Next Article in Journal
Design and Optimization of a Machine-Vision-Based Complementary Seeding Device for Tray-Type Green Onion Seedling Machines
Next Article in Special Issue
Natural and Artificial Occurrence, Structure, and Abundance of Juglans neotropica Diels in Southern Ecuador
Previous Article in Journal
Effects of a Local Tomato Rootstock on the Agronomic, Functional and Sensory Quality of the Fruit of a Recovered Local Tomato (Solanum lycopersicum L.) Named “Tomate Limachino Antiguo”
Previous Article in Special Issue
Effects of Temperature and Light on the Germination-Promoting Activity by Melatonin in Almond Seeds without Stratification
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 12
Issue 9
10.3390/agronomy12092179
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Characterization of a Plum Landrace Collection from La Palma, Canary Islands

by
Verónica Pérez
1,2,
Javier Rodrigo
3,4,
Donia Abdallah
5,
Nerea Larranaga
6,7 and
José I. Hormaza
7,*
1
Laboratorio de Agrobiología Juan José Bravo Rodríguez (Cabildo de La Palma), Unidad Técnica del Instituto de Productos Naturales y Agrobiología, IPNA-CSIC, 37000 Santa Cruz de La Palma, Spain
2
Instituto de Productos Naturales y Agrobiología, IPNA-CSIC, C/Astrofísico Francisco Sánchez 3, 38206 La Laguna, Tenerife, Canary Islands, Spain
3
Departamento de Ciencia Vegetal, Centro de Investigación y Tecnología Agroalimentaria de Aragón (CITA), Avda. Montañana 930, 50059 Zaragoza, Spain
4
Instituto Agroalimentario de Aragón-IA2 (CITA-Universidad de Zaragoza), 50013 Zaragoza, Spain
5
Département de Biologie, Faculté des Sciences de Tunis, Université Tunis el Manar, Tunis 2092, Tunisia
6
Laboratorio Nacional de Identificación y Caracterización Vegetal (LaniVeg-CONACYT), Departamento de Botánica y Zoología, Universidad de Guadalajara, Zapopan 45200, Mexico
7
Subtropical Fruit Crops Department, IHSM La Mayora-CSIC-UMA, 29750 Algarrobo-Costa, Spain
*
Author to whom correspondence should be addressed.
Agronomy 2022, 12(9), 2179; https://doi.org/10.3390/agronomy12092179
Submission received: 11 August 2022 / Revised: 31 August 2022 / Accepted: 9 September 2022 / Published: 14 September 2022
(This article belongs to the Collection Genetic Diversity Evaluation of the Fruit Trees)
Browse Figures
Versions Notes

Abstract

:
A plum collection located in the island of La Palma, Canary Islands, composed of twenty-nine European and Japanese plums was analyzed using nine simple sequence repeat (SSR) highly polymorphic loci. First, a cytometry flow analysis was performed to determine the ploidy level. Sixteen accessions turned out diploid and thirteen hexaploid. According to morphological characteristics, fourteen of the sixteen diploid accessions were assigned to Prunus salicina, and two accessions to P. cerasifera. All the hexaploid accessions were assigned to P. domestica. The 29 accessions were compared using SSR markers with twenty-two P. domestica accessions maintained at the CITA plum germplasm collection located in Zaragoza, Aragón, Spain. A principal component analysis (PCA) and a clustering approach grouped the accessions according to the assigned species and geographical location, while some synonyms and homonyms were found within La Palma accessions. The two principal components explained 80.3% (67.3% and 13%, respectively) of the total variance. A tree generated with UPGMA hierarchical clustering and Bruvo distance grouped the accessions in two main clusters according to ploidy level and species assignment. The STRUCTURE approach clearly differentiated La Palma diploid accessions and some of the hexaploid accessions from those of the CITA collection. The results obtained could be used for management and conservation purposes of this valuable local plum germplasm.

1. Introduction

Conservation of crop genetic resources is fundamental for future food security [1], since they are the main source for developing new varieties adapted to changing climatic conditions and with better qualities. However, in the last decades, an increase in genetic erosion in different crops caused by changes in land uses, introduction of more productive commercial varieties, the effects of climate change or the arrival of new diseases and pests has been observed. In order to maintain extant diversity, in situ and ex situ conservation strategies have been promoted [2]. In fruit trees, that are usually clonally propagated and where long-time seed conservation is generally difficult, ex situ germplasm cultivar collections are developed to guarantee the conservation of genetic diversity. Collections provide a genetic reservoir for growers and breeders, and an interesting plant material to be studied [2].
This global genetic erosion is even worse in particular situations in which the exchange of plant material is low, such as in the case of islands. One example is the island of La Palma, the northwesternmost island of the Canaries, part of the Macaronesia, a group of five volcanic North Atlantic archipelagos (Azores, Madeira, Savage Islands, Canary Islands and Cabo Verde), which extends from southwestern Europe to northwestern Africa. La Palma is a small island of 705 km2 with elevations ranging from 0 to 2426 m above sea level (Figure 1). As the other Canary Islands, La Palma has a mild climate, without extreme temperatures, due to the influence of the north–northeast (NNE) trade winds and relatively cold ocean waters [3]. This climate favors the cultivation of temperate and subtropical fruit crop species such as peach, almond, plum, mango and avocado, as well as some tropical fruits at the sea level, such as bananas [4]. For centuries, isolation has favored local differentiation or crop diversity due to the limitation of gene flow. However, the crossroad geographical location of the Canary Islands has allowed vegetal material exchanges with other places, such as continental Europe or Central and South America. In fact, after the European arrival to America in 1492, La Palma became the most important harbor in the Canaries in the commercial route between mainland Europe and the New World. As a result, the island presents an interesting diversity of plant materials from diverse origins due to human migration or commercial transfers [5].
Agriculture is the largest source of wealth of La Palma. Since complex mechanization is difficult due to the mountainous nature of the island with a central volcano range, most agricultural production is restricted to small-scale farming in the coastal areas. At the coastal level, around 3000 ha are devoted to banana cultivation, which is mainly exported to continental Europe [4]. Other important crops are grapevine [6] and avocado [7]. In addition, many families have small orchards with fruit trees or vegetables for self-consumption and for sale in local markets. This small-scale agriculture has favored the conservation of local varieties of different crops, which are being studied in the last few years, and the local La Palma authorities have dedicated important resources to preserve and characterize the threatened agronomic heritage of the island. Previous studies have revealed genetic relationships between La Palma local fruit trees with Spanish mainland landraces of almond [8], peach [9], apple [10], chestnut [11] or pear [12], but also exchange with different Latin American countries, mainly Cuba and Venezuela [13,14].
However, no detailed previous studies are available on the diversity of plums in La Palma. Plums comprise a large group of Prunus species, belonging to the family Rosaceae, with hundreds to thousands of years of domestication. Species of plums are mainly self-incompatible [15,16,17,18] with a gametophytic self-incompatibility (GSI) system as other Prunus species. GSI prevents fertilization of the ovules by their own pollen by arresting growth of incompatible pollen tubes in the style [19,20]. Chromosome numbers of plum species range from diploid to hexaploid. P. salicina, P. americana, P. simonii and P. cerasifera are diploid (2n = 6x = 16), P. spinosa is tetraploid (2n = 6x = 32) and P. domestica and P. insititia are hexaploid (2n = 6x = 48) [21]. Polyploidy is widespread in plants and is a mechanism of adaptation and speciation, which usually gives rise to more vigorous plants [22]. However, the complexity of the polyploid genome makes molecular studies more laborious [23,24]. Among plums, the most interesting species from an agronomic perspective are the European (P. domestica; 6x) and the Japanese (P. salicina; 2x) plums [25]. Plums have relevant economic importance and are consumed both as fresh or processed food, in jam, jellies, and for the production of spirits, with a world production over 12 million tons, half of which is concentrated in China [26]. They are grown mainly in Asia, Eastern Europe and South and North America. In Spain, production is over 153 thousand tons [26]. Several plum diversity studies have been carried out, mainly in diploid Japanese plum [27,28,29], but studies are scarcer in plum species with higher ploidy [24,30,31,32,33,34,35,36], probably due to the higher complexity of the analyses.
In order to preserve the genetic resources of plums in La Palma, an ex situ germplasm plum collection was created after a prospection of local cultivated varieties. In this work, we report the characterization of this collection through flow cytometry and molecular marker analysis with microsatellite markers. Both approaches have been widely used in the genus. Thus, ploidy level and cytogenetic studies have been used in Prunus for the characterization of cultivated and wild species [37,38,39,40]. On the other hand, microsatellite markers are one of the most used molecular markers for intraspecies characterization [41], due to advantages as their codominance, polymorphism, reproducibility and neutrality [42]. Microsatellites have been used previously in plums [24,27,28,29,30,31,32,33,34,35,36]. The availability of a European plum collection in mainland Spain (Zaragoza) allowed the comparison of the European plum genotypes conserved in La Palma with those of a broader germplasm collection. The collection in Zaragoza has a high number of “Reine Claude” accessions, including several of the type “Reine Claude Verte”, which is the most appreciated cultivar in this group for its excellent organoleptic qualities, and is the most popular European plum cultivar in many regions of Europe.

2. Materials and Methods

2.1. Plant Material

A total of 51 plum accessions were analyzed in this study. Of those, twenty-nine adult plum trees (P. domestica, P. cerasifera and P. salicina) originated from a germplasm collection in the Granja Experimental de Garafía-Cabildo Insular de La Palma located in La Palma, Canary Islands (X:215870; Y:3190713; UTM:28) at 952 m above sea level. In addition, twenty-two European plums (P. domestica) were included, all of them [32] except “Stanley”, “Ruth Gestteter”, “Polinizador Zuera” and “Fraila” belonging to the Reine Claude type from the Spanish germplasm collection of CITA in Zaragoza (Spain).

2.2. Flow Cytometry Analysis

To better discriminate between the 29 diploid and hexaploid selected individuals of the La Palma plum collection, flow cytometry analysis was performed [39,40]. Young leaves were collected and put in plastic bags with moist cotton until ploidy was analyzed with flow cytometer following [43]. For that, the leaves were chopped (0.5 cm2 pieces) with a sharp razor blade and deposited into a buffer solution designed for nuclei extraction (CyStain® UV Precise T Kit; Sysmex, Norderstedt, Germany). The crude solution was filtered with a nylon filter with a pore size of 30 µm and stained with an aqueous solution of 4′,6-diamidino-2-fenylindole. They were then analyzed with a Cyflow® PA flow cytometer (Sysmex), and DNA content was quantified relative to 2C DNA content from the tomato cultivar Moneymaker.

2.3. DNA Extraction and PCR Amplification

DNA extraction was performed from silica-gel-dried young leaves following a modified cetyltrimethylammonium bromide (CTAB) method for Prunus [44], using an extraction buffer with 350 mM Sorbitol, 100 mM Tris-HCl, 6.4 mM EDTA and 0.1% NaHSO3 pH 7.5, and a nuclei lysis buffer with 200 mM Tris-HCl, 64 mM EDTA, 2 M NaCl, 2% CTAB and 5% N-lauryl sarcosine. Genomic DNA was amplified with nine SSR loci developed in peach and cherry, due to the transferability of these markers between Prunus species [45,46] and previously being used in European plum [32] (Table 1). PCR amplification was performed with 16 mM (NH4)2SO4, 67 mM Tris-HCl pH 8.8, 0.01% Tween-20, 20.3 mM MgCl2, 0.1 mM of each dNTP, 0.3 µM of each primer, 20 ng of genomic DNA and 1 unit of BioTaqTM DNA polymerase (Bioline, London, UK) in a final volume of 15 µL. Forward primers were labelled with WellRed fluorescent dyes on the 5′ end (Sigma-Aldrich, St. Louis, MO, USA). Reactions were carried out on a thermocycler (Bio-Rad Laboratories, Hercules, CA, USA) using the following temperature profile: an initial step of 2 min at 94 °C, 35 cycles of 45 s at 94 °C, 45 s at 57 °C, 1 min at 72 °C and a final step of 5 min at 72 °C. PCR products were separated by capillary electrophoresis on a CEQTM 8000 capillary DNA analysis system (Beckman Coulter, Fullerton, CA, USA).

2.4. Population Genetic Structure

SSR results were analyzed with the R package POLYSAT [50]. Samples were archived in three groups according to their origin and ploidy: diploid La Palma (16 accessions), with 14 P. salicina samples and two P. cerasifera from La Palma; hexaploid La Palma (13 accessions), with La Palma P. domestica landraces; and hexaploid CITA (22 accessions) with P. domestica accessions of the ex situ collection in mainland Spain, including 14 landraces and 8 commercial cultivars. Principal component analysis (PCA) based on pairwise Bruvo distance was performed and represented in R with the package factoextra [51]. In addition, a UPGMA dendrogram based on the pairwise Bruvo distance matrix was constructed, plotted with the same R package and edited with FigTree software [52]. POLYSAT data files were exported to STRUCTURE [53] and SPAGeDi [54] appropriate formats. The samples were ordered according to the UPGMA dendrogram results to run the Bayesian clustering algorithm implemented in STRUCTURE [53], using 20 interactions of 200,000 Markov Chain Monte Carlo (MCMC) generations with a burn-in period of 20,000 generations [55] for K from 2 to 7. The interactions were combined using the large K greedy algorithm from the program CLUMPAK [56] that was used also for graphic representation.

2.5. Genetic Diversity Analyses

Genetic diversity indices for intra- and intergroups were calculated with SPAGeDi [54], which allows the analysis of polyploid species. The following parameters were estimated: number of alleles per locus (NA), average of effective number of alleles (Nae), expected heterozygosity (He), observed heterozygosity (Ho) and inbreeding coefficient (Fi). In addition, statistic pairwise indexes between groups were estimated with the ANOVA approach: measure of population differentiation (intraclass kinship coefficient) (Fst) [57], intraclass relatedness coefficient (Rho) [58] and Fst analogue based on allele size (Rst) [59,60].

3. Results

3.1. Species Discrimination by Ploidy Level

The flow cytometry results showed two ploidy levels in the 29 La Palma local plum samples analyzed; 16 accessions were diploid, and 13 accessions were hexaploid (Table 2); this and fruit and leaf phenotypic analyses (data not shown) allowed to establish that 14 accessions corresponded to P. salicina (2n), two to P. cerasifera (2n) and 13 to P. domestica (6n).

3.2. Genetic Grouping

In order to study the relation between the accessions and the initially established groups, a principal component analysis (PCA) was performed. The two principal components explained 80.3% (67.3% and 13%, respectively) of the total variance, allowing to clearly separate the two species according to ploidy level. The accessions of P. salicina were located on the left of the PCA figure (Figure 2), while accessions of P. domestica were located on the right. Many P. domestica accessions from La Palma, mainly “Agustina” and “Verde” types were overlapping with samples from the CITA collection. The two P. cerasifera samples, called “Morada”, appeared at one end of the polygon that included all the diploid genotypes.
A tree generated with UPGMA hierarchical clustering and Bruvo distance grouped the accessions into two main clusters (Figure 3) according to ploidy level and species assignment. The first one included all the hexaploid accessions and could be subdivided into two groups: one with all the Reine Claude type P. domestica accessions from CITA and only one sample from La Palma, “Verde 27”; in this main group, the Reine Claude Verte accessions from CITA clustered together, except “RCV F-4 A-4” and “RCV Verde” that grouped together but with the other Reine Claude group. The second cluster grouped all the rest of the hexaploid P. domestica accessions from La Palma, and three samples from CITA (“Polinizador Zuera”, “Stanley” and “Fraila”) that are not “Reine Claude” types. All the La Palma diploid samples were placed in the second main group, which could be divided into two groups. One cluster included “Morada 61” and “Negra1_35”, which are indistinguishable at the molecular level and probably are synonyms, and “Pastosa 43”, “Agustina negra 17” and “de Catela 39”. The second group included several synonymies under the common name of “Blanca japonesa”, “Amarilla secona 57”, “Rojizo 64”, “Negra2_45”, “Roja 42” and “Japonesa amarilla antigua 53”. Among this group, the samples that showed the higher distance were the two accessions named Morada, “Morada 70” and “Morada 23”, name given because of their purple leaves (Morada means “purple” in Spanish) and were considered as P. cerasifera.
The STRUCTURE results considering K = 3 (colored bar in Figure 3) showed a clear differentiation between the hexaploid and diploid groups. However, in the hexaploid groups of P. domestica, the Reine Claude Verte accessions were separated. La Palma accessions and several accessions from CITA, with some Reine Claude (RC), grouped together.
When the K value increased (K = 4) (Figure 4), a new group appeared with only “Huevo chivato” accessions, which showed short Bruvo distances among them both in the dendrogram and PCA, and “Stanley” and “Polinizador Zuera”. With K = 5, P. domestica accessions of La Palma were separated from those of the CITA collection, while for higher K values the groups remained similar.

3.3. SSR Polymorphisms and Molecular Characterization

The average number of alleles per loci was the highest for the hexaploid CITA genotypes (10.56), followed by the hexaploid La Palma samples (9.33), and the lowest (6.89) for the diploid La Palma group (Table 3). However, the effective number of alleles was the highest for the hexaploid La Palma group (7.07), followed by the hexaploid CITA samples (5.91) and the diploid La Palma population (4.31). The expected heterozygosity was also the highest for the hexaploid La Palma group (0.85), followed by the hexaploid CITA samples (0.795) and the diploid La Palma accessions (0.76). However, the observed heterozygosity was the highest for the hexaploid CITA samples (0.935), followed by the diploid La Palma accessions (0.88) and the hexaploid La Palma samples (0.74). The Fi index was positive for La Palma accessions: 0.015 for diploid and 0.018 for hexaploidy plums, and negative (−0.027) for CITA samples. Statistics for pairwise Fst, Rho and Rst showed larger values between the hexaploid CITA and diploid La Palma groups, followed by the pair hexaploid and diploid La Palma accessions; the pair with the lowest differentiation was the two hexaploid groups (Table 4).

4. Discussion

4.1. Ploidy Level and Species Assignment

As a first step, the ploidy level of all the accessions from La Palma was analyzed, and the accessions were split in two groups: diploid and hexaploid. The diploid accessions were assigned to P. salicina (Japanese plum) and P. cerasifera, whereas the hexaploid accessions were assigned to P. domestica (European plum), taking also into account the morphological characteristics observed. Microsatellite markers (SSR) confirmed the ploidy level obtained by the cytometry assay and helped confirm the data and species taxonomy as shown in previous works [24,33]. Ploidies higher than 2n make the molecular analysis more complex [35], and the results are more ambiguous [34], hindering the interpretation of the multiple alleles per locus. In hexaploid species, a single locus can present up to six different alleles. When the number of alleles observed is lower than six, it is not possible, with the methodology used, to recognize those that are repeated. In any case, with the approach followed in this work, it was possible to unequivocally assign each of the accessions studied to its corresponding species.

4.2. Genetic Diversity and Population Structure

The PCA corroborated the differentiation between the two plum species, and a partial overlap was observed between the European plum accessions from La Palma and CITA. This mixture was also obtained with the STRUCTURE analysis for K = 3 and K = 4. These two groups were even more clearly separated in the dendrogram obtained with UPGMA using Bruvo distance. Only one accession from La Palma, “Verde 27”, grouped with the CITA Reine Claude accessions and probably it could correspond to a Reine Claude type introduced from the Spain mainland. Previous studies of genetic diversity of temperate fruit crops in the Canary Islands, including La Palma, have established the origin of some of them, such as peach, apple or chestnut, in the Iberian Peninsula [9,10,11], so it is very likely that most of the plums of La Palma have a similar origin. However, in those works, some of the Canarian accessions showed some unique alleles compared to the accessions from the Iberian Peninsula, which could be due to sampling bias or to the introduction of genotypes from other origins [6,9], as it has been shown for other crops such as potato [13] or cauliflower [61].
The genetic indexes showed endogamy within La Palma plum samples in both hexaploid and diploid accessions. This is an expected result according to previous works in other species, due to the small size and the isolation of the territory [9,61] and the reduced input of plant material. A lower inbreeding value was observed in the European plums from CITA, a collection that includes accessions from a larger geographical area. However, relatively low genetic diversity has been reported across cultivated plums in other regions [62].

4.3. Relations between La Palma Plum Accessions

Hexaploid samples from la Palma formed a group close to the group of the “Reine Claude” plums from the Spanish mainland collection, with the exception of “Verde 27”, which grouped within the “Reine Claude” samples, suggesting that this could indeed be a Reine Claude type. In the hexaploid group of La Palma, three of the four plums from CITA that were not Reine Claude type, “Fraila”, “Stanley” and “Polinizador Zuera” were included. The three accessions of “Huevo Chivato” showed zero or little distance among them (null alleles in two accessions for one locus UDP96-005), which could indicate a case of synonymy. This has also been found in other works with plums due to the graft propagation of interesting cultivars [34]. Several “Reine Claudia Verte” accessions from the CITA collection showed the same SSR profile although they could be distinguished at the morphological level [32]. In this same branch, an Agustina accession, “Agustina 10”, was also present, whereas the rest of the samples of this variety grouped together in a nearby branch, a possible case of homonymy. The rest of La Palma hexaploid plums showed unique genotypes that allowed their unequivocal differentiation. It should be noted that the La Palma plum collection was made after intense ethnobotanical work, and only those trees that showed different morphological and pomological characteristics were conserved in the ex situ collection. Since the SSR markers and some accessions from the CITA collection were the same as those used by Gharbi et al. (2014) [32], the relation between the CITA accessions was similar to the one in that work, except that in our work, more accessions could be unequivocally discriminated. This can be explained by the fact that in Gharbi et al. (2014) [32] the separation of DNA amplification products was made by electrophoresis in metaphor agarose gels, while in this study, capillary electrophoresis, which offers better resolution, was used. Indeed, some of the “Reine Claude Verte” accessions that are synonyms are likely to have been vegetatively propagated, whereas those that are slightly different could represent seedlings.
In the diploid La Palma accessions, two main branches were obtained. In a first branch with five accessions, “Morada 61” and “Negra1_35” were indistinguishable, which could be a case of synonymy. Actually, the local name Morada, like the Morada used to assign P. cerasifera species, is a homonymy that produces confusion since Morada in Spanish refers to purple color, a frequent case in plum fruits. Other accessions present in this group include “Pastosa 43”, “Agustina negra 17” and “De Catela 39”. The local name Agustina is usually associated in La Palma with European plums, but in this case the accession is a Japanese plum. Plums of different geographic origins in the island named “Blanca japonesa” and “Blanca cumplida 11” were undistinguishable, probably indicating another case of synonymy.

4.4. Genetic Erosion and Conservation of La Palma Plums

This work contributes to improving the characterization of local La Palma plum accessions following previous works focused on the recovery of landraces, establishment, and maintenance of germplasm banks in other fruit tree crop species, such as almond [8], peach [9] or chestnut [11]. The combination of ploidy analyses with microsatellite molecular marker studies allowed to assign each accession to the corresponding species and study the diversity of the collection, revealing some synonyms and homonyms. Although the results showed low diversity, this collection is an important germplasm resource because the plums of La Palma are adapted to warm conditions, which could serve as a reservoir for plum breeders in the current context of global climate change. Small territories such as islands are threatened by genetic erosion [63] as a result of natural inbreeding or human activities, such as changes in land use, increase in tourism or implementation of a few commercial new varieties, among others.
In this work, La Palma local plum accessions have been characterized using molecular markers. A comparison of La Palma samples with a Spanish local plum collection provided information about the relationship between them. The results showed that the most possible origin of most of the local plums from La Palma is the Iberian Peninsula. The abandonment of the cultivation of local landraces in La Palma and other islands in the Canaries makes its conservation necessary to preserve interesting genetic resources to optimize fruit production in the current context of climate change. The results obtained in this work will be relevant to optimize the conservation of plum genetic resources in La Palma, and similar works can be performed in other islands of the Macaronesia in order to preserve singular genotypes for future generations.

Author Contributions

Conceptualization, V.P. and J.I.H.; lab experiments V.P. and D.A.; data curation and analysis, V.P. and N.L.; data interpretation and writing of the manuscript V.P.; J.R., N.L. and J.I.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by projects PID2019-109566RB-I00 and PID2020-115473RR-I00 funded by MCIN/AEI and ERDF A way to make Europe (MCIN/AEI/10.13039/501100011033). V.P. was supported by a Cabildo Insular de La Palma-CSIC postdoc contract, and N.L. was supported by a post-doctoral stay financed by CONACYT (Mexico).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Acknowledgments

We thank Sonia Cívico and Yolanda Verdún for technical assistance. We also thank CAP (Centro de Agrodiversidad de La Palma-Cabildo Insular de La Palma), especially Neftalí Castro.

Conflicts of Interest

The authors declare no conflict of interests. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Khoury, C.K.; Bjorkman, A.D.; Dempewolf, H.; Ramirez-Villegas, J.; Guarino, L.; Jarvis, A.; Rieseberg, L.H.; Struik, P.C. Increasing homogeneity in global food supplies and the implications for food security. Proc. Natl. Acad. Sci. USA 2014, 111, 4001–4006. [Google Scholar] [CrossRef] [PubMed]
  2. Maxted, N.; Hunter, D.; Ortíz, R. Whole Plant, Plantlet and DNA Conservation. In Plant Genetic Conservation; Cambridge University Press: Cambridge, UK, 2020; pp. 368–390. [Google Scholar] [CrossRef]
  3. Hernández, Y.; Pereira, Â.G.; Barbosa, P. Resilient futures of a small island: A participatory approach in Tenerife (Canary Islands) to address climate change. Environ. Sci. Policy 2018, 80, 28–37. [Google Scholar] [CrossRef] [PubMed]
  4. Rodríguez-Hernández, Á.; Díaz-Díaz, R.; Zumbado, M.; Bernal- Suárez, M.D.M.; Acosta-Dacal, A.; Macías-Montes, A.; Travieso-Aja, M.D.M.; Rial-Berriel, C.; Hernández-Hernández, L.A.; Boada, L.D.; et al. Impact of chemical elements released by the volcanic eruption of La Palma (Canary Islands, Spain) on banana agriculture and European consumers. Chemosphere 2022, 293, 133508. [Google Scholar] [CrossRef] [PubMed]
  5. Galán-Saúco, V.; Cubero, J.I. Contribution of Spain and Portugal to the exchange and acclimatization of new and old world crops. Acta Hortic. 2011, 916, 71–82. [Google Scholar] [CrossRef]
  6. Marsal, G.; Méndez, J.J.; Mateo, J.M.; Ferrer, S.; Canals, J.M.; Zamora, F.; Fort, F. Molecular characterization of Vitis vinifera L. local cultivars from volcanic areas (Canary Islands and Madeira) using SSR markers. Oeno One 2019, 53, 667–680. [Google Scholar] [CrossRef]
  7. Rodríguez-Padrón, C.; Siverio, F.; Pérez-Sierra, A.; Rodríguez, A. Isolation and pathogenicity of Phytophthora species and Phytopythium vexans recovered from avocado orchards in the Canary Islands, including Phytophthora niederhauserii as a new pathogen of avocado. Phytopathol. Mediterr. 2018, 57, 89–106. [Google Scholar] [CrossRef]
  8. Padilla, G.; Ordás, A. Molecular characterization of almond accessions from the island of La Palma (Canary Islands, Spain) using SSR markers. Plant Genet. Resour. 2014, 12, 323–329. [Google Scholar] [CrossRef]
  9. Pérez, V.; Larrañaga, N.; Abdallah, D.; Wünsch, A.; Hormaza, J.I. Genetic diversity of local peach (Prunus persica) accessions from La Palma island (Canary Islands, Spain). Agronomy 2020, 10, 457. [Google Scholar] [CrossRef]
  10. Pereira-Lorenzo, S.; Ramos-Cabrer, A.M.; González-Díaz, A.J.; Díaz-Hernández, M.B. Genetic assessment of local apple cultivars from La Palma, Spain, using simple sequence repeats (SSRs). Sci. Hortic. 2008, 117, 160–166. [Google Scholar] [CrossRef]
  11. Pereira-Lorenzo, S.; Costa, R.M.L.; Ramos-Cabrer, A.M.; Ciordia-Ara, M.; Ribeiro, C.A.M.; Borges, O.; Barreneche, T. Chestnut cultivar diversification process in the Iberian Peninsula, Canary Islands, and Azores. Genome 2011, 54, 301–315. [Google Scholar] [CrossRef]
  12. Velázquez-Barrera, M.E.; Ramos-Cabrer, A.M.; Pereira-Lorenzo, S.; Ríos-Mesa, D.J. Genetic pool of the cultivated pear tree (Pyrus spp.) in the Canary Islands (Spain), studied using SSR molecular markers. Agronomy 2022, 12, 1711. [Google Scholar] [CrossRef]
  13. De Galarreta, J.I.R.; Barandalla, L.; Ríos, D.J.; López, R.; Ritter, E. Genetic relationships among local potato cultivars from Spain using SSR markers. Genet. Resour. Crop Evol. 2011, 58, 383–395. [Google Scholar] [CrossRef]
  14. Parrilla-González, M.; Rios-Mesa, D.; Méndez-Hernández, C.; Hernández-González, J.Z.; Fernández-Galván, D.; Hernández-Delgado, P.M.; Galán-Saúco, V. Preliminary study of the seedling avocado (Persea americana Mill.) population of Tenerife. Acta Hortic. 2012, 928, 81–86. [Google Scholar] [CrossRef]
  15. Abdallah, D.; Baraket, G.; Pérez, V.; Ben Mustapha, S.; Salhi-Hannachi, A.; Hormaza, J.I. Analysis of self-incompatibility and genetic diversity in diploid and hexaploid plum genotypes. Front. Plant Sci. 2019, 10, 896. [Google Scholar] [CrossRef] [PubMed]
  16. Sapir, G.; Stern, R.A.; Shafir, S.; Goldway, M. Full compatibility is superior to semi-compatibility for fruit set in Japanese plum (Prunus salicina Lindl.) cultivars. Sci. Hortic. 2008, 116, 394–398. [Google Scholar] [CrossRef]
  17. Guerra, M.E.; López-Corrales, M.; Wünsch, A. Improved S-genotyping and new incompatibility groups in Japanese plum. Euphytica 2012, 186, 445–452. [Google Scholar] [CrossRef]
  18. Guerra, M.E.; Guerrero, B.I.; Casadomet, C.; Rodrigo, J. Self-(in) compatibility, S-RNase allele identification, and selection of pollinizers in new Japanese plum-type cultivars. Sci. Horti. 2020, 261, 109022. [Google Scholar] [CrossRef]
  19. Socas i Company, R.S.; Kodad, O.; Fernández i Martí, A.; Alonso, J.M. Mutations conferring self-compatibility in Prunus species: From deletions and insertions to epigenetic alterations. Sci. Hortic. 2015, 192, 125–131. [Google Scholar] [CrossRef]
  20. Fernandez i Marti, A.; Castro, S.; DeJong, T.M.; Dodd, R.S. Evaluation of the S-locus in Prunus domestica, characterization, phylogeny and 3D modelling. PLoS ONE 2021, 16, e0251305. [Google Scholar] [CrossRef]
  21. Zohary, D.; Hopf, M.; Weiss, E. Domestication of Plants in the Old World: The Origin and Spread of Cultivated Plants in West Asia, Europe and the Nile Valley, 4th ed.; Oxford University Press: New York, NY, USA, 2012; pp. 140–142. [Google Scholar]
  22. Comai, L. The advantages and disadvantages of being polyploid. Nat. Rev. Genet. 2005, 6, 836–846. [Google Scholar] [CrossRef]
  23. Dufresne, F.; Stift, M.; Vergilino, R.; Mables, B.K. Recent progress and challenges in population genetics of polyploid organisms: An overview of current state-of-the-art molecular and statistical tools. Mol. Ecol. 2014, 23, 40–69. [Google Scholar] [CrossRef] [PubMed]
  24. Gaši, F.; Sehic, J.; Grahic, J.; Hjeltnes, S.H.; Ordidge, M.; Benedikova, D.; Blouin-Delmas, M.; Drogoudi, P.; Giovannini, D.; Höfer, M.; et al. Genetic assessment of the pomological classification of plum Prunus domestica L. accessions sampled across Europe. Genet. Resour. Crop Evol. 2020, 67, 1137–1161. [Google Scholar] [CrossRef]
  25. Faust, M.; Timon, B.; Surányi, D.; Nyujtó, F.; Gradziel, T.M. Origin and Dissemination of Prunus Crops: Peach, Cherry, Apricot, Plum and Almond; Janick, J., Ed.; Horticultural Reviews; Gent-Oostakker: Leuven, Belgium, 2011; Volume 17, 241p. [Google Scholar]
  26. FAOSTAT. Available online: https://www.fao.org/faostat/es/#data/QCL (accessed on 25 May 2022).
  27. Acuña, C.V.; Rivas, J.G.; Brambilla, S.M.; Cerrillo, T.; Frusso, E.A.; García, M.N.; Villalba, P.V.; Aguirre, N.C.; Sabio y García, J.V.; Martínez, M.C.; et al. Characterization of genetic diversity in accessions of Prunus salicina lindl: Keeping fruit flesh color ideotype while adapting to water stressed environments. Agronomy 2019, 9, 487. [Google Scholar] [CrossRef]
  28. Guerrero, B.I.; Guerra, M.E.; Herrera, S.; Irisarri, P.; Pina, A.; Rodrigo, J. Genetic diversity and population structure of Japanese plum-Type (hybrids of P. salicina) accessions assessed by SSR markers. Agronomy 2021, 11, 1748. [Google Scholar] [CrossRef]
  29. Guerrero, B.I.; Guerra, M.E.; Rodrigo, J. Simple Sequence Repeat (SSR)-based genetic diversity in interspecific plumcot-type (Prunus salicina × Prunus armeniaca) hybrids. Plants 2022, 11, 1241. [Google Scholar] [CrossRef]
  30. Decroocq, V.; Hagen, L.S.; Favé, M.G.; Eyquard, J.P.; Pierronnet, A. Microsatellite markers in the hexaploid Prunus domestica species and parentage lineage of three European plum cultivars using nuclear and chloroplast simple-sequence repeats. Mol. Breed. 2004, 13, 135–142. [Google Scholar] [CrossRef]
  31. Horvath, A.; Balsemin, E.; Barbot, J.C.; Christmann, H.; Manzano, G.; Reynet, P.; Laigret, F.; Mariette, S. Phenotypic variability and genetic structure in plum (Prunus domestica L.), cherry plum (P. cerasifera Ehrh.) and sloe (P. spinosa L.). Sci. Hortic. 2011, 129, 283–293. [Google Scholar] [CrossRef]
  32. Gharbi, O.; Wünsch, A.; Rodrigo, J. Characterization of accessions of ‘Reine Claude Verte’ plum using Prunus SRR and phenotypic traits. Sci. Hortic. 2014, 169, 57–65. [Google Scholar] [CrossRef]
  33. Halapija Kazija, D.; Jelačić, T.; Vujević, P.; Milinović, B.; Čiček, D.; Biško, A.; Pejić, I.; Šimon, S.; Žulj Mihaljević, M.; Pecina, M.; et al. Plum germplasm in Croatia and neighboring countries assessed by microsatellites and DUS descriptors. Tree Genet. Genomes 2014, 10, 761–778. [Google Scholar] [CrossRef]
  34. Sehic, J.; Nybom, H.; Hjeltnes, S.H.; Gaši, F. Genetic diversity and structure of Nordic plum germplasm preserved ex situ and on-farm. Sci. Hortic. 2015, 190, 195–202. [Google Scholar] [CrossRef]
  35. Urrestarazu, J.; Errea, P.; Miranda, C.; Santesteban, L.G.; Pina, A. Genetic diversity of Spanish Prunus domestica L. germplasm reveals a complex genetic structure underlying. PLoS ONE 2018, 13, e0195591. [Google Scholar] [CrossRef]
  36. Manco, R.; Chiaiese, P.; Basile, B.; Corrado, G. Comparative analysis of genomic-and EST-SSRs in European plum (Prunus domestica L.): Implications for the diversity analysis of polyploids. 3 Biotech 2020, 10, 543. [Google Scholar] [CrossRef] [PubMed]
  37. Tamarzizt, H.B.; Walker, D.; Mustapha, S.B.; Abdallah, D.; Baraket, G.; Hannachi, A.S.; Azzouzi, S.Z. DNA variation and polymorphism in Tunisian plum species (Prunus spp.): Contribution of flow cytometry and molecular markers. Genet. Mol. Res. 2015, 14, 18034–18046. [Google Scholar] [CrossRef] [PubMed]
  38. Žabka, M.; Ďurišová, Ľ.; Eliáš, P.; Baranec, T. Genome size and ploidy level among wild and cultivated Prunus taxa in Slovakia. Biologia 2018, 73, 121–128. [Google Scholar] [CrossRef]
  39. Nzweundji, J.G.; Ngwe, M.F.S.N.; Siljak-Yakovlev, S. Insights on cytogenetic of the only strict African representative of genus Prunus (P. africana): First genome size assessment, heterochromatin and rDNA chromosome pattern. Caryologia 2019, 72, 9–19. [Google Scholar] [CrossRef]
  40. Głowacka, A.; Sitarek, M.; Rozpara, E.; Podwyszyńska, M. Pomological Characteristics and Ploidy Levels of Japanese Plum (Prunus salicina Lindl.) Cultivars Preserved in Poland. Plants 2021, 10, 884. [Google Scholar] [CrossRef]
  41. Larranaga, N.; Hormaza, J.I. Advances in Genetic Diversity Analysis in Fruit Tree crops. In Progress in Botany 77; Lüttge, U., Cánovas, F., Matyssek, R., Eds.; Springer: Cham, Switzerland, 2016; Volume 77, pp. 245–264. [Google Scholar] [CrossRef]
  42. Varshney, R.K.; Graner, A.; Sorrells, M.E. Genomics-assisted breeding for crop improvement. Trends Plant Sci. 2005, 10, 621–630. [Google Scholar] [CrossRef] [PubMed]
  43. Martín, C.; Viruel, M.A.; Lora, J.; Hormaza, J.I. Polyploidy in fruit tree crops of the genus Annona (Annonaceae). Front. Plant Sci. 2019, 10, 99. [Google Scholar] [CrossRef]
  44. Hormaza, J.I. Molecular characterization and similarity relationships among apricot (Prunus armeniaca L.) genotypes using simple sequence repeats. Theor. Appl. Genet. 2002, 104, 321–328. [Google Scholar] [CrossRef]
  45. Wünsch, A. Cross-transferable polymorphic SSR loci in Prunus species. Sci. Hortic. 2009, 120, 348–352. [Google Scholar] [CrossRef]
  46. Mnejja, M.; Garcia-Mas, J.; Audergon, J.M.; Arús, P. Prunus microsatellite marker transferability across rosaceous crops. Tree Genet. Genomes 2010, 6, 689–700. [Google Scholar] [CrossRef]
  47. Dirlewanger, E.; Cosson, P.; Tavaud, M.; Aranzana, M.J.; Poizat, C.; Zanetto, A.; Arus, P.; Laigret, F. Development of microsatellite markers in peach [Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry (Prunus avium L.). Theor. Appl. Genet. 2002, 105, 127–138. [Google Scholar] [CrossRef] [PubMed]
  48. Struss, D.; Boritzki, M.; Karle, R.; Iezzoni, A.F. Microsatellite markers differentiate eight Giessen cherry rootstocks. HortScience 2002, 37, 191–193. [Google Scholar] [CrossRef]
  49. Cipriani, G.; Lot, G.; Huang, W.G.; Marrazzo, M.T.; Peterlunger, E.; Testolin, R. AC/GT and AG/CT microsatellite repeats in peach Prunus persica (L.) Batsch: Isolation characterisation and cross-species amplification in Prunus. Theor. Appl. Genet. 1999, 9, 65–72. [Google Scholar] [CrossRef]
  50. Clark, L.V.; Jasieniuk, M. POLYSAT: An R package for polyploid microsatellite analysis. Mol. Ecol. Resour. 2011, 11, 562–566. [Google Scholar] [CrossRef]
  51. Kassambara, A.; Mundt, F. Factoextra: Extract and Visualize the Results of Multivariate Data Analyses. R Package Version 1.0.7. 2020. Available online: https://CRAN.R-project.org/package=factoextra (accessed on 12 September 2022).
  52. FigTree, Version 1.4.4. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 12 September 2022).
  53. Hubisz, M.J.; Falush, D.; Stephens, M.; Pritchard, J.K. Inferring weak population structure with the assistance of sample group information. Mol. Ecol. Resour. 2009, 9, 1322–1332. [Google Scholar] [CrossRef]
  54. Hardy, O.J.; Vekemans, X. SPAGeDi: A versatile computer program to analyse spatial genetic structure at the individual or population levels. Mol. Ecol. Notes 2002, 2, 618–620. [Google Scholar] [CrossRef]
  55. Martín, C.; Herrero, M.; Hormaza, J.I. Molecular characterization of apricot germplasm from an old stone collection. PLoS ONE 2011, 6, e23979. [Google Scholar] [CrossRef] [Green Version]
  56. Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. CLUMPAK: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef]
  57. Weir, B.S.; Cockerham, C.C. Estimating F-statistics for the analysis of population structure. Evolution 1984, 38, 1358–1370. [Google Scholar] [CrossRef]
  58. Ronfort, J.; Jenczewski, E.; Bataillon, T.; Rousset, F. Analysis of population structure in autotetraploid species. Genetics 1998, 150, 921–930. [Google Scholar] [CrossRef] [PubMed]
  59. Slatkin, M. A measure of population subdivision based on microsatellite allele frequencies. Genetics 1995, 139, 457–462. [Google Scholar] [CrossRef]
  60. Michalakis, Y.; Excoffier, L.A. Genetic estimation of population subdivision using distances between alleles with special reference for microsatellite loci. Genetics 1996, 142, 1061–1064. [Google Scholar] [CrossRef] [PubMed]
  61. Tortosa, M.; Velasco, P.; Afonso, D.; Padilla, G.; Ríos, D.; Soengas, P. Characterization of a Spanish Brassica oleracea collection by using molecular and biochemical markers. Sci. Hortic. 2017, 219, 344–350. [Google Scholar] [CrossRef]
  62. Zhebentyayeva, T.; Shankar, V.; Scorza, R.; Callahan, A.; Ravelonandro, M.; Castro, S.; DeJong, T.; Saski, C.A.; Dardick, C. Genetic characterization of worldwide Prunus domestica (plum) germplasm using sequence-based genotyping. Hortic. Res. 2019, 6, 12. [Google Scholar] [CrossRef]
  63. Lebot, V. Coping with insularity: The need for crop genetic improvement to strengthen adaptation to climatic change and food security in the Pacific. Environ. Dev. Sustain. 2013, 15, 1405–1423. [Google Scholar] [CrossRef]
Agronomy 12 02179 g001 550
Figure 1. (A,B) Location of La Palma within the Canary Islands and in relation to mainland Spain; (C) location of Granja Experimental de Garafía-Cabildo Insular de La Palma plum collection; (D) photography of La Palma plum collection during the blooming season.
Figure 1. (A,B) Location of La Palma within the Canary Islands and in relation to mainland Spain; (C) location of Granja Experimental de Garafía-Cabildo Insular de La Palma plum collection; (D) photography of La Palma plum collection during the blooming season.
Agronomy 12 02179 g001
Agronomy 12 02179 g002 550
Figure 2. PCA based on Bruvo pairwise distance matrix. Diploid species (diploid LP plums) are in red. Hexaploid species of Prunus domestica are in green (hexaploid LP plums) and blue (hexaploid CITA plums). Accessions correspond to abbreviations in Table 1.
Figure 2. PCA based on Bruvo pairwise distance matrix. Diploid species (diploid LP plums) are in red. Hexaploid species of Prunus domestica are in green (hexaploid LP plums) and blue (hexaploid CITA plums). Accessions correspond to abbreviations in Table 1.
Agronomy 12 02179 g002
Agronomy 12 02179 g003 550
Figure 3. Bruvo-UPGMA cluster analysis based on nine SSR loci in plum species. Groups are indicated with colors: CITA hexaploid plums (Prunus domestica) in orange, La Palma hexaploid plums (P. domestica) in green and La Palma diploid plums (P. salicina and P. cerasifera) in purple and red, respectively. On the right, STRUCTURE results for K = 3 are shown.
Figure 3. Bruvo-UPGMA cluster analysis based on nine SSR loci in plum species. Groups are indicated with colors: CITA hexaploid plums (Prunus domestica) in orange, La Palma hexaploid plums (P. domestica) in green and La Palma diploid plums (P. salicina and P. cerasifera) in purple and red, respectively. On the right, STRUCTURE results for K = 3 are shown.
Agronomy 12 02179 g003
Agronomy 12 02179 g004 550
Figure 4. Bar plot of Prunus species inferred from Bayesian cluster STRUCTURE-CLUMPAK analyzed with Q = 20 repetitions for K = 2 to K = 7.
Figure 4. Bar plot of Prunus species inferred from Bayesian cluster STRUCTURE-CLUMPAK analyzed with Q = 20 repetitions for K = 2 to K = 7.
Agronomy 12 02179 g004
Table
Table 1. SSR loci analyzed in this study.
Table 1. SSR loci analyzed in this study.
SSR LocusForwardReverseReference
BPPCT-002TCGACAGCTTGATCTTGACCCAATGCCTACGGAGATAAAAGAC[47]
BPPCT-007TCATTGCTCGTCATCAGCCAGATTTCTGAAGTTAGCGGTA[47]
BPPCT-010AAAGCACAGCCCATAATGCGTACTGTTACTGCTGGGAATGC[47]
BPPCT-012ACTTCCATTGTCAGGCATCAGGAGCAACGATGGAGTGC[47]
BPPCT-028TCAAGTTAGCTGAGGATCGCGAGCTTGCCTATGAGAAGACC[47]
PMS3TGGACTTCACTCATTTCAGAGAACTGCAGAGAATTTCACAACCA[48]
UDP96-005GTAACGCTCGCTACCACAAACACCCAGCTCATACACCTCA[49]
UDP96-008TTGTACACACCCTCAGCCTGTGCTGAGGTTCAGGTGAGTG[49]
UDP98-409GCTGATGGGTTTTATGGTTTTCCGGACTCTTATCCTATCAACA[49]
Table
Table 2. List of 51 accessions used in this study from La Palma (LP) and CITA in Zaragoza (CITA) collections, with accession name, abbreviation name, locality of prospection, collection of origin, ploidy level analyzed using flow cytometry and assigned species.
Table 2. List of 51 accessions used in this study from La Palma (LP) and CITA in Zaragoza (CITA) collections, with accession name, abbreviation name, locality of prospection, collection of origin, ploidy level analyzed using flow cytometry and assigned species.
AccessionAbbreviationLocalityCollectionPloidySpecies
Agustina negra 17 1AN17PuntagordaLPDiploidP. salicina
Amarilla secona 57 1AS57GarafíaLPDiploidP. salicina
Blanca punta cumplida 11 1BPC11GarafíaLPDiploidP. salicina
Blanca japonesa 2 1BJ2PuntallanaLPDiploidP. salicina
Blanca japonesa 15 1BJ15MazoLPDiploidP. salicina
Blanca japonesa 21 1BJ21Breña AltaLPDiploidP. salicina
De Catela 39 1DC39GarafíaLPDiploidP. salicina
Japonesa amarilla antigua 53 1JAA53GarafíaLPDiploidP. salicina
Morada 23 1MR23PuntallanaLPDiploidP. cerasifera
Morada 61 1MR61GarafíaLPDiploidP. salicina
Morada 70 1MR70GarafíaLPDiploidP. cerasifera
Negra1_35 1N35PuntallanaLPDiploidP. salicina
Negra2_45 1N45PuntallanaLPDiploidP. salicina
Pastosa 43 1P43GarafíaLPDiploidP. salicina
Roja 42 1R42GarafíaLPDiploidP. salicina
Rojizo 64 1RZ64GarafíaLPDiploidP. salicina
Agustina 10 1A10GarafíaLPHexaploidP. domestica
Agustina 52 1A52GarafíaLPHexaploidP. domestica
Agustina blanca 32 1AB32PuntagordaLPHexaploidP. domestica
Agustina blanca 50 1AB50GarafíaLPHexaploidP. domestica
Blanca del país 38 1BP38GarafíaLPHexaploidP. domestica
Huevo chivato 8 1HC8GarafíaLPHexaploidP. domestica
Huevo chivato 19 1HC19PuntagordaLPHexaploidP. domestica
Huevo chivato 58 1HC58GarafíaLPHexaploidP. domestica
Mulata 4 1ML4GarafíaLPHexaploidP. domestica
Mulata 25 1ML25GarafíaLPHexaploidP. domestica
Negra 5 1N5GarafíaLPHexaploidP. domestica
Negra del país pequeña 67 1NPP67TijarafeLPHexaploidP. domestica
Verde 27 1V27GarafíaLPHexaploidP. domestica
RC Arandana 2RCA CITA P. domestica
RC Bavay 2RCB CITA P. domestica
RC Dorada 2RCD CITA P. domestica
RC Doullins 2RCDL CITA P. domestica
RC President 2RCP CITA P. domestica
RCV Alcor 1 1RCVA1 CITA P. domestica
RCV Alcor 2 1RCVA2 CITA P. domestica
RCV Aniñon 1RCVAN CITA P. domestica
RCV Arenal 1RCVAR CITA P. domestica
RCV Conde 1RCVC CITA P. domestica
RCV Domingo 1RCVD CITA P. domestica
RCV F-4 A-4 1RCVF4 CITA P. domestica
RCV F-9 A-10 1RCVF9 CITA P. domestica
RCV Puente Ave 1RCVPA CITA P. domestica
RCV Río Ribazo1 1RCVR1 CITA P. domestica
RCV Río Ribazo2 1RCVR2 CITA P. domestica
RCV Tobed 1RCVT CITA P. domestica
RCV Verde 2RCVV CITA P. domestica
Fraila 1FR CITA P. domestica
Polinizador Zuera 1PZ CITA P. domestica
Ruth Gestteter 2RG CITA P. domestica
Stanley 2STL CITA P. domestica
1 Landrace; 2 commercial variety; RC = Reine Claude; RCV = Reine Claude Verte.
Table
Table 3. Diversity indices for La Palma diploid accessions and La Palma and CITA hexaploid accessions. Number of alleles per locus (NA), average of effective number of alleles (NAe), expected heterozygosity (He), observed heterozygosity (Ho) and inbreeding coefficient (Fi).
Table 3. Diversity indices for La Palma diploid accessions and La Palma and CITA hexaploid accessions. Number of alleles per locus (NA), average of effective number of alleles (NAe), expected heterozygosity (He), observed heterozygosity (Ho) and inbreeding coefficient (Fi).
Diversity Index
nNANAeARHeHoFi
Diploid La Palma166.894.316.890.760.880.015
Hexaploid La Palma139.337.078.550.850.740.018
Hexaploid CITA2210.565.918.180.7950.935−0.027
Table
Table 4. Statistics for pairwise groups differences. Measure of population differentiation (intraclass kinship coefficient) (Fst), intraclass relatedness coefficient (Rho) and Fst analogue based on allele size (Rst), all with the ANOVA approach.
Table 4. Statistics for pairwise groups differences. Measure of population differentiation (intraclass kinship coefficient) (Fst), intraclass relatedness coefficient (Rho) and Fst analogue based on allele size (Rst), all with the ANOVA approach.
Statistic for Pairwise
FstRhoRst
Dipl. LPHex. LPHex. CITADipl. LPHex. LPHex. CITADipl. LPHex. LPHex. CITA
Dipl. LP-0.1660.220-0.3460.469-0.0450.116
Hex. LP0.166-0.0670.346-0.2280.045-0.050
Hex. CITA0.2200.067-0.4690.228-0.1160.050-
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Pérez, V.; Rodrigo, J.; Abdallah, D.; Larranaga, N.; Hormaza, J.I. Genetic Characterization of a Plum Landrace Collection from La Palma, Canary Islands. Agronomy 2022, 12, 2179. https://doi.org/10.3390/agronomy12092179

AMA Style

Pérez V, Rodrigo J, Abdallah D, Larranaga N, Hormaza JI. Genetic Characterization of a Plum Landrace Collection from La Palma, Canary Islands. Agronomy. 2022; 12(9):2179. https://doi.org/10.3390/agronomy12092179

Chicago/Turabian Style

Pérez, Verónica, Javier Rodrigo, Donia Abdallah, Nerea Larranaga, and José I. Hormaza. 2022. "Genetic Characterization of a Plum Landrace Collection from La Palma, Canary Islands" Agronomy 12, no. 9: 2179. https://doi.org/10.3390/agronomy12092179

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop