Next Article in Journal
Phytoremediation of Soil Contaminated with Heavy Metals via Arbuscular Mycorrhiza (Funneliformismosseae) Inoculation Ameliorates the Growth Responses and Essential Oil Content in Lavender (Lavandula angustifolia L.)
Previous Article in Journal
Toxic Impact of Soil Microplastics (PVC) on Two Weeds: Changes in Growth, Phenology and Photosynthesis Efficiency
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Endophytic Fungi Accelerate Leaf Physiological Activity and Resveratrol Accumulation in Polygonum cuspidatum by Up-Regulating Expression of Associated Genes

1
College of Horticulture and Gardening, Yangtze University, Jingzhou 434025, China
2
Shiyan Academy of Agricultural Sciences, Shiyan 442000, China
3
College of Biology and Food Engineering, Chongqing Three Gorges University, Chongqing 404120, China
4
Pharmacy Faculty, Hubei University of Chinese Medicine, Wuhan 430065, China
5
Agrobiology and Bioresources Department, School of Agriculture, Utsunomiya University, 350 Mine-machi, Utsunomiya 321-8505, Tochigi, Japan
6
Botany and Microbiology Department, College of Science, King Saud University, Riyadh 11451, Saudi Arabia
7
Plant Production Department, College of Food and Agricultural Sciences, King Saud University, Riyadh 11451, Saudi Arabia
*
Author to whom correspondence should be addressed.
Agronomy 2022, 12(5), 1220; https://doi.org/10.3390/agronomy12051220
Submission received: 17 March 2022 / Revised: 5 May 2022 / Accepted: 18 May 2022 / Published: 19 May 2022
(This article belongs to the Special Issue Mycorrhizal Fungi Mediated Sustainable Crop Production)

Abstract

Polygonum cuspidatum Sieb. et Zucc. is a major raw material for the extraction of drugs such as resveratrol, while the over-exploitation of P. cuspidatum decreases the yield and drug components. The purpose of this study was to analyze the effect of inoculation with root endophytic fungi Funneliformis mosseae and Piriformospora indica singly or in combination in biomass production, physiological activities (e.g., chlorophyll, soluble protein, and gas exchange) and main medicinal ingredients of P. cuspidatum, accompanied by the expression levels of associated genes in resveratrol biosynthesis. Single and co-inoculation with P. indica significantly improved shoot and root biomass production, and single and co-inoculation with F. mosseae and P. indica, especially single P. indica, significantly promoted leaf chlorophyll and soluble-protein concentrations and improved leaf gas exchange, including photosynthetic rate, transpiration rate, stomatal conductance, and intercellular CO2 concentration. The application of endophytic fungi increased resveratrol and polydatin concentrations, while it affected chrysophanol, emodin, and physcion concentrations in a complex manner. In addition, F. mosseae inoculation and co-inoculation induced the expression of PcCRS1, PcRS11, PcRS, and PcSTS, and only single F. mosseae and P. indica inoculation up-regulated the expression of PcCHS1 and PcCHS2. It was concluded that endophytic fungi accelerated biomass production, leaf physiological activity, and resveratrol accumulation in P. cuspidatum, which was associated with the up-regulation of related gene expression in resveratrol biosynthesis.

1. Introduction

Polygonum cuspidatum Sieb. et Zucc. is a perennial herb with medicinal components mainly containing anthraquinones, stilbenes, flavonoids, tannins, and polysaccharides [1]. P. cuspidatum is used in China and Japan to treat inflammation, infection, jaundice, skin burns, and hyperlipemia [2]. Among secondary metabolites of P. cuspidatum, resveratrol is a non-flavonoid polyphenolic compound containing a terpene structure, which is a phytoalexin in response to biotic or abiotic stresses, as well as possessing antitumor, antioxidant, and antibacterial effects [3]. The resveratrol and anthraquinones in P. cuspidatum are from the metabolic pathway of phenylpropanoids [4]. These secondary metabolites of P. cuspidatum have shown strong clinical medical benefits, such as being anti-coronavirus and anti-hepatitis B virus [5]. Therefore, it is very important to increase the contents of the main medicinal components in P. cuspidatum.
In nature, endophytic fungi do not result in any harm to the host, and they can promote the production of bioactive secondary metabolites in the host [6]. Among them, arbuscular mycorrhizal (AM) fungi can form a symbiont with the roots of terrestrial plants [7]. AM fungi help the host plant to obtain more water and mineral nutrients for the improvement of plant growth, and in turn, the host plant has to provide AM fungi with sugar substances and fatty compounds [8]. It has been documented that AM fungi could influence the accumulation of bioactive secondary metabolites in Paris polyphylla var. yunnanensis [9]. In a study conducted by Mandal et al. [10], AM fungal inoculation in Artemisia annua plants promoted the synthesis and accumulation of the medicinal component artemisinin, which was associated with the up-regulated expression of key genes in the artemisinin synthesis pathway. Similarly, AM fungal inoculation also stimulated the accumulation of glycyrrhizin and liquiritin in Glycyrrhiza uralensis plants under drought stress and the concentrations of essential oils in oregano [10,11,12]. These results suggest that AM fungi improve the concentrations of intrinsic medicinal components in medicinal plants, which may be linked to the change in the differential expression of genes.
Piriformospora indica is an endophytic fungus isolated from the rhizosphere of desert plants in India and has similar functions to those of AM fungi [13]. Previous studies also showed that P. indica colonization significantly altered the contents of secondary metabolites in the host, such as increasing aristolochic acid in Aristolochia elegans, promoting artemisinin content in Artemisia annua, and increasing oil content in sunflower [14,15,16,17]. The change in the secondary metabolism of plants caused by the endophytic fungus was associated with different expressions of genes related to chlorophyll and cysteine in host plants [18].
The concentrations of secondary metabolites such as resveratrol and polydatin in P. cuspidatum are influenced by planting techniques and seasons. Moreover, the over-exploitation of P. cuspidatum decreases the yield and drug components. Since AM fungi and P. indica collectively have positive effects on plant growth and secondary-metabolite production, we hypothesized that AM fungi and P. indica could promote the contents of the main medicinal components in P. cuspidatum and that the change could be associated with the expression of genes related to the synthesis of medicinal components induced by endophytic fungi. To confirm the above hypothesis, an AM fungus (Funneliformis mosseae) and an endophytic fungus (P. indica) were inoculated into P. cuspidatum singly or in combination to analyze their effects on biomass production, physiological activities (chlorophyll, soluble protein, and gas exchange), and medicinal ingredient contents, along with the changes in the expression of six genes associated with the resveratrol synthesis pathway.

2. Materials and Methods

2.1. Plant Culture and Endophytic Fungal Inoculation

The seeds of P. cuspidatum were surface-disinfected with 75% alcohol for 10 min and then sown in an autoclaved mixture of soil and sands (3:1, v/v). One month later, we transplanted the P. cuspidatum seedlings with four leaves into a plastic pot containing 1.5 kg of an autoclaved mixture of soil and sands (5:2, v/v). Meanwhile, the inoculation with endophytic fungi was also performed.
An endophytic fungus, P. indica, and an AM fungus, F. mosseae (BGC XZ02A), were selected. Among them, F. mosseae, which was provided by the Bank of Glomeromycota in China (BGC; Beijing, China), was allowed to proliferate with white clover as a trap plant. The mycorrhizal inoculum included root segments infected by AM fungi, spores (23/g), sporocarps, and growth substrate. P. indica was provided by Professor Zhi-Hong Tian of Yangtze University. The proliferation of P. indica was carried out as per the protocol described by Yang et al. [19]. The obtained spore suspension had the concentration of 2.85 × 108 CFU/mL by colorimetry at 600 nm.
For AM fungal inoculation, 100 g of F. mosseae inoculum was applied to a pot; for P. indica treatment, 30 mL of spore suspension of P. indica was inoculated into a pot; for dual inoculation of F. mosseae and P. indica, 100 g of F. mosseae inoculum and 30 mL of spore suspension of P. indica were applied simultaneously to a pot. The treatment without fungal inoculation received equal amounts of autoclaved F. mosseae inoculum and equal volumes of autoclaved spore suspension of P. indica, plus 2 mL of filtrate (30 μm) of F. mosseae inoculum. After the completion of inoculation, the treated plants were grown under controlled environmental conditions, the details of which were described by Yang et al. [19]. The plants did not receive any additional fertilizer during the experiment.

2.2. Experimental Design

The experiment consisted of four treatments: single inoculation with F. mosseae; single inoculation with P. indica; double inoculation with both F. mosseae and P. indica; no inoculation with either F. mosseae or P. indica. Each treatment had five replicates, and each replication included 2 pots (two seedlings per pot), for a total of 40 pots. The plants were randomly placed in the climatic chamber and changed weekly to eliminate environmental effects.

2.3. Determination of Root Fungal Colonization and Biomass Production

Eleven weeks after inoculation with endophytic fungi, the experiment was terminated. The roots were harvested, cut into 1 cm long root segments and stained for the colonization status of endophytic fungi in the roots using the method described by Meng et al. [20]. The frequency of root fungal colonization was the percentage of the number of root segments infected with endophytic fungi versus the total number of root segments observed. The treated plants were divided into shoots and roots and were oven-dried to a constant weight at 70 °C for 48 h; their dry weights were determined separately.

2.4. Determination of Chlorophyll, Soluble Protein, and Gas Exchange

Chlorophyll concentration in leaves was measured according to the method described by Lichtenthaler and Wellburn [21], using an 80% acetone solution for extraction. Leaf gas exchange was measured on the top fifth fully expanded leaves of the plants using a Plant Gas Exchange Measurement (LI-6400; LI-COR Inc., Lincoln, NE, USA) from 9:00 a.m. to 11:00 a.m. on the day before plant harvest. Soluble protein concentration was measured according to the method of Bradford [22], after homogenization in 5 mL of distilled water with 0.2 g of leaf samples and centrifugation at 4000× g for 10 min at 4 °C.

2.5. Determination of Medicinal Components in Leaves

High-performance liquid chromatography (HPLC) was used to determine the contents of six medicinal components in the leaves from P. cuspidatum, namely, aloe-emodin, chrysophanol, emodin, physcion, polydatin, and resveratrol. The extraction and assay conditions for these medicinal components of P. cuspidatum referred to the method described by Sun et al. [23] in detail under HPLC (LC-20AT; Shimadzu, Tokyo, Japan) conditions.

2.6. Determination of Relative Expression Levels of Resveratrol-Synthesis-Related Enzyme Genes

Leaf total RNA was extracted using a Quick RNA Isolation Kit (ZH120) (Huayueyang Biotechnology (Beijing) Co., Ltd., Beijing, China) according to the user’s guidelines. The extracted RNA was analyzed using a Bio Photometer Plus 6132 ultramicro spectrophotometer (Eppendorf, Hamburg, Germany) for RNA purity and reversely transcribed using a TRUE 1st Strand cDNA Synthesis Kit with gDNA Eraser (PC5402) (Aidlab Biotechnologies Co., Ltd., Beijing, China).
Six genes associated with resveratrol biosynthesis in P. cuspidatum, including resveratrol synthase (PcRS), stilbene synthase (PcSTS), supposed stilbene synthase 1 (PcCRS1), chalcone synthase 1 (PcCHS1), chalcone synthase 2 (PcCHS2), and resveratrol-forming stilbene synthase 11 (PcRS11), were obtained through the NCBI database (http://www.ncbi.nlm.nih.gov, accessed on 16 October 2021). The primer sequences of these genes (Table 1) were designed using Primer Premier 5.0 software, and qRT-PCR amplification was performed using the reverse-transcribed cDNA of each treatment as the template. Using β-actin of P. cuspidatum as an internal gene, real-time fluorescence expression analysis was performed using the CFX96 Real Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) and a fluorescent dye method (2× AceQ qPCR SYBR Green Master Mix; Aidlab, Beijing, China). Each treatment was replicated three times. The 2−ΔΔCt method [24] was used to calculate the relative expression of genes with the non-fungi inoculation as the control.

2.7. Statistical Analysis

Experimental data were analyzed by analysis of variance using SAS® Software (SAS Institute Inc., Cary, NC, USA). Duncan’s multiple range test was utilized to compare the significant difference among treatments at the level of 0.05.

3. Results

3.1. Changes in Root Fungal Colonization Frequency and Biomass Production

No fungal colonization was observed in the seedlings inoculated without any fungi, while the seedlings with F. mosseae, P. indica, and F. mosseae + P. indica had 58.75 ± 4.15%, 39.57 ± 3.18%, and 28.09 ± 2.27% of root fungal colonization frequency, respectively. The application of endophytic fungi dramatically improved the growth of P. cuspidatum (Figure 1a). Among them, F. mosseae, P. indica, and F. mosseae + P. indica significantly increased shoot biomass by 40%, 212%, and 102%, respectively (Figure 1b), and also significantly improved root biomass by 8%, 40%, and 25%, respectively (Figure 1c), compared with the non-fungi control.

3.2. Changes in Leaf Chlorophyll and Soluble-Protein Concentrations

Compared with the uninoculated control, the inoculation with single F. mosseae, single P. indica, and dual F. mosseae + P. indica significantly increased leaf chlorophyll concentration by 44%, 107%, and 79% (Figure 2a) and also distinctly elevated leaf soluble-protein concentration by 38%, 162%, and 110% (Figure 2b). Significantly higher leaf chlorophyll and soluble-protein concentrations were ranked as P. indica > F. mosseae + P. indica > F. mosseae > non-fungi control in decreasing order.

3.3. Changes in Leaf Gas Exchange

The endophytic fungal treatments improved leaf gas exchange in P. cuspidatum (Figure 3a–d). Compared with the uninoculated control, single P. indica, single F. mosseae, and dual F. mosseae + P. indica significantly increased the photosynthetic rate, transpiration rate, and stomatal conductance, reaching 174%, 86% and 113% higher values of photosynthetic rate (Figure 3a); 90%, 22% and 55% higher values of transpiration rate (Figure 3b); and 100%, 50% and 75% higher values of stomatal conductance (Figure 3c), respectively. In addition, single P. indica and single F. mosseae, but not double inoculation with F. mosseae and P. indica, significantly increased intercellular CO2 concentration by 30% and 18%, compared with the non-fungi control (Figure 3d).

3.4. Changes in Leaf Medicinal Components

Of the six medicinal components in P. cuspidatum, chrysophanol, emodin, physcion, polydatin, and resveratrol were detected, and aloe-emodin was not detected within the range of concentrations detected in this study (Table 2). Single F. mosseae, single P. indica, and dual F. mosseae + P. indica significantly increased leaf polydatin and resveratrol concentrations, with the corresponding increases of 52%, 150%, and 134% in polydatin and the corresponding increases of 220%, 137%, and 80% in resveratrol. Compared with the non-fungi control, single F. mosseae and dual F. mosseae + P. indica significantly reduced emodin concentration by 11% and 32%, respectively. No significant changes were observed in chrysophanol concentration after inoculation with endophytic fungi. Regarding physcion, P. indica significantly increased it, whereas dual F. mosseae + P. indica decreased it.

3.5. Changes in Expression of Associated Genes

Endophytic fungal application altered the expression levels of genes encoding resveratrol biosynthesis (Figure 4a–f). Compared with the non-fungi control, inoculation with F. mosseae significantly induced the relative expression levels of leaf PcCHS1, PcCHS2, PcCRS1, PcRS11, PcRS, and PcSTS; inoculation with P. indica stimulated the expression levels of PcCHS1, PcCHS2, and PcRS; double inoculation also up-regulated the expression levels of PcCRS1, PcRS11, PcRS, and PcSTS, accompanied by the suppression of PcCHS2 (Figure 4a–f).

4. Discussion

In our study, single P. indica and dual F. mosseae + P. indica collectively improved shoot and root biomass production, while single F. mosseae did not alter shoot and root biomass, suggesting that increased biomass of P. cuspidatum was more dependent on P. indica than F. mosseae. Earlier studies have also revealed improved growth of Withania somnifera, Spilanthes calva, Coleus forskohlii, and Adhatoda vasica [25,26]. However, Meng et al. [20] reported that single or dual inoculation with F. mosseae and P. indica considerably improved shoot and root biomass in trifoliate orange, but the increase in root biomass was more important in F. mosseae-inoculated than in P. indica-inoculated trifoliate orange. These results suggest that the improvement of host growth by endophytic fungi such as F. mosseae and P. indica depends on the compatibility between host plants and endophytic fungi. The increase in plant growth caused by endophytic fungi may be due to a combination of nutrient and water promotion, phytohormone production, root morphological improvement, and reduced amount of ethylene [27].
Previous studies have shown that leaf chlorophyll and soluble-protein concentrations were increased by endophytic fungi [28,29,30]. Our study indicated that P. indica and F. mosseae, singly or in combination, distinctly increased leaf chlorophyll and soluble-protein concentrations in P. cuspidatum. Among them, the significant increase among endophytic fungal treatments presented the trend of P. indica > dual F. mosseae + P. indica > F. mosseae. This was in line with the effect of endophytic fungal inoculation on the frequency of root colonization and the improved biomass production. Similar results were observed in Aloe vera infected with P. indica [31]. Pandey and Banik [32] also reported higher shoot and root biomass production in P. indica- than in Glomus sp.-inoculated A. vera. As a result, the endophytic fungi used in this experiment, particularly P. indica, were able to accelerate the synthesis of chlorophyll and proteins, as reported by Yaghoubian et al. [28]. Since endophytic-fungus-inoculated P. cuspidatum plants were recorded to have a higher chlorophyll concentration, inoculated plants represented greater leaf gas exchange than non-inoculated plants. Khalvandi et al. [30] concluded that an AM fungus, P. indica, and their co-inoculation improved the function of the plant photosynthetic apparatus, such as ΦPSII, for stimulating the capacity of light harvesting and electron transfer to plastoquinone.
There are four secondary metabolites with potential pharmacological value in the extract from P. cuspidatum, namely, resveratrol, polydatin, emodin, and physcion [33]. We detected five secondary metabolites in the leaves from P. cuspidatum, namely, chrysophanol, emodin, physcion, polydatin, and resveratrol, while aloe-emodin was below the detection line. The five secondary metabolites were heavily influenced by root endophytic fungi. Our study indicated that the application of endophytic fungi significantly increased leaf polydatin and resveratrol concentrations, whilst the highest polydatin concentration was observed in P. indica-inoculated plants, and the highest resveratrol concentration was recorded in F. mosseae-inoculated plants. In Vitis vinifera cvs Pinot Noir and Divico, ten days after infection with Plasmopara viticola, Rhizophagus irregularis-inoculated plants presented a considerably higher resveratrol concentration than non-inoculated plants [34]. In Fallopia japonica, mycorrhizal fungi induced the accumulation of resveratrol-glucoside content in roots [35]. In Rumex gmelini seedlings, inoculation with AM fungi increased resveratrol concentration after 60 days [36]. It is well-known that resveratrol is found in grapes, P. cuspidatum, pine trees, cassia seeds, peanuts, and other natural plants, among which the content of resveratrol in P. cuspidatum is the highest [37]. Resveratrol is a type of non-flavonoid polyphenol compound, which has a variety of physiological activities, such as tumor inhibition and anticancer activity [38]. Polydatin is a natural precursor of resveratrol, which has positive effects on bone health and related diseases alone or in combination with resveratrol [39]. Therefore, it is speculated that the root endophytic fungi strongly promoted the biosynthesis of resveratrol in P. cuspidatum. On the other hand, resveratrol as an antioxidant also scavenges reactive oxygen species under biotic and abiotic stresses [3]. AM fungi and P. indica collectively mitigated oxidative damage in host plants exposed to stress environments [40,41]. This suggests that the P. cuspidatum plants inoculated with endophytic fungi have higher stress resistance than uninoculated plants, but further experiments are needed to confirm it.
In addition to polydatin and resveratrol, endophytic fungi also affected the concentrations of emodin and physcion in P. cuspidatum leaves, and most of them showed an inhibitory effect. For example, F. mosseae and co-inoculation significantly inhibited the concentrations of emodin and physcion, and only P. indica significantly increased the concentration of physcion. Chrysophanol concentration in P. cuspidatum was not significantly affected by endophytic fungi. However, in Rumex gmelini and Ophiopogon japonicus plants, AM fungi dramatically increased chrysophanol content, and this was dependent on inoculated times [36,42]. These results indicate that the effects of endophytic fungi on some secondary metabolites of medicinal plants depend on environmental conditions, host plant types, endophytic fungi species, and secondary-metabolite species.
Resveratrol is synthesized through the phenylpropanoid metabolic pathway, in which phenylalanine is deaminated into cinnamic acid under the catalysis of phenylalanine ammonia-lyase; then, cinnamic acid is changed into coumaric acid by cinnamate-4-hydroxylase, which is catalyzed into p-coumaryl-coA by coumaryl-CoA-ligase [43]. P-coumaryl-CoA and malonyl-CoA as substrates synthesize resveratrol under the action of RS [43]. Therefore, RS is the key enzyme required in the resveratrol synthesis pathway [44]. STS is a type III polyketide synthase, which is only found in plants that can synthesize resveratrol and related compounds [43]. The results of our study indicate that F. mosseae and co-inoculation induced PcCRS1, PcRS11, PcRS, and PcSTS gene expression, thus inducing more accumulation of resveratrol. P. indica only up-regulated PcRS gene expression to activate resveratrol biosynthesis. In grapevines, AM fungi induced STS gene expression in the Pinot Noir and Divico varieties under Plasmopara viticola infection conditions and in the Chasselas variety under Botrytis cinerea infection conditions [34]. In Paris polyphylla var. yunnanensis, the application of mixed AM fungi promoted the expression of the squalene epoxidase gene to induce the accumulation of polyphyllin [45]. The accumulation of saponins in Centella asiatica was increased by the colonization with P. indica, coupled with the increased transcription levels of the squalene synthase gene and β-amyrin synthase gene in the saponin synthesis pathway [46]. This suggests that endophytic fungi may have their independent system to regulate resveratrol biosynthesis in P. cuspidatum by up-regulating the expressions of different genes associated with resveratrol biosynthesis, which still needs to be further studied.
Interestingly, single inoculation with F. mosseae and P. indica, but not co-inoculation, significantly promoted the expression of the PcCHS1 and PcCHS2 genes. CHS is an enzyme that plays a major role in the biosynthesis of flavonoids in plants [44]. P-coumaryl-coA and malonyl-coA as substrates also synthesize naringin under the action of CHS into the flavonoid synthesis pathway. Therefore, CHS and RS compete for the same substrate, causing different catalytic mechanisms [47]. Although this experiment did not measure the changes in flavonoids, it also revealed that endophytic fungi may potentially regulate flavonoid synthesis in P. cuspidatum.

5. Conclusions

Single or combined inoculation with F. mosseae and P. indica in P. cuspidatum promoted biomass production, especially shoots, and also enhanced leaf physiological activities, such as chlorophyll and soluble-protein syntheses and gas exchange. Inoculation with endophytic fungi mainly increased the concentrations of resveratrol and polydatin in P. cuspidatum leaves, which was closely related with the induced expression of genes in resveratrol biosynthesis by endophytic fungi. Such endophytic fungi inoculation provides a technique for accelerating the production of resveratrol and polydatin in P. cuspidatum in the future.

Author Contributions

Conceptualization, R.-T.S. and Q.-S.W.; methodology, R.-T.S. and N.Z.; data curation and statistical analysis, R.-T.S., N.Z. and Q.-S.W.; investigation, R.-T.S., Z.-Z.Z., X.-C.F., H.-D.F. and Y.-M.L.; writing—original draft preparation, R.-T.S.; writing—review and editing, W.H., A.H., E.F.A. and Q.-S.W.; supervision, Q.-S.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by 2021 Undergraduate Innovation and Entrepreneurship Training Program of Yangtze University (Yz2021329). The authors would like to extend their sincere appreciation to the Researchers Supporting Project (Number RSP-2021/134), King Saud University, Riyadh, Saudi Arabia.

Data Availability Statement

All the data supporting the findings of this study are included in this article.

Acknowledgments

The authors would like to extend their sincere appreciation to the Researchers Supporting Project (Number RSP-2021/134), King Saud University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Pan, H.T.; Ding, S.L.; Lin, H.S. Pharmacological research progress of Polygonum cuspidatum. China J. Chin. Mat. Med. 2013, 38, 651–653. [Google Scholar]
  2. Pei, W.; Qin, R.X.; Li, X.L.; Zhou, H. Botany, phytochemistry, pharmacology, and potential application of Polygonum cuspidatum Sieb. et Zucc.: A review. J. Ethnopharmacol. 2013, 148, 729–745. [Google Scholar]
  3. Galiniak, S.; Aebisher, D.; Bartusik-Aebisher, D. Health benefits of resveratrol administration. Acta Biochim. Pol. 2019, 66, 13–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Cho, S.; Namkoong, K.; Shin, M.; Park, J.; Yang, E.; Ihm, J. Cardiovascular protective effects and clinical applications of resveratrol. J. Med. Food. 2017, 20, 323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Liang, C.X.; Wang, S.S.; Chen, S.J.; Wang, Y.; Li, J.; Chang, Y.X. Research development on chemical composition and pharmacology of Polygoni cuspidati Rhizoma et Radix. Chin. Tradit. Herb. Drugs 2022, 53, 1264–1276. [Google Scholar]
  6. Ludwig-Müller, J. Plants and endophytes: Equal partners in secondary metabolite production? Biotechnol. Lett. 2015, 37, 1325–1334. [Google Scholar] [CrossRef] [Scilit]
  7. Cheng, S.; Zou, Y.N.; Kuča, K.; Hashem, A.; Abd_Allah, E.F.; Wu, Q.S. Elucidating the mechanisms underlying enhanced drought tolerance in plants mediated by arbuscular mycorrhizal fungi. Front. Microbiol. 2021, 12, 809473. [Google Scholar] [CrossRef] [Scilit]
  8. Wu, Q.S.; He, J.D.; Srivastava, A.K.; Zou, Y.N.; Kuča, K. Mycorrhizas enhance drought tolerance of citrus by altering root fatty acid compositions and their saturation levels. Tree Physiol. 2019, 39, 1149–1158. [Google Scholar] [CrossRef] [Scilit]
  9. Zhou, N.; Ding, B.; Feng, Y.; Qi, W.H.; Zhang, H.; Guo, D.Q.; Xiang, J. Effects of mycorrhizal colonization and medicine quality of Paris polyphylla var. yunnanensis inoculated by different foreign AM fungi species. China J. Chin. Mat. Med. 2015, 40, 3158–3167. [Google Scholar]
  10. Mandal, S.; Upadhyay, S.; Wajid, S.; Ram, M.; Jain, D.C.; Singh, V.P.; Abdin, M.Z.; Kapoor, R. Arbuscular mycorrhiza increase artemisinin accumulation in Artemisia annua by higher expression of key biosynthesis genes via enhanced jasmonic acid levels. Mycorrhiza 2015, 25, 345–357. [Google Scholar] [CrossRef] [Scilit]
  11. Khaosaad, T.; Vierheilig, H.; Nell, M. Arbuscular mycorrhiza alter the concentration of essential oils in oregano (Origanum sp., Lamiaceae). Mycorrhiza 2006, 16, 443–446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Xie, W.; Hao, Z.; Zhou, X. Arbuscular mycorrhiza facilitates the accumulation of glycyrrhizin and liquiritin in Glycyrrhiza uralensis under drought stress. Mycorrhiza 2018, 28, 285–300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Cheng, X.F.; Xie, M.M.; Li, Y.; Liu, B.Y.; Liu, C.Y.; Wu, Q.S.; Kuča, K. Effects of field inoculation with arbuscular mycorrhizal fungi and endophytic fungi on fruit quality and soil properties of Newhall navel orange. Appl. Soil Ecol. 2022, 170, 104308. [Google Scholar] [CrossRef] [Scilit]
  14. Waller, F.; Achatz, B.; Baltruschat, H. The endophytic fungus Piriformospora indica reprograms barley to salt-stress tolerance, disease resistance, and higher yield. Proc. Natl. Acad. Sci. USA 2005, 102, 13386–13391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Bagde, U.S.; Prasad, R.; Varma, A. Impact of culture filtrate of Piriformospora indica on biomass and biosynthesis of active ingredient aristolochic acid in Aristolochia elegans Mart. Int. J. Biol. 2014, 6, 29–37. [Google Scholar] [CrossRef] [Scilit]
  16. Sharma, G.; Agrawal, V. Marked enhancement in the artemisinin content and biomass productivity in Artemisia annua L. shoots co-cultivated with Piriformospora indica. World J. Microbiol. Biotechnol. 2013, 29, 1133–1138. [Google Scholar] [CrossRef] [Scilit]
  17. Bagde, U.S.; Prasad, R.; Varma, A. Influence of culture filtrate of Piriformospora indica on growth and yield of seed oil in Helianthus annus. Symbiosis 2011, 53, 83–88. [Google Scholar] [CrossRef] [Scilit]
  18. Shayan, M.; Jagriti, S.; Kushwaha, A.S.; KaPil, M.; Jai, S.; Nidhi, A. Endophytic fungi Piriformospora indica mediated protection of host from arsenic toxicity. Front. Microbiol. 2017, 8, 754. [Google Scholar]
  19. Yang, L.; Zou, Y.N.; Tian, Z.H.; Wu, Q.S.; Kuča, K. Effects of beneficial endophytic fungal inoculants on plant growth and nutrient absorption of trifoliate orange seedlings. Sci. Hortic. 2021, 277, 109815. [Google Scholar] [CrossRef] [Scilit]
  20. Meng, L.L.; Liu, R.C.; Yang, L.; Zou, Y.N.; Srivastava, A.K.; Kuča, K.; Hashem, A.; Abd_Allah, E.F.; Giri, B.; Wu, Q.S. The change in fatty acids and sugars reveals the association between trifoliate orange and endophytic fungi. J. Fungi 2021, 7, 716. [Google Scholar] [CrossRef] [Scilit]
  21. Lichtenthaler, H.K.; Wellburn, A.R. Determinations of total carotenoids and chlorophyll a and b of leaf extracts in different solvents. Biochem. Soc. Trans. 1983, 11, 591–592. [Google Scholar] [CrossRef] [Scilit]
  22. Bradford, M.M. A rapid and sensitive method for the quantification of microgram quantities of proteins utilizing the principle of protein–dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  23. Sun, R.-T.; Feng, X.-C.; Zhang, Z.Z.; Zhou, N.; Feng, H.D.; Liu, Y.M.; Hashem, A.; Al-Arjani, A.B.F.; Abd_Allah, E.F.; Wu, Q.S. Root endophytic fungi regulate changes in sugar and medicinal compositions of Polygonum cuspidatum. Front. Plant Sci. 2022, 13, 818909. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data usingreal-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Schuck, S.; Camehl, I.; Gilardoni, P.A. HSPRO controls early Nicotiana attenuata seedling growth during interaction with the fungus Piriformospora indica. Plant Physiol. 2012, 160, 929–943. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Baltruschat, H.; Fodor, J.; Harrach, B.D. Salt tolerance of barley induced by the root endophyte Piriformospora indica is associated with a strong increase in antioxidants. New Phytol. 2008, 180, 501–510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Poveda, J.; Eugui, D.; Abril-Urías, P.; Velasco, P. Endophytic fungi as direct plant growth promoters for sustainable agricultural production. Symbiosis 2021, 85, 1–19. [Google Scholar] [CrossRef] [Scilit]
  28. Yaghoubian, Y.; Goltapeh, E.M.; Pirdashti, H.; Esfandiari, E.; Feiziasl, V.; Dolatabadi, H.K.; Varma, A.; Hassim, M.H. Effect of Glomus mosseae and Piriformospora indica on growth and antioxidant defense responses of wheat plants under drought stress. Agric. Res. 2014, 3, 229–245. [Google Scholar] [CrossRef] [Scilit]
  29. Sun, R.T.; Zhang, Z.Z.; Zhou, N.; Srivastava, A.K.; Kuča, K.; Abd_Allah, E.F.; Hashem, A.; Wu, Q.S. A review of the interaction of medicinal plants and arbuscular mycorrhizal fungi in the rhizosphere. Not. Bot. Horti Agrobot. 2021, 49, 12454. [Google Scholar] [CrossRef] [Scilit]
  30. Khalvandi, M.; Amerian, M.; Pirdashti, H.; Keramati, S. Does co-inoculation of mycorrhiza and Piriformospora indica fungi enhance the efficiency of chlorophyll fluorescence and essential oil composition in peppermint under irrigation with saline water from the Caspian Sea? PLoS ONE 2021, 16, e0254076. [Google Scholar]
  31. Sharma, P.; Kharkwal, A.C.; Abdin, M.Z.; Verma, A. Piriformospora indica improves micropropagation, growth and phytochemical content of Aloe vera L. plants. Symbiosis 2014, 64, 11–23. [Google Scholar] [CrossRef] [Scilit]
  32. Pandey, D.K.; Banik, R.M. The influence of dual inoculation with Glomus mossae and Azotobacter on growth and barbaloin content of Aloe vera. Am. Eurasian J. Sustain. Agric. 2009, 3, 703–714. [Google Scholar]
  33. Zahedi, H.S.; Jazayeri, S.; Ghiasvand, R.; Djalali, M.; Eshraghian, M.R. Effects of Polygonum cuspidatum containing resveratrol on inflammation in male professional basketball players. Int. J. Prev. Med. 2013, 4, 1–4. [Google Scholar]
  34. Bruisson, S.; Maillot, P.; Schellenbaum, P.; Walter, B.; Gindro, K.; Deglene-Benbrahim, L. Arbuscular mycorrhizal symbiosis stimulates key genes of the phenylpropanoid biosynthesis and stilbenoid production in grapevine leaves in response to downy mildew and grey mould infection. Phytochemistry 2016, 131, 92–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Kovářová, M.; Frantík, T.; Koblihová, H.; Bartůňková, K.; Vosátka, M. Effect of clone selection, nitrogen supply, leaf damage and mycorrhizal fungi on stilbene and emodin production in knotweed. BMC Plant Biol. 2011, 11, 98. [Google Scholar] [CrossRef] [Scilit]
  36. Wang, D. Efficiency of Inoculation with Arbuscular Mycorrhizal Fungi to Rumex gmelini Turcz Seedlings. Master’s Thesis, Heilongjiang University of Chinese Medicine, Harbin, China, 2008. [Google Scholar]
  37. Burns, J.; Yokota, T.; Ashihara, H. Plant foods and herbal sources of resveratrol. J. Agric. Food Chem. 2002, 50, 3337–3340. [Google Scholar] [CrossRef] [Scilit]
  38. Park, E.J.; Pezzuto, J.M. The pharmacology of resveratrol in animals and humans. Biochim. Biophys. Acta 2015, 1852, 1071–1113. [Google Scholar] [CrossRef] [Scilit]
  39. De Maria, S.; Scognamiglio, I.; Lombardi, A.; Amodio, N.; Caraglia, M.; Cartenì, M.; Ravagnan, G.; Stiuso, P. Polydatin, a natural precursor of resveratrol, inducescell cycle arrest and differentiation of human colorectal Caco-2 cell. J. Transl. Med. 2013, 11, 264. [Google Scholar] [CrossRef] [Scilit]
  40. Tsai, H.J.; Shao, K.H.; Chan, M.T.; Cheng, C.P.; Yeh, K.W.; Oelmuller, R.; Wang, S.J. Piriformospora indica symbiosis improves water stress tolerance of rice through regulating stomata behavior and ROS scavenging systems. Plant Signal. Behav. 2020, 15, 2. [Google Scholar] [CrossRef] [Scilit]
  41. Zou, Y.N.; Wu, Q.S.; Kuča, K. Unravelling the role of arbuscular mycorrhizal fungi in mitigating the oxidative burst of plants under drought stress. Plant Biol. 2021, 23, 50–57. [Google Scholar] [CrossRef] [Scilit]
  42. Wang, S. Medical Plant Arbuscular Mycorrhizal Fungi Resource and Inoculation Effect of Arbuscular Mycorrhizal Fungi on Ophopogon japonicus. Master’s Thesis, Northwest A&F University, Yangling, China, 2008. [Google Scholar]
  43. Zhang, Y.T.; Huang, X.; Chen, Y.Z.; Li, J.D.; Yu, K. Chemical constituents and their biosynthesis mechanisms of Polygonum cuspidatum. China J. Chin. Mat. Med. 2020, 45, 4364–4372. [Google Scholar]
  44. Lei, Y.M. Cloning and Expression of the Resveratrol Synthase Gene from Polygonum cuspidatum. Master’s Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2007. [Google Scholar]
  45. Li, H.L.; Xu, L.F.; Li, Z.W.; Zhao, S.X.; Guo, D.Q.; Rui, L.; Zhou, N. Mycorrhizas affect polyphyllin accumulation of Paris polyphylla var. yunnanensis through promoting PpSE expression. Phyton Int. J. Exp. Bot. 2021, 90, 1535–1547. [Google Scholar] [CrossRef] [Scilit]
  46. Kumar, V.; Sahai, V.; Bisaria, V.S. Effect of Piriformospora indica on enhanced biosynthesis of anticancer drug, po-dophyllotoxin, in plant cell cultures of Linum album. In Piriformospora Indica; Varma, A., Kost, G., Oelmüller, R., Eds.; Springer: Heidelberg/Berlin, Germany, 2013; pp. 119–137. [Google Scholar]
  47. Flores-Sanchez, I.J.; Verpoorte, R. Plant polyketide synthases: A fascinating group of enzymes. Plant Physiol. Biochem. 2009, 47, 167–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Effects of single and co-inoculation with Funneliformis mosseae (Fm) and Piriformospora indica (Pi) on plant growth (a), shoot biomass (b), and root biomass (c) in Polygonum cuspidatum. Data (means ± SD, n = 5) followed by different letters above the bars indicate significant (p < 0.05) differences among treatments.
Figure 1. Effects of single and co-inoculation with Funneliformis mosseae (Fm) and Piriformospora indica (Pi) on plant growth (a), shoot biomass (b), and root biomass (c) in Polygonum cuspidatum. Data (means ± SD, n = 5) followed by different letters above the bars indicate significant (p < 0.05) differences among treatments.
Agronomy 12 01220 g001
Figure 2. Effects of single and co-inoculation with Funneliformis mosseae (Fm) and Piriformospora indica (Pi) on leaf chlorophyll (a) and soluble-protein (b) concentrations in Polygonum cuspidatum. Data (means ± SD, n = 5) followed by different letters above the bars indicate significant (p < 0.05) differences among treatments.
Figure 2. Effects of single and co-inoculation with Funneliformis mosseae (Fm) and Piriformospora indica (Pi) on leaf chlorophyll (a) and soluble-protein (b) concentrations in Polygonum cuspidatum. Data (means ± SD, n = 5) followed by different letters above the bars indicate significant (p < 0.05) differences among treatments.
Agronomy 12 01220 g002
Figure 3. Effects of single and co-inoculation with Funneliformis mosseae (Fm) and Piriformospora indica (Pi) on leaf photosynthetic rate (a), transpiration rate (b), stomatal conductance (c), and intercellular CO2 concentration (d) in Polygonum cuspidatum. Data (means ± SD, n = 5) followed by different letters above the bars indicate significant (p < 0.05) differences among treatments.
Figure 3. Effects of single and co-inoculation with Funneliformis mosseae (Fm) and Piriformospora indica (Pi) on leaf photosynthetic rate (a), transpiration rate (b), stomatal conductance (c), and intercellular CO2 concentration (d) in Polygonum cuspidatum. Data (means ± SD, n = 5) followed by different letters above the bars indicate significant (p < 0.05) differences among treatments.
Agronomy 12 01220 g003
Figure 4. Effects of single and co-inoculation with Funneliformis mosseae (Fm) and Piriformospora indica (Pi) on the relative expression of PcCHS1 (a), PcCHS2 (b), PcCRS1 (c), PcRS11 (d), PcRS (e), and PcSTS (f) in Polygonum cuspidatum. Data (means ± SD, n = 3) followed by different letters above the bars indicate significant (p < 0.05) differences among treatments.
Figure 4. Effects of single and co-inoculation with Funneliformis mosseae (Fm) and Piriformospora indica (Pi) on the relative expression of PcCHS1 (a), PcCHS2 (b), PcCRS1 (c), PcRS11 (d), PcRS (e), and PcSTS (f) in Polygonum cuspidatum. Data (means ± SD, n = 3) followed by different letters above the bars indicate significant (p < 0.05) differences among treatments.
Agronomy 12 01220 g004
Table 1. Primer sequences of associated genes in resveratrol biosynthesis.
Table 1. Primer sequences of associated genes in resveratrol biosynthesis.
GenesGene IDForward Sequence (5′→3′) Reverse Sequence (5′→3′)
PcCHS1AB019030. 1GTAGCTGCCGAATCTTCTACTGTGTCGTAGCATCGTCCTTTG
PcCHS2EU647246. 1GAAGCTTAAGGCGACTAGACAACAACCGACTTCTTCCTCATCTC
PcCRS1DQ459350. 1TGAGCGAGTACGGGAATTTGCCTTCTCCAGTCGTCTTCTTAC
PcRS11EF117977. 1GATGAGATGATGAAGGCACAAACGGAAGTAGAAGTCGGGAAAGTC
PcRSDQ900615. 1GAGATGACGAAGGCACTAACAGGAAGTAGAAGTCGGGAAAGTC
PcSTSEU647245. 1GAAGAGATGATGAAGGCACAAACGGAAGTAGAAGTCGGGAAAGTC
PcActinMK288156. 1TACAATGAGCTTCGGGTTGC GCTCTTTGCAGTTTCCAGCT
Table 2. Effects of single and co-inoculation with Funneliformis mosseae (Fm) and Piriformospora indica (Pi) on leaf chrysophanol, emodin, physcion, polydatin, and resveratrol contents (mg/g DW) in Polygonum cuspidatum.
Table 2. Effects of single and co-inoculation with Funneliformis mosseae (Fm) and Piriformospora indica (Pi) on leaf chrysophanol, emodin, physcion, polydatin, and resveratrol contents (mg/g DW) in Polygonum cuspidatum.
TreatmentsChrysophanolEmodinPhyscionPolydatinResveratrol
Control0.28 ± 0.03 ab0.62 ± 0.05 a0.10 ± 0.01 b1.01 ± 0.11 c0.30 ± 0.04 d
Fm0.32 ± 0.02 a0.55 ± 0.03 b0.07 ± 0.01 c1.54 ± 0.14 b0.96 ± 0.09 a
Pi0.26 ± 0.02 b0.57 ± 0.04 ab0.13 ± 0.01 a2.52 ± 0.25 a0.71 ± 0.08 b
Fm + Pi0.27 ± 0.02 b0.42 ± 0.04 c0.07 ± 0.01 c2.36 ± 0.20 a0.54 ± 0.06 c
Data (means ± SD, n = 3) followed by different letters in the row indicate significant (p < 0.05) differences among treatments.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sun, R.-T.; Zhang, Z.-Z.; Feng, X.-C.; Zhou, N.; Feng, H.-D.; Liu, Y.-M.; Harsonowati, W.; Hashem, A.; Abd_Allah, E.F.; Wu, Q.-S. Endophytic Fungi Accelerate Leaf Physiological Activity and Resveratrol Accumulation in Polygonum cuspidatum by Up-Regulating Expression of Associated Genes. Agronomy 2022, 12, 1220. https://doi.org/10.3390/agronomy12051220

AMA Style

Sun R-T, Zhang Z-Z, Feng X-C, Zhou N, Feng H-D, Liu Y-M, Harsonowati W, Hashem A, Abd_Allah EF, Wu Q-S. Endophytic Fungi Accelerate Leaf Physiological Activity and Resveratrol Accumulation in Polygonum cuspidatum by Up-Regulating Expression of Associated Genes. Agronomy. 2022; 12(5):1220. https://doi.org/10.3390/agronomy12051220

Chicago/Turabian Style

Sun, Rui-Ting, Ze-Zhi Zhang, Xiang-Cao Feng, Nong Zhou, Hai-Dong Feng, Yi-Mei Liu, Wiwiek Harsonowati, Abeer Hashem, Elsayed Fathi Abd_Allah, and Qiang-Sheng Wu. 2022. "Endophytic Fungi Accelerate Leaf Physiological Activity and Resveratrol Accumulation in Polygonum cuspidatum by Up-Regulating Expression of Associated Genes" Agronomy 12, no. 5: 1220. https://doi.org/10.3390/agronomy12051220

APA Style

Sun, R.-T., Zhang, Z.-Z., Feng, X.-C., Zhou, N., Feng, H.-D., Liu, Y.-M., Harsonowati, W., Hashem, A., Abd_Allah, E. F., & Wu, Q.-S. (2022). Endophytic Fungi Accelerate Leaf Physiological Activity and Resveratrol Accumulation in Polygonum cuspidatum by Up-Regulating Expression of Associated Genes. Agronomy, 12(5), 1220. https://doi.org/10.3390/agronomy12051220

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop