCHI, and TsANS were significantly down regulated during storage for 1 d. Meanwhile, the expression level of TsF3H gradually increased during storage and reached a maximum value after storage for 3 d. The general trend of the expression levels of TsF3′5′H and Ts3GT were first increasing and then decreasing, whereas that of TsDFR consisted of an initial decrease, a subsequent increase, and lastly another decrease. The differences in the expression levels of TsF3′5′H, Ts3GT, and TsDFR reached their maximum values after storage for 2 d (Figure 5).
In the petioles, the expression levels of TsCHS, TsF3H, and TsANS were significantly down regulated during storage. The expression levels of TsCHI, TsF3′5′H, and Ts3GT first increased and then decreased whereas that of TsDFR showed an opposite trend. Although the expression levels of TsCHI, TsF3′5′H, TsDFR, and Ts3GT stored for 3 d were higher after 3 d storage than at 0 d, the difference of TsF3′5′H and TsDFR was not significant (Figure 5).
Furthermore, the expression level of anthocyanin-related genes were different in the analyzed tissues. The expression level of TsCHI in the leaves was significantly higher than that in the petioles. Conversely, the expression level of TsF3H in the leaves significantly was higher than that in the petioles. Meanwhile, the expression patterns of the other genes in both the leaves and the petioles were consistent.

4. Discussion

The color changes of red T. sinensis buds are an important factor that affects T. sinensis bud consumption and sales. Anthocyanins are important indicators that influence the color change and quality of red T. sinensis buds [22]. In this study, as the storage time increased, the anthocyanin content of the red T. sinensis buds decreased after 3 d storage. In the early stage of storage of the red T. sinensis buds, the anthocyanin content increased. On the one hand, this increase may be due to the immaturity of the picked red T. sinensis buds, which continued to develop and accumulate nutrients after harvesting. On the other hand, the increase may be due to the low temperature, which can promote the accumulation of anthocyanin. In the late stage of storage, the anthocyanin content of the red T. sinensis buds decreased; this decrease may be related to the aging of the buds. Shi et al. (2022) revealed that a CA (controlled atmosphere) can effectively inhibit the loss of anthocyanin content and alleviate the cell damage and senescence of “Tunisia” soft-seed pomegranate fruits during cold storage [23]. Cecila et al. (2005) showed that the anthocyanin content of ”Oso Grande“ strawberries decreased after storage for 8 d, resulting in bad quality [24]. Moreover, in the current study, the color of the red T. sinensis buds gradually darkened during storage, possibly due to POD activity. High POD activity promotes the synthesis of phenolic substances that contribute to the darkening of red T. sinensis buds [25].
Meanwhile, lignin is an important component of cell walls in plants. It affects the senescence of fruits and vegetables during storage, as has been confirmed in a variety of horticultural crops, such as water bamboo shoots [26], kiwifruit [27], and loquat [28].In the current study, the lignin content of the red T. sinensis buds gradually increased during storage; this increase may be highly correlated with the activity of lignin-related enzymes. The activities of the PAL and POD enzymes and the lignin content of Phullostachys prominens shoot increased during low-temperature storage, and melatonin treatment effectively delayed the aging process by inhibiting the activity of lignin-related enzymes to reduce lignin synthesis [29]. Pan et al. (2013) revealed that the key enzymes in lignin-synthesis (PAL, CAD, PPO, and POD) activities and the lignin content all increased during cold pomelo fruit storage, which caused the granulation of pomelo fruits [30]. Meanwhile, during the low-temperature storage of cabbage, the activities of the 4CL and POD enzymes and the content of lignin increased and resulted in lignification [31]. In the current study, the enzyme activities of PAL, 4CL, CAD, and POD all increased during red T. sinensis bud storage, which promoted the synthesis of lignin, resulted in the gradual thickening of the secondary cell wall of the xylem cells in the leaf veins and petioles, and led to the gradual deepening of the color.
Red T. sinensis buds can perform transpiration after they are picked, transpiration is a process in which water from the plant surface is lost in the form of water vapor (mainly leaves), which can lead to wilting [32]. In this study, the enzyme activities of PAL, 4CL, CAD, and POD increased, indicating that the respiration rate of the red T. sinensis buds was high during storage. This strong respiration caused rapid water loss, which also led to leaf wilting. During water loss, the red T. sinensis buds exhibited a corresponding response and adaptation mechanism. Thus, the palisade and sponge tissues of the mesophyll cells gradually became closely arranged, and the secondary cell wall of the leaf veins and petioles gradually thickened to slow down the rate of water loss to a certain extent.
Numerous functional studies have shown that the up regulated and down regulated expression of lignin-related and anthocyanin-related genes can significantly increase or decrease lignin and anthocyanin content [33,34,35,36]. During the storage of the red T. sinensis buds, the expression levels of anthocyanin-related genes are also related to the anthocyanin synthesis and degradation. Studies on ”Friar“ plum (Prunus salicina) have suggested that the expression levels of anthocyanin-related genes upregulated and lead to increased anthocyanin content during cold storage [37,38]. Moreover, in this study, the expression levels of lignin-related (expect TsHCT and TsF5H) genes increased, which contributed to the synthesis and accumulation of lignin in red T. sinensis buds during storage. This result is consistent with the increased expression levels of lignin-related genes in water bamboo shoots during low-temperature storage, which in turn accelerates lignin synthesis and lignifications in the water shoots [39]. The results are also consistent with the expression levels of lignin-related genes during grape storage, which cause the hardening of the peduncle and the dropping of berries [40]. Lignin is a complex phenolic polymer composed of three monomers, namely of p-coumaryl alcohol, coniferyl alcohol, and sinapyl alcohol. Depending on the monomers present, lignin is classified into three types, namely H-lignin, G-lignin and S-lignin. Dicotyledonous plants mainly contain G-lignin and S-lignin. Moreover, F5H and HCT are critical genes for catalyzing S-lignin synthesis [41,42]. In this study, the expression levels of the TsF5H and TsHCT genes decreased significantly during red T. sinensis bud storage, possibly because the main form of lignin in red T. sinensis buds is G-ligninor because S-lignin was converted to G-lignin during storage. Studies have shown that the coniferyl alcohol monomer can be converted to sinapyl alcohol when the overall lignin content remains unchanged [42]. In addition, the TsF5H and TsHCT genes may have been involved in the synthesis of acids or flavonoids during red T. sinensis bud storage [43].
The model to elucidate the senescence mechanism involved in lignin and anthocyanin metabolism of red T. sinensis buds during storage showed in Figure 6. However, the main forms of lignin in red T. sinensis buds, the conversion of sinapyl alcohol monomers to coniferyl alcohol, and whether or not TsHCT and TsF5H regulate the synthesis of other substances during red T. sinensis bud storage remain to be explored further.

5. Conclusions

The current study also showed that as the storage time increased, the red T. sinensis buds wilted, and the color gradually became darken. Moreover, the anthocyanin content decreased, the lignin content increased, and the enzyme activities of PAL, 4CL, CAD, and POD increased. Furthermore, the palisade and spongy tissues became closely arranged, and the xylem cell wall of the leaf veins and petioles gradually thickened during storage. In addition, the expression levels of lignin-related and anthocyanin-related genes are highly consistent with the changes in lignin and anthocyanin content. These results indicated that the red T. sinensis buds underwent lignification and anthocyanin degradation during cold storage, which resulted in the reduced quality of red T. sinensis buds. This study may serve as a reference for exploring the molecular mechanisms of aging, regulating the quality, and cultivating new varieties of red T. sinensis buds with low lignin content after harvest.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy13010119/s1, Supplementary Data S1: Lignin and anthocyanin biosyntheses related genes sequences.

Author Contributions

Conceptualization, Q.Z. and G.-F.T.; Methodology, Q.Z., X.-L.Z., X.C. and S.-H.Z.; Validation, Q.Z. and G.-F.T.; Data curation and writing—original draft preparation, Q.Z., P.-H.M., G.-F.T. and J.Z.; Writing—review and editing, G.-F.T.; Visualization, Q.Z.; Supervision, G.-F.T. and J.Z.; Project administration, G.-F.T. and P.-H.M.; Funding acquisition. All authors have read and agreed to the published version of the manuscript and agreed to the published version of the manuscript.

Funding

This study was financially supported by Guizhou Academy of Agricultural Sciences Project (Qiannong Keyuan Support [2021] 05; Germplasm Resources of Guizhou Academy of Agricultural Sciences No. [2022] 10); Jilin Agricultural University high level researcher grant 523 (JLAUHLRG20102006); Vegetable System Project of Guizhou (GZCYTX2022-0101); Construction of Guiyang Vegetable Germplasm Resources Research Center (Zhuke contract [2021] No. 5-1).

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Liao, J.W.; Yeh, J.Y.; Lin, Y.C.; Wei, M.M.; Chung, Y.C. Mutagenicity and safety evaluation of water extract of fermented Toona sinensis Roemor leaves. J. Food Sci. 2009, 74, T7–T13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Liao, J.W.; Chung, Y.C.; Yeh, J.Y.; Lin, Y.C.; Lin, Y.G.; Wu, S.M.; Chan, Y.C. Safety evaluation of water extracts of Toona sinensis Roemor leaf. Food Chem. Toxicol. 2007, 45, 1393–1399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Zhao, Q.; Zhong, X.L.; Zhu, S.H.; Wang, K.; Tan, G.F.; Meng, P.H.; Zhang, J. Research advances in Toona sinensis, a traditional Chinese medicinal plant and popular vegetable in China. Diversity 2022, 14, 572. [Google Scholar] [CrossRef] [Scilit]
  4. Shi, G.Y.; Zhao, L.L.; Wang, X.M.; Zhang, L.; Jiang, P.F.; Wang, X.Z.; Wang, Z.G. Dynamic changes in major active substances and volatile components in Toona sinensis leaves during growth. Food Sci. 2022, 43, 276–284. [Google Scholar]
  5. Wang, C.Y.; Lin, K.H.; Yang, C.J.; Tsai, J.R.; Hung, J.Y.; Wang, P.H.; Hsu, H.K.; Huang, M.S. Toona sinensis extracts induced cell cycle arrest and apoptosis in the human lung large cell carcinoma. Kaohsiung J. Med. Sci. 2010, 26, 68–75. [Google Scholar] [CrossRef] [Scilit]
  6. Kakumu, A.; Ninomiya, M.; Efdi, M.; Adfa, M.; Hayashi, M.; Tanaka, K.; Koketsu, M. Phytochemical analysis and antileukemic activity of polyphenolic constituents of Toona sinensis. Bioorg. Med. Chem. Lett. 2014, 24, 4286–4290. [Google Scholar] [CrossRef] [Scilit]
  7. Peng, W.; Liu, Y.J.; Hu, M.B.; Zhang, M.M.; Yang, J.; Liang, F.; Huang, Q.W.; Wu, C.J. Toona sinensis: A comprehensive review on its traditional usages, phytochemisty, pharmacology and toxicology. Rev. Farmacogn. 2019, 29, 111–124. [Google Scholar] [CrossRef] [Scilit]
  8. Lin, S.H.; Chen, C.K.; Luo, H.X. The combined effect of ozone treatment and polyethylene packaging on postharvest quality and biodiversity of Toona sinensis (A. Juss.) M. Roem. Postharvest Biol. Technol. 2019, 154, 1–10. [Google Scholar] [CrossRef] [Scilit]
  9. Lin, S.H.; Chen, C.K.; Zhang, H.J.; Luo, H.X.; Wang, L.Q.; Cui, M.J.; Xu, W.T.; Deng, M.C. Analysis of microbial diversities dynamics of Toona sinensis (A. Juss.) M. Roem treated by three different preservation methods during storage based on next-generation sequencing. Food Res. Dev. 2019, 40, 42–50. [Google Scholar]
  10. Lin, S.H.; Zhang, H.J.; Wang, X.Y.; Ji, H.P.; Luo, H.X.; Deng, C.H. Effects of different concentrations of ozone on non-enzymatic antioxidant activity of Toona sinensis during storage. Stor. Proc. 2022, 22, 15–20. [Google Scholar]
  11. Zhu, Y.Q.; Yuan, H.Y.; Gao, J.; Luo, F.Y.; He, H.Y.; Li, H.J.; Huang, C. Effects of different commercial packaging materials on quality of Chinese Toon MAP storage. Southwest China J. Agric. 2014, 27, 1695–1699. [Google Scholar]
  12. Zhou, G.F.; Sun, X.N.; Zhang, L.P.; Zeng, X.L.; Liu, G.D.; Sheng, O. Lignin metabolism plays an essential role in the formation of corky split vein caused by boron deficiency in ‘Newhall’ navel orange (Citrus sinensis Osb.). Sci. Hortic. 2022, 294, e110763. [Google Scholar] [CrossRef] [Scilit]
  13. Riboulet, C.; Guillaumie, S.; Méchin, V.; Bosio, M.; Pichon, M.; Goffner, D.; Lapierre, C.; Pollet, B.; Lefevre, B.; Martinant, J.P. Kinetics of phenylpropanoid gene expression in maize growing internodes: Relationships with cell wall deposition. Crop Sci. 2009, 49, 211–223. [Google Scholar] [CrossRef] [Scilit]
  14. Vanholme, R.; Cesarino, I.; Rataj, K.; Xiao, Y.G.; Sundin, L.; Goeminne, G.; Kim, H.; Cross, J.; Morreel, K.; Araujo, P.; et al. Caffeoyl shikimate esterase (CSE) is an enzyme in the lignin biosynthetic pathway in Arabidopsis. Science 2013, 341, 1103–1106. [Google Scholar] [CrossRef] [Scilit]
  15. Vanholme, R.; Demedts, B.; Morreel, K.; Ralph, J.; Boerjan, W. Lignin biosynthesis and structure. Plant Physiol. 2010, 153, 895–905. [Google Scholar] [CrossRef] [Scilit]
  16. Wang, L.; Albert, N.W.; Zhang, H.B.; Arathoon, S.; Boase, M.R.; Ngo, H.; Schwinn, K.E.; Davies, K.M.; Lewis, D.H. Temporal and spatial regulation of anthocyanins biosynthesis provide diverse flower colorintensities and patterning in Cymbidium orchid. Planta 2014, 240, 983–1002. [Google Scholar] [CrossRef] [Scilit]
  17. Zeng, S.H.; Wu, M.; Zou, C.Y.; Liu, X.M.; Shen, X.F.; Hayward, A.; Liu, C.Z.; Wang, Y. Comparative analysis of anthocyanins biosynthesis during fruit development in two Lycium species, Physiol. Plant 2014, 150, 505–516. [Google Scholar]
  18. Yang, H.; Mao, W.L.; Zhao, S.H.; Zhao, H.Y.; Zhang, L.; Shi, G.Y.; Wang, X.M.; Wang, Z.G. Effects of controlled freezing point technology combined with the modified humidity packaging on preservation for Toona sinensis. Food Mach. 2017, 33, 121–125. [Google Scholar]
  19. Yang, H.; Zhao, S.H.; Shi, G.Y.; Zhang, L.; Wang, X.M.; Wang, Z.G. Effect of near freezing-point storage on quality and key flavor substances of Toona sinensis bud. Stor. Proc. 2019, 19, 46–52. [Google Scholar]
  20. Bao, L.; Yuan, Y.C. Effects of the fresh-keeping agents on storage characteristic in Chinese Toona. Food Sci. Technol. 2006, 12, 161–163. [Google Scholar]
  21. Diao, C.Y.; Gao, X.R. Fresh-keeping of Toona sinensis sprouts with tea polyphenol combined with chitosan solution. Guihaia 2016, 36, 492–496. [Google Scholar]
  22. Lin, S.H.; Cui, M.J.; Chen, C.K.; Zhang, H.J.; Jia, H.L.; Luo, H.X.; Deng, M.C.; Xu, W.T. Effects of three different preservation methods on volatile flavor components of Toona sinensis during storage. J. Anhui Agric. Uni. 2019, 46, 1062–1068, (In Chinese with English Title and Abstract). [Google Scholar]
  23. Shi, J.L.; Tong, R.R.; Wang, S.; Yao, J.A.; Wei, A.N.; Wang, S.; Wang, M.M.; Wan, R.; Jiao, J.; Zhang, C.L.; et al. Effect of cold controlled atmosphere storage on fruit quality of ‘Tunisia’ soft-seed pomegranate based on principal component analysis. J. Henan Agric. Uni. 2020, 41, 153–160, (In Chinese with English Title and Abstract). [Google Scholar] [CrossRef]
  24. Cecila, N.N.M.; Jeffrey, K.B.; Alcina, M.M.B.M.; Sreve, A.S. Possible influences of water loss and polyphenol oxidase activity on anthocyanins content and discoloration in fresh ripe strawberry (cv. Oso Grabde) during storage at 1 °C. J. Food Sci. 2005, 70, S79–S84. [Google Scholar]
  25. Lee, C.J.; Kim, S.E.; Park, S.I.; Lim, Y.H.; Choi, H.Y.; Kim, W.G.; Ji, C.Y.; Kim, H.S.; Kwak, S.S. Tuberous roots of transgenic sweet potato overexpression IbCAD1 have enhanced low-temperature storage phenotypes. Plant Physiol. Biochem. 2021, 166, 549–557. [Google Scholar] [CrossRef] [Scilit]
  26. Yang, B.Q.; Han, Y.C.; Wu, W.J.; Fang, X.J.; Chen, H.J.; Gao, H.Y. Impact of melatonin application on lignification in water bamboo shoot during storage. Food Chem. X 2022, 13, e100254. [Google Scholar] [CrossRef] [Scilit]
  27. Jiao, J.Q.; Jin, M.J.; Liu, H.; Suo, J.T.; Yin, X.R.; Zhu, Q.G.; Rao, J.P. Application of melatonin in kiwifruit (Actinidia chinensis) alleviated chilling injury during cold storage. Sci. Hortic. 2022, 296, e110876. [Google Scholar] [CrossRef] [Scilit]
  28. Zhang, M.X.; Shi, Y.N.; Liu, Z.M.; Zhang, Y.J.; Yin, X.R.; Liang, Z.H.; Huang, Y.Q.; Grierson, D.; Chen, K.S. An EjbHLH14-EjHB1-EjPRX12 module involved in methyl jasmonate alleviation of low temperature-induced lignin deposition in loquat fruit. J. Exp. Bot. 2022, 73, 1668–1682. [Google Scholar] [CrossRef] [Scilit]
  29. Luo, J.; Suo, J.W.; Zhang, H.; Xuan, L.L.; Ying, Y.Q.; Song, L.L. Effect of melatonin treatment on lignification of Phullostachysprominens shoots during low temperature storage. Sci. Silvae Sin. 2019, 55, 41–49, (In Chinese with English Title and Abstract). [Google Scholar]
  30. Pan, T.F.; Zhu, X.L.; Pan, D.M.; Zeng, Z.X. Effects of low temperature on the relationship between granulation and lignin metabolism in pummelo fruit during storage. Chin. J. Trop. Crops 2013, 34, 710–714, (In Chinese with English Title and Abstract). [Google Scholar]
  31. Song, K.H.; Jia, Z.W.; Chang, J.M.; Sun, M.L.; Zhang, L.B. Lignification induced by ethephon and related gene expression in postharvest flowering Chinese cabbage at low temperature. Acta Hortic. Sin. 2019, 46, 775–783. [Google Scholar]
  32. Rico, D.; Martín-Diana, A.B.; Barat, J.M.; Barry-Ryan, C. Extending and measuring the quality of fresh-cut fruit and vegetables: A review. Trends Food Sci. Technol. 2007, 18, 373–386. [Google Scholar] [CrossRef] [Scilit]
  33. Meng, Y.; Xing, L.L.; Cao, X.H.; Guo, G.Y.; Chai, J.F.; Bei, C.L. Cloning of Ta4CL1 and its function in promoting plant growth and lignin deposition in transgenic Arabidopsis plants. Acta Agric. Sin. 2022, 48, 63–75. [Google Scholar] [CrossRef] [Scilit]
  34. Shi, J.L.; Wang, S.; Wang, L.; Tong, R.R.; Wang, S.; Hu, Q.X.; Wan, R.; Jian, Z.H.; Zheng, X.B.; Chen, Y.H. Comparison analysis of key genes expression and metabolites with differential accumulation in lignin biosynthesis from soft- and hard-seed pomegranates. J. Henan Agric. Uni. 2022, 56, 61–69, (In Chinese with English Title and Abstract). [Google Scholar]
  35. Sun, W.; Meng, X.Y.; Liang, L.J.; Li, Y.Q.; Zhou, T.T.; Cai, X.Q.; Wang, L.; Gao, X. Overexpression of a Freesia hybrida flavonoid 3-O-glycosyltransferase gene, Fh3GT1, enhances transcription of key anthocyanins genes and accumulation of anthocyanins and flavonol in transgenic petunia (Petunia hybrida). In Vitro Cell. Dev. Biol. Plant 2017, 53, 478–488. [Google Scholar] [CrossRef] [Scilit]
  36. Zhou, Z.; Ying, Z.; Wu, Z.G.; Yang, Y.P.; Fu, S.B.; Xu, W.; Yao, L.J.; Zeng, A.P.; Huang, J.; Lan, S.R.; et al. Anthocyanins genes involved in the flower coloration mechanisms of cymbidium kanran. Front. Plant Sci. 2021, 12, e737815. [Google Scholar] [CrossRef] [Scilit]
  37. Li, X.L.; Cheng, Y.D.; Wang, M.; Cui, S.J.; Guan, J.F. Weighted gene coexpression correlation network analysis reveals a potential molecular regulatory mechanism of anthocyanins accumulation under different storage temperatures in ‘Friar’ plum. BMC Plant Biol. 2021, 21, e576. [Google Scholar] [CrossRef] [Scilit]
  38. Xu, R.R.; Wang, Y.B.; Zhao, Z.L.; Qu, G.Q.; Cao, J.K. Transcriptomics integrated with metabolomics reveals underlying mechanisms of cold-induced flesh bleeding in plum (cv. Friar) fruit during storage. Postharvest Biol. Technol. 2022, 192, 112032. [Google Scholar] [CrossRef] [Scilit]
  39. Yang, B.Q.; Fang, X.J.; Han, Y.C.; Liu, R.L.; Chen, H.J.; Gao, H.Y. Analysis of lignin metabolism in water bamboo shoots during storage. Postharvest Biol. Technol. 2022, 192, e111989. [Google Scholar] [CrossRef] [Scilit]
  40. García-Rojas, M.; Meneses, M.; Oviedo, K.; Carrasco, C.; Defilippi, B.; González-Agüero, M.; León, G.; Hinrichsen, P. Exogenous gibberellic acid application induces the overexpression of key genes for pedicel lignification and an increase in berry drop in table grape. Plant Physiol. Biochem. 2018, 126, 32–38. [Google Scholar] [CrossRef] [Scilit]
  41. Hoffmann, L.; Besseau, S.; Geoffroy, P.; Ritzenthaler, C.; Meyer, D.; Lapierre, C.; Pollet, B.; Legrand, M. Silencing of hydroxycinnamoyl-coenzyme A shikimate/quinate hydroxycinnamoyitransferase affects phenylpropanoid biosynthesis. Plant Cell 2004, 16, 1446–1465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Costa, M.A.; Collins, R.E.; Anterola, A.M.; Cochrane, F.C.; Davin, L.B.; Lewis, N.G. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 2003, 64, 1097–1112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Bao, A.D.; Li, Y.L.; Li, X.S.; Zhang, Y.Z.; Liu, G.B.; Zhang, X.L. Identification and expression analysis of lignin synthesis genes F5H and HCT in suspension cells of Glycyrrhiza uralensis. Mol. Plant Breed. 2022, 12, 75–82. [Google Scholar]
Figure 1. Color changes and anthocyanins, lignin and chlorophyll content of red T. sinensis buds during storage. (A-I): Stored red T. sinensis buds for 0 d; (A-II): Stored red T. sinensis buds for 1 d; (A-III): Stored red T. sinensis buds for 2 d; (A-IV): Stored red T. sinensis buds for 3 d; (B-I): Lignin content of red T. sinensis buds during storage; (B-II): Anthocyanin content of red T. sinensis buds during storage. Note: The white arrows in the figure represent the sampling site for observing the paraffin section. Different lowercase letters on the column indicates significant differences among different treatments (p < 0.05).
Figure 1. Color changes and anthocyanins, lignin and chlorophyll content of red T. sinensis buds during storage. (A-I): Stored red T. sinensis buds for 0 d; (A-II): Stored red T. sinensis buds for 1 d; (A-III): Stored red T. sinensis buds for 2 d; (A-IV): Stored red T. sinensis buds for 3 d; (B-I): Lignin content of red T. sinensis buds during storage; (B-II): Anthocyanin content of red T. sinensis buds during storage. Note: The white arrows in the figure represent the sampling site for observing the paraffin section. Different lowercase letters on the column indicates significant differences among different treatments (p < 0.05).
Agronomy 13 00119 g001
Figure 2. Analysis of enzyme activity of T. sinensis buds during storage in lignin metabolic pathways. (A): The PAL activity of red T. sinensis buds during storage; (B): The 4CL activity of red T. sinensis buds during storage; (C): The CAD activity of red T. sinensis buds during storage; (D): The POD activity of red T. sinensis buds during storage. Different lowercase letters on the column indicates significant differences among different treatments (p < 0.05).
Figure 2. Analysis of enzyme activity of T. sinensis buds during storage in lignin metabolic pathways. (A): The PAL activity of red T. sinensis buds during storage; (B): The 4CL activity of red T. sinensis buds during storage; (C): The CAD activity of red T. sinensis buds during storage; (D): The POD activity of red T. sinensis buds during storage. Different lowercase letters on the column indicates significant differences among different treatments (p < 0.05).
Agronomy 13 00119 g002
Figure 3. Mesophyll cell, leaf vein, petiole structure of red T. sinensis buds during storage. (A-I): Mesophyll cell structure of red T. sinensis budsstored for 0 d; (A-II): Mesophyll cell structure of red T. sinensis buds stored for 1 d; (A-III): Mesophyll cell structure of red T. sinensis buds stored for 2 d; (A-IV): Mesophyll cell structure of red T. sinensis buds stored for 3 d; (B-I): Leaf vein structure of red T. sinensis budsstored for 0 d; (B-II): Leaf vein structure of red T. sinensis budsstored for 1 d; (B-III): Leaf vein structure of red T. sinensis budsstored for 2 d; (B-IV): Leaf vein structure of red T. sinensis budsstored for 3 d; (C-I): Petiole structure of red T. sinensis budsstored for 0 d; (C-II): Petiole structure of red T. sinensis budsstored for 1 d; (C-III): Petiole structure of red T. sinensis budsstored for 2 d; (C-IV): Petiole structure of red T. sinensis budsstored for 3 d. Epidermis (Ep), palisade tissue (Pt), sponge tissue (St), xylem (X) were marked in figure.
Figure 3. Mesophyll cell, leaf vein, petiole structure of red T. sinensis buds during storage. (A-I): Mesophyll cell structure of red T. sinensis budsstored for 0 d; (A-II): Mesophyll cell structure of red T. sinensis buds stored for 1 d; (A-III): Mesophyll cell structure of red T. sinensis buds stored for 2 d; (A-IV): Mesophyll cell structure of red T. sinensis buds stored for 3 d; (B-I): Leaf vein structure of red T. sinensis budsstored for 0 d; (B-II): Leaf vein structure of red T. sinensis budsstored for 1 d; (B-III): Leaf vein structure of red T. sinensis budsstored for 2 d; (B-IV): Leaf vein structure of red T. sinensis budsstored for 3 d; (C-I): Petiole structure of red T. sinensis budsstored for 0 d; (C-II): Petiole structure of red T. sinensis budsstored for 1 d; (C-III): Petiole structure of red T. sinensis budsstored for 2 d; (C-IV): Petiole structure of red T. sinensis budsstored for 3 d. Epidermis (Ep), palisade tissue (Pt), sponge tissue (St), xylem (X) were marked in figure.
Agronomy 13 00119 g003
Figure 4. Relative expression level of lignin-related genes of red T. sinensis buds during storage. (A): The expression level of TsPAL in red T. sinensis during storage; (B): The expression level of TsC4H in red T. sinensis during storage; (C): The expression level of Ts4CL in red T. sinensis during storage; (D): The expression level of TsCCR in red T. sinensis during storage; (E): The expression level of TsCAD in red T. sinensis during storage; (F): The expression level of TsHCT in red T. sinensis during storage; (G): The expression level of TsC3’H in red T. sinensis during storage; (H): The expression level of TsCOMT in red T. sinensis during storage; (I): The expression level of TsF5H in red T. sinensis during storage; (J): The expression level of TsCCoAOMT in red T. sinensis during storage; (K): The expression level of TsLAC in red T. sinensis during storage. Different lowercase letters on the column indicates significant differences among different treatments (p < 0.05).
Figure 4. Relative expression level of lignin-related genes of red T. sinensis buds during storage. (A): The expression level of TsPAL in red T. sinensis during storage; (B): The expression level of TsC4H in red T. sinensis during storage; (C): The expression level of Ts4CL in red T. sinensis during storage; (D): The expression level of TsCCR in red T. sinensis during storage; (E): The expression level of TsCAD in red T. sinensis during storage; (F): The expression level of TsHCT in red T. sinensis during storage; (G): The expression level of TsC3’H in red T. sinensis during storage; (H): The expression level of TsCOMT in red T. sinensis during storage; (I): The expression level of TsF5H in red T. sinensis during storage; (J): The expression level of TsCCoAOMT in red T. sinensis during storage; (K): The expression level of TsLAC in red T. sinensis during storage. Different lowercase letters on the column indicates significant differences among different treatments (p < 0.05).
Agronomy 13 00119 g004
Figure 5. Relative expression level of anthocyanins-related genes of red T. sinensis buds during storage. (A): The expression level of TsCHS in red T. sinensis during storage; (B): The expression level of TsCHI in red T. sinensis during storage; (C): The expression level of TsF3H in red T. sinensis during storage; (D): The expression level of TsF3′5′H in red T. sinensis during storage; (E): The expression level of TsDFR in red T. sinensis during storage; (F): The expression level of TsANS in red T. sinensis during storage; (G): The expression level of Ts3GT in red T. sinensis during storage. Different lowercase letters on the column indicates significant differences among different treatments (p < 0.05).
Figure 5. Relative expression level of anthocyanins-related genes of red T. sinensis buds during storage. (A): The expression level of TsCHS in red T. sinensis during storage; (B): The expression level of TsCHI in red T. sinensis during storage; (C): The expression level of TsF3H in red T. sinensis during storage; (D): The expression level of TsF3′5′H in red T. sinensis during storage; (E): The expression level of TsDFR in red T. sinensis during storage; (F): The expression level of TsANS in red T. sinensis during storage; (G): The expression level of Ts3GT in red T. sinensis during storage. Different lowercase letters on the column indicates significant differences among different treatments (p < 0.05).
Agronomy 13 00119 g005
Figure 6. A model to elucidate the senescence mechanism involved in lignin and anthocyanin metabolism of red T. sinensis buds during storage. +: marks the promotion of senescence.
Figure 6. A model to elucidate the senescence mechanism involved in lignin and anthocyanin metabolism of red T. sinensis buds during storage. +: marks the promotion of senescence.
Agronomy 13 00119 g006
Table 1. Primers for RT-qPCR related to anthocyanins and lignin synthesis.
Table 1. Primers for RT-qPCR related to anthocyanins and lignin synthesis.
GeneForward Primer (5′-3′)Reverse Primer (5′-3′)Substance
TsPALCTTGTGAGGATCAACACTCTTCTCAATGTAGGATAGAGGAACCAGATLignin/Anthocyanins
TsC4HCAACTCTATGGTCAATGGAATGGGGAATTGGAGTGTGTAATCTTAGTGLignin/Anthocyanins
Ts4CLCAAAGAGAACCATAGACAAAGAACAACAGCAGCATCAGTGATATTGLignin/Anthocyanins
TsCCRGTAGTAGTTGACGAGACTTGGTTGTATTAAGTGTTGGCTGTAAGAGAGLignin
TsCADGCAACTACTGTAATCTCAGGCTAGCATCATCGGAGAATAACAAGTGLignin
TsHCTAGCAGTTATAGACTCCACAACAGTAAGATCATCCTCAGGCAATCACLignin
TsC3′HCAGATTACGGTCCTCACTATGTTACAGCCTCGTTATGTTGTTGAATGLignin
TsCOMTAGCAGTTATAGACTCCACAACAGTAAGATCATCCTCAGGCAATCACLignin
TsCCoAOMTGTGTTTACACAGGCTACTCTCTCTATCAGCGTCCACGAATATGAAGLignin
TsF5HCACCATAGCCATCAGTTATCTCATACAAGTGTATCAACCTCGTCTCLignin
TsLACGTCACAATTATGCTCGGAGAATGGAGATATGTCTTTCCTGGCTTCALignin
TsCHSAGGATATTGTGGTGGTGGAAGTAGATACATCATCAGACGCTTAACAGAnthocyanins
TsCHIGATAGGAGTGTACTTGGAGGATAGCCTTCAGCATCTGTGTAAATTCCAnthocyanins
TsF3HCCTGATCTAGCACTTGGATTAGTATCTCTATCTGGTCGCCAATATGAnthocyanins
TsF3′5′HCCATAGCCGAACTAATCAGACACGATATGGTAGCCGTTGATCTCACAnthocyanins
TsDFRCAGGAACTGTGGATGTTGAAGAGCAAGAGTTGGTATGACACTGATGAAnthocyanins
TsANSCAAGACACCAACCGACTATACTGCTTCAACACCAAGAGCTAATTCTGAnthocyanins
Ts3GTGTAATCACTTACACCGAATCACTCCAACTTCTATCATGGACGTACAGAAnthocyanins
TsActinGGTCAGAAGGATGCCTATGTTGGGGATTTAGAGGAGCCTCAGTTActin
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, Q.; Zhong, X.-L.; Cai, X.; Zhu, S.-H.; Meng, P.-H.; Zhang, J.; Tan, G.-F. Comparative Physiological Analysis of Lignification, Anthocyanin Metabolism and Correlated Gene Expression in Red Toona sinensis Buds during Cold Storage. Agronomy 2023, 13, 119. https://doi.org/10.3390/agronomy13010119

AMA Style

Zhao Q, Zhong X-L, Cai X, Zhu S-H, Meng P-H, Zhang J, Tan G-F. Comparative Physiological Analysis of Lignification, Anthocyanin Metabolism and Correlated Gene Expression in Red Toona sinensis Buds during Cold Storage. Agronomy. 2023; 13(1):119. https://doi.org/10.3390/agronomy13010119

Chicago/Turabian Style

Zhao, Qian, Xiu-Lai Zhong, Xia Cai, Shun-Hua Zhu, Ping-Hong Meng, Jian Zhang, and Guo-Fei Tan. 2023. "Comparative Physiological Analysis of Lignification, Anthocyanin Metabolism and Correlated Gene Expression in Red Toona sinensis Buds during Cold Storage" Agronomy 13, no. 1: 119. https://doi.org/10.3390/agronomy13010119

APA Style

Zhao, Q., Zhong, X.-L., Cai, X., Zhu, S.-H., Meng, P.-H., Zhang, J., & Tan, G.-F. (2023). Comparative Physiological Analysis of Lignification, Anthocyanin Metabolism and Correlated Gene Expression in Red Toona sinensis Buds during Cold Storage. Agronomy, 13(1), 119. https://doi.org/10.3390/agronomy13010119

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop