Comparative Physiological Analysis of Lignification, Anthocyanin Metabolism and Correlated Gene Expression in Red Toona sinensis Buds during Cold Storage
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material and Experimental Design
2.2. Anthocyanin and Lignin Content Determination
2.3. Enzyme Activity Determination
2.4. Preparation and Histochemical Staining of Paraffin Sections
2.5. Total RNA Extraction and cDNA Synthesis
2.6. Real-Time Quantitative PCR Analysis
2.7. Statistical Analysis
3. Results
3.1. Changes in Skin Color Anthocyanins and Lignin Contents
3.2. Analysis of Enzyme Activity of T. sinensis Buds during Storage
3.3. Anatomical Analysis of Red T. sinensis Buds during Storage
3.4. Lignin-Related Gene Expression Analysis
3.5. Anthocyanin-related Gene Expression Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Liao, J.W.; Yeh, J.Y.; Lin, Y.C.; Wei, M.M.; Chung, Y.C. Mutagenicity and safety evaluation of water extract of fermented Toona sinensis Roemor leaves. J. Food Sci. 2009, 74, T7–T13. [Google Scholar] [CrossRef] [PubMed]
- Liao, J.W.; Chung, Y.C.; Yeh, J.Y.; Lin, Y.C.; Lin, Y.G.; Wu, S.M.; Chan, Y.C. Safety evaluation of water extracts of Toona sinensis Roemor leaf. Food Chem. Toxicol. 2007, 45, 1393–1399. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Zhong, X.L.; Zhu, S.H.; Wang, K.; Tan, G.F.; Meng, P.H.; Zhang, J. Research advances in Toona sinensis, a traditional Chinese medicinal plant and popular vegetable in China. Diversity 2022, 14, 572. [Google Scholar] [CrossRef]
- Shi, G.Y.; Zhao, L.L.; Wang, X.M.; Zhang, L.; Jiang, P.F.; Wang, X.Z.; Wang, Z.G. Dynamic changes in major active substances and volatile components in Toona sinensis leaves during growth. Food Sci. 2022, 43, 276–284. [Google Scholar]
- Wang, C.Y.; Lin, K.H.; Yang, C.J.; Tsai, J.R.; Hung, J.Y.; Wang, P.H.; Hsu, H.K.; Huang, M.S. Toona sinensis extracts induced cell cycle arrest and apoptosis in the human lung large cell carcinoma. Kaohsiung J. Med. Sci. 2010, 26, 68–75. [Google Scholar] [CrossRef] [Green Version]
- Kakumu, A.; Ninomiya, M.; Efdi, M.; Adfa, M.; Hayashi, M.; Tanaka, K.; Koketsu, M. Phytochemical analysis and antileukemic activity of polyphenolic constituents of Toona sinensis. Bioorg. Med. Chem. Lett. 2014, 24, 4286–4290. [Google Scholar] [CrossRef]
- Peng, W.; Liu, Y.J.; Hu, M.B.; Zhang, M.M.; Yang, J.; Liang, F.; Huang, Q.W.; Wu, C.J. Toona sinensis: A comprehensive review on its traditional usages, phytochemisty, pharmacology and toxicology. Rev. Farmacogn. 2019, 29, 111–124. [Google Scholar] [CrossRef]
- Lin, S.H.; Chen, C.K.; Luo, H.X. The combined effect of ozone treatment and polyethylene packaging on postharvest quality and biodiversity of Toona sinensis (A. Juss.) M. Roem. Postharvest Biol. Technol. 2019, 154, 1–10. [Google Scholar] [CrossRef]
- Lin, S.H.; Chen, C.K.; Zhang, H.J.; Luo, H.X.; Wang, L.Q.; Cui, M.J.; Xu, W.T.; Deng, M.C. Analysis of microbial diversities dynamics of Toona sinensis (A. Juss.) M. Roem treated by three different preservation methods during storage based on next-generation sequencing. Food Res. Dev. 2019, 40, 42–50. [Google Scholar]
- Lin, S.H.; Zhang, H.J.; Wang, X.Y.; Ji, H.P.; Luo, H.X.; Deng, C.H. Effects of different concentrations of ozone on non-enzymatic antioxidant activity of Toona sinensis during storage. Stor. Proc. 2022, 22, 15–20. [Google Scholar]
- Zhu, Y.Q.; Yuan, H.Y.; Gao, J.; Luo, F.Y.; He, H.Y.; Li, H.J.; Huang, C. Effects of different commercial packaging materials on quality of Chinese Toon MAP storage. Southwest China J. Agric. 2014, 27, 1695–1699. [Google Scholar]
- Zhou, G.F.; Sun, X.N.; Zhang, L.P.; Zeng, X.L.; Liu, G.D.; Sheng, O. Lignin metabolism plays an essential role in the formation of corky split vein caused by boron deficiency in ‘Newhall’ navel orange (Citrus sinensis Osb.). Sci. Hortic. 2022, 294, e110763. [Google Scholar] [CrossRef]
- Riboulet, C.; Guillaumie, S.; Méchin, V.; Bosio, M.; Pichon, M.; Goffner, D.; Lapierre, C.; Pollet, B.; Lefevre, B.; Martinant, J.P. Kinetics of phenylpropanoid gene expression in maize growing internodes: Relationships with cell wall deposition. Crop Sci. 2009, 49, 211–223. [Google Scholar] [CrossRef]
- Vanholme, R.; Cesarino, I.; Rataj, K.; Xiao, Y.G.; Sundin, L.; Goeminne, G.; Kim, H.; Cross, J.; Morreel, K.; Araujo, P.; et al. Caffeoyl shikimate esterase (CSE) is an enzyme in the lignin biosynthetic pathway in Arabidopsis. Science 2013, 341, 1103–1106. [Google Scholar] [CrossRef]
- Vanholme, R.; Demedts, B.; Morreel, K.; Ralph, J.; Boerjan, W. Lignin biosynthesis and structure. Plant Physiol. 2010, 153, 895–905. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Albert, N.W.; Zhang, H.B.; Arathoon, S.; Boase, M.R.; Ngo, H.; Schwinn, K.E.; Davies, K.M.; Lewis, D.H. Temporal and spatial regulation of anthocyanins biosynthesis provide diverse flower colorintensities and patterning in Cymbidium orchid. Planta 2014, 240, 983–1002. [Google Scholar] [CrossRef]
- Zeng, S.H.; Wu, M.; Zou, C.Y.; Liu, X.M.; Shen, X.F.; Hayward, A.; Liu, C.Z.; Wang, Y. Comparative analysis of anthocyanins biosynthesis during fruit development in two Lycium species, Physiol. Plant 2014, 150, 505–516. [Google Scholar]
- Yang, H.; Mao, W.L.; Zhao, S.H.; Zhao, H.Y.; Zhang, L.; Shi, G.Y.; Wang, X.M.; Wang, Z.G. Effects of controlled freezing point technology combined with the modified humidity packaging on preservation for Toona sinensis. Food Mach. 2017, 33, 121–125. [Google Scholar]
- Yang, H.; Zhao, S.H.; Shi, G.Y.; Zhang, L.; Wang, X.M.; Wang, Z.G. Effect of near freezing-point storage on quality and key flavor substances of Toona sinensis bud. Stor. Proc. 2019, 19, 46–52. [Google Scholar]
- Bao, L.; Yuan, Y.C. Effects of the fresh-keeping agents on storage characteristic in Chinese Toona. Food Sci. Technol. 2006, 12, 161–163. [Google Scholar]
- Diao, C.Y.; Gao, X.R. Fresh-keeping of Toona sinensis sprouts with tea polyphenol combined with chitosan solution. Guihaia 2016, 36, 492–496. [Google Scholar]
- Lin, S.H.; Cui, M.J.; Chen, C.K.; Zhang, H.J.; Jia, H.L.; Luo, H.X.; Deng, M.C.; Xu, W.T. Effects of three different preservation methods on volatile flavor components of Toona sinensis during storage. J. Anhui Agric. Uni. 2019, 46, 1062–1068, (In Chinese with English Title and Abstract). [Google Scholar]
- Shi, J.L.; Tong, R.R.; Wang, S.; Yao, J.A.; Wei, A.N.; Wang, S.; Wang, M.M.; Wan, R.; Jiao, J.; Zhang, C.L.; et al. Effect of cold controlled atmosphere storage on fruit quality of ‘Tunisia’ soft-seed pomegranate based on principal component analysis. J. Henan Agric. Uni. 2020, 41, 153–160, (In Chinese with English Title and Abstract). [Google Scholar] [CrossRef]
- Cecila, N.N.M.; Jeffrey, K.B.; Alcina, M.M.B.M.; Sreve, A.S. Possible influences of water loss and polyphenol oxidase activity on anthocyanins content and discoloration in fresh ripe strawberry (cv. Oso Grabde) during storage at 1 °C. J. Food Sci. 2005, 70, S79–S84. [Google Scholar]
- Lee, C.J.; Kim, S.E.; Park, S.I.; Lim, Y.H.; Choi, H.Y.; Kim, W.G.; Ji, C.Y.; Kim, H.S.; Kwak, S.S. Tuberous roots of transgenic sweet potato overexpression IbCAD1 have enhanced low-temperature storage phenotypes. Plant Physiol. Biochem. 2021, 166, 549–557. [Google Scholar] [CrossRef]
- Yang, B.Q.; Han, Y.C.; Wu, W.J.; Fang, X.J.; Chen, H.J.; Gao, H.Y. Impact of melatonin application on lignification in water bamboo shoot during storage. Food Chem. X 2022, 13, e100254. [Google Scholar] [CrossRef]
- Jiao, J.Q.; Jin, M.J.; Liu, H.; Suo, J.T.; Yin, X.R.; Zhu, Q.G.; Rao, J.P. Application of melatonin in kiwifruit (Actinidia chinensis) alleviated chilling injury during cold storage. Sci. Hortic. 2022, 296, e110876. [Google Scholar] [CrossRef]
- Zhang, M.X.; Shi, Y.N.; Liu, Z.M.; Zhang, Y.J.; Yin, X.R.; Liang, Z.H.; Huang, Y.Q.; Grierson, D.; Chen, K.S. An EjbHLH14-EjHB1-EjPRX12 module involved in methyl jasmonate alleviation of low temperature-induced lignin deposition in loquat fruit. J. Exp. Bot. 2022, 73, 1668–1682. [Google Scholar] [CrossRef]
- Luo, J.; Suo, J.W.; Zhang, H.; Xuan, L.L.; Ying, Y.Q.; Song, L.L. Effect of melatonin treatment on lignification of Phullostachysprominens shoots during low temperature storage. Sci. Silvae Sin. 2019, 55, 41–49, (In Chinese with English Title and Abstract). [Google Scholar]
- Pan, T.F.; Zhu, X.L.; Pan, D.M.; Zeng, Z.X. Effects of low temperature on the relationship between granulation and lignin metabolism in pummelo fruit during storage. Chin. J. Trop. Crops 2013, 34, 710–714, (In Chinese with English Title and Abstract). [Google Scholar]
- Song, K.H.; Jia, Z.W.; Chang, J.M.; Sun, M.L.; Zhang, L.B. Lignification induced by ethephon and related gene expression in postharvest flowering Chinese cabbage at low temperature. Acta Hortic. Sin. 2019, 46, 775–783. [Google Scholar]
- Rico, D.; Martín-Diana, A.B.; Barat, J.M.; Barry-Ryan, C. Extending and measuring the quality of fresh-cut fruit and vegetables: A review. Trends Food Sci. Technol. 2007, 18, 373–386. [Google Scholar] [CrossRef] [Green Version]
- Meng, Y.; Xing, L.L.; Cao, X.H.; Guo, G.Y.; Chai, J.F.; Bei, C.L. Cloning of Ta4CL1 and its function in promoting plant growth and lignin deposition in transgenic Arabidopsis plants. Acta Agric. Sin. 2022, 48, 63–75. [Google Scholar] [CrossRef]
- Shi, J.L.; Wang, S.; Wang, L.; Tong, R.R.; Wang, S.; Hu, Q.X.; Wan, R.; Jian, Z.H.; Zheng, X.B.; Chen, Y.H. Comparison analysis of key genes expression and metabolites with differential accumulation in lignin biosynthesis from soft- and hard-seed pomegranates. J. Henan Agric. Uni. 2022, 56, 61–69, (In Chinese with English Title and Abstract). [Google Scholar]
- Sun, W.; Meng, X.Y.; Liang, L.J.; Li, Y.Q.; Zhou, T.T.; Cai, X.Q.; Wang, L.; Gao, X. Overexpression of a Freesia hybrida flavonoid 3-O-glycosyltransferase gene, Fh3GT1, enhances transcription of key anthocyanins genes and accumulation of anthocyanins and flavonol in transgenic petunia (Petunia hybrida). In Vitro Cell. Dev. Biol. Plant 2017, 53, 478–488. [Google Scholar] [CrossRef]
- Zhou, Z.; Ying, Z.; Wu, Z.G.; Yang, Y.P.; Fu, S.B.; Xu, W.; Yao, L.J.; Zeng, A.P.; Huang, J.; Lan, S.R.; et al. Anthocyanins genes involved in the flower coloration mechanisms of cymbidium kanran. Front. Plant Sci. 2021, 12, e737815. [Google Scholar] [CrossRef]
- Li, X.L.; Cheng, Y.D.; Wang, M.; Cui, S.J.; Guan, J.F. Weighted gene coexpression correlation network analysis reveals a potential molecular regulatory mechanism of anthocyanins accumulation under different storage temperatures in ‘Friar’ plum. BMC Plant Biol. 2021, 21, e576. [Google Scholar] [CrossRef]
- Xu, R.R.; Wang, Y.B.; Zhao, Z.L.; Qu, G.Q.; Cao, J.K. Transcriptomics integrated with metabolomics reveals underlying mechanisms of cold-induced flesh bleeding in plum (cv. Friar) fruit during storage. Postharvest Biol. Technol. 2022, 192, 112032. [Google Scholar] [CrossRef]
- Yang, B.Q.; Fang, X.J.; Han, Y.C.; Liu, R.L.; Chen, H.J.; Gao, H.Y. Analysis of lignin metabolism in water bamboo shoots during storage. Postharvest Biol. Technol. 2022, 192, e111989. [Google Scholar] [CrossRef]
- García-Rojas, M.; Meneses, M.; Oviedo, K.; Carrasco, C.; Defilippi, B.; González-Agüero, M.; León, G.; Hinrichsen, P. Exogenous gibberellic acid application induces the overexpression of key genes for pedicel lignification and an increase in berry drop in table grape. Plant Physiol. Biochem. 2018, 126, 32–38. [Google Scholar] [CrossRef]
- Hoffmann, L.; Besseau, S.; Geoffroy, P.; Ritzenthaler, C.; Meyer, D.; Lapierre, C.; Pollet, B.; Legrand, M. Silencing of hydroxycinnamoyl-coenzyme A shikimate/quinate hydroxycinnamoyitransferase affects phenylpropanoid biosynthesis. Plant Cell 2004, 16, 1446–1465. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Costa, M.A.; Collins, R.E.; Anterola, A.M.; Cochrane, F.C.; Davin, L.B.; Lewis, N.G. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 2003, 64, 1097–1112. [Google Scholar] [CrossRef] [PubMed]
- Bao, A.D.; Li, Y.L.; Li, X.S.; Zhang, Y.Z.; Liu, G.B.; Zhang, X.L. Identification and expression analysis of lignin synthesis genes F5H and HCT in suspension cells of Glycyrrhiza uralensis. Mol. Plant Breed. 2022, 12, 75–82. [Google Scholar]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Substance |
---|---|---|---|
TsPAL | CTTGTGAGGATCAACACTCTTCT | CAATGTAGGATAGAGGAACCAGAT | Lignin/Anthocyanins |
TsC4H | CAACTCTATGGTCAATGGAATGG | GGAATTGGAGTGTGTAATCTTAGTG | Lignin/Anthocyanins |
Ts4CL | CAAAGAGAACCATAGACAAAGAA | CAACAGCAGCATCAGTGATATTG | Lignin/Anthocyanins |
TsCCR | GTAGTAGTTGACGAGACTTGGTT | GTATTAAGTGTTGGCTGTAAGAGAG | Lignin |
TsCAD | GCAACTACTGTAATCTCAGGCTA | GCATCATCGGAGAATAACAAGTG | Lignin |
TsHCT | AGCAGTTATAGACTCCACAACAG | TAAGATCATCCTCAGGCAATCAC | Lignin |
TsC3′H | CAGATTACGGTCCTCACTATGTTA | CAGCCTCGTTATGTTGTTGAATG | Lignin |
TsCOMT | AGCAGTTATAGACTCCACAACAG | TAAGATCATCCTCAGGCAATCAC | Lignin |
TsCCoAOMT | GTGTTTACACAGGCTACTCTCTC | TATCAGCGTCCACGAATATGAAG | Lignin |
TsF5H | CACCATAGCCATCAGTTATCTCA | TACAAGTGTATCAACCTCGTCTC | Lignin |
TsLAC | GTCACAATTATGCTCGGAGAATG | GAGATATGTCTTTCCTGGCTTCA | Lignin |
TsCHS | AGGATATTGTGGTGGTGGAAGTA | GATACATCATCAGACGCTTAACAG | Anthocyanins |
TsCHI | GATAGGAGTGTACTTGGAGGATAG | CCTTCAGCATCTGTGTAAATTCC | Anthocyanins |
TsF3H | CCTGATCTAGCACTTGGATTAGT | ATCTCTATCTGGTCGCCAATATG | Anthocyanins |
TsF3′5′H | CCATAGCCGAACTAATCAGACAC | GATATGGTAGCCGTTGATCTCAC | Anthocyanins |
TsDFR | CAGGAACTGTGGATGTTGAAGAG | CAAGAGTTGGTATGACACTGATGA | Anthocyanins |
TsANS | CAAGACACCAACCGACTATACTG | CTTCAACACCAAGAGCTAATTCTG | Anthocyanins |
Ts3GT | GTAATCACTTACACCGAATCACTC | CAACTTCTATCATGGACGTACAGA | Anthocyanins |
TsActin | GGTCAGAAGGATGCCTATGTTG | GGGATTTAGAGGAGCCTCAGTT | Actin |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, Q.; Zhong, X.-L.; Cai, X.; Zhu, S.-H.; Meng, P.-H.; Zhang, J.; Tan, G.-F. Comparative Physiological Analysis of Lignification, Anthocyanin Metabolism and Correlated Gene Expression in Red Toona sinensis Buds during Cold Storage. Agronomy 2023, 13, 119. https://doi.org/10.3390/agronomy13010119
Zhao Q, Zhong X-L, Cai X, Zhu S-H, Meng P-H, Zhang J, Tan G-F. Comparative Physiological Analysis of Lignification, Anthocyanin Metabolism and Correlated Gene Expression in Red Toona sinensis Buds during Cold Storage. Agronomy. 2023; 13(1):119. https://doi.org/10.3390/agronomy13010119
Chicago/Turabian StyleZhao, Qian, Xiu-Lai Zhong, Xia Cai, Shun-Hua Zhu, Ping-Hong Meng, Jian Zhang, and Guo-Fei Tan. 2023. "Comparative Physiological Analysis of Lignification, Anthocyanin Metabolism and Correlated Gene Expression in Red Toona sinensis Buds during Cold Storage" Agronomy 13, no. 1: 119. https://doi.org/10.3390/agronomy13010119
APA StyleZhao, Q., Zhong, X.-L., Cai, X., Zhu, S.-H., Meng, P.-H., Zhang, J., & Tan, G.-F. (2023). Comparative Physiological Analysis of Lignification, Anthocyanin Metabolism and Correlated Gene Expression in Red Toona sinensis Buds during Cold Storage. Agronomy, 13(1), 119. https://doi.org/10.3390/agronomy13010119