Development of Quantitative Real-Time PCR Assays to Quantify Erysiphe pisi and Erysiphe trifolii and Its Implementation for Monitoring Their Relative Prevalence in Pea Crops in Spain and Tunisia
Abstract
:1. Introduction
2. Materials and Methods
2.1. Development of a qPCR Assay to Identify and Quantify E. pisi and E. trifolii
2.2. Analysis of the Relative Prevalence of E. pisi and E. trifolii in Pea Fields in Spain and Tunisia
3. Results and Discussions
3.1. Development of a qPCR Assay to Identify and Quantify E. pisi and E. trifolii
3.2. Analysis of the Relative Prevalence of E. pisi and E. trifolii in Pea Fields in Spain and Tunisia
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Fondevilla, S.; Rubiales, D. Powdery mildew control in pea. A review. Agronon. Sustain. Dev. 2012, 32, 401–409. [Google Scholar] [CrossRef] [Green Version]
- Harland, S.C. Inheritance of immunity to mildew in Peruvian forms of Pisum sativum. Heredity 1948, 2, 263–269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heringa, R.J.; Van Norel, A.; Tazelaar, M.F. Resistance to powdery mildew (Erysiphe polygoni D.C.) in peas (Pisum sativum L.). Euphytica 1969, 18, 163–169. [Google Scholar]
- Fondevilla, S.; Cubero, J.I.; Rubiales, D. Confirmation that the Er3 gene, conferring resistance to Erysiphe pisi in pea, is a different gene from er1 and er2 genes. Plant Breed. 2010, 130, 281–282. [Google Scholar] [CrossRef] [Green Version]
- Attanayake, R.N.; Glawe, D.A.; McPhee, K.E.; Dugan, F.M.; Chen, W. Erysiphe trifolii—A newly recognized powdery mildew pathogen of pea. Plant Pathol. 2010, 59, 712–720. [Google Scholar] [CrossRef]
- Fondevilla, S.; Chattopadhyay, C.; Khare, N.; Rubiales, D. Erysiphe trifolii is able to overcome er1 and Er3 resistance genes but not er2. Eur. J. Plant Pathol. 2013, 136, 557–563. [Google Scholar] [CrossRef]
- Rubiales, D.; González-Bernal, M.J.; Warkentin, T.; Bueckert, R.; Vaz Patto, M.C.; McPhee, K.; McGee, R.; Smýkal, P. Advances in breeding of peas. In Achieving Sustainable Cultivation of Vegetables; Hochmuth, G., Ed.; BurleigDodds Science Publishing Limited: Cambridge, UK, 2019; pp. 1–33. [Google Scholar] [CrossRef]
- Baiswar, P.; Ngachan, S.; Verma, V.; Kumar, R.; Jha, A.; Chandra, S. Molecular evidence of Erysiphe pisi on pea and E. trifoliorum on white clover in northeast India. Australas. Plant Dis. Notes 2015, 10, 1–3. [Google Scholar] [CrossRef]
- Torres, A.M.; Weeden, N.F.; Martín, A. Linkage among isozyme, RFLP and RAPD markers in Viciafaba. Theor. Appl. Genet. 1993, 85, 937–945. [Google Scholar] [CrossRef] [PubMed]
- Ramakers, C.; Ruijter, J.M.; Lekanne Deprez, R.H.; Moorman, A.F.M. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 2003, 339, 62–66. [Google Scholar] [CrossRef]
- Tiwari, K.R.; Penner, G.A.; Warkentin, T.D. Inheritance of powdery mildew resistance in pea. Can. J. Plant Sci. 1997, 77, 307–310. [Google Scholar] [CrossRef] [Green Version]
- Attanayake, R.N.; Glawe, D.A.; Dugan, F.M.; Chen, W. Erysiphe trifolii causing powdery mildew of lentil (Lens culinaris). Plant Dis. 2009, 93, 797–803. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Santos, C.; Martins, D.; Rubiales, D.; Vaz Patto, M.C. Partial resistance against Erysiphe pisi and E. trifolii under different genetic control in Lathyrus cicera: Outcomes from a linkage mapping approach. Plant Dis. 2020, 104, 2875–2884. [Google Scholar] [CrossRef] [PubMed]
- Norini, M.P.; Secher, C.; Lollier, M.; Jézéquel, K.; Cornu, J.Y.; Lebeau, T. Quantification of the 16S–23S rRNA internal transcribed spacers of Burkholderia xenovorans strain LB400 using real-time PCR in soil samples. Lett. Applied Microbiol. 2013, 56, 366–372. [Google Scholar] [CrossRef] [PubMed]
- Bokulich, N.A.; Mills, D.A. Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities. AEM 2013, 79, 2519–2526. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ieda, S.; Moriyama, M.; Takashita, T.; Maehara, T.; Imabayashi, Y.; Shinozaki, S.; Tanaka, A.; Hayashida, J.N.; Furukawa, S.; Ohta, M.; et al. Molecular Analysis of Fungal Populations in Patients with Oral Candidiasis Using Internal Transcribed Spacer Region. PLoS ONE 2014, 9, e101156. [Google Scholar] [CrossRef] [Green Version]
- Fondevilla, S.; Carver, T.L.W.; Moreno, M.T.; Rubiales, D. Macroscopic and histological characterisation of genes er1 and er2 for powdery mildew resistance in pea. Eur. J. Plant Pathol. 2006, 115, 309–321. [Google Scholar] [CrossRef]
- Rubiales, D.; Osuna-Caballero, S.; González-Bernal, M.J.; Cobos, M.J.; Flores, F. Pea Breeding Lines Adapted to Autumn Sowings in Broomrape Prone Mediterranean Environments. Agronomy 2021, 11, 769. [Google Scholar] [CrossRef]
- RAEA. Resultados de Ensayos de Variedades de Guisantes Proteaginosos. Campaña 2020/21; Junta de Andalucia Ed.: Alcalá del Río, Spain; pp. 1–21.
- Fondevilla, S.; Carver, T.L.W.; Moreno, M.T.; Rubiales, D. Identification and characterisation of sources of resistance to Erysiphe pisi Syd. in Pisum spp. Plant Breed. 2007, 126, 113–119. [Google Scholar] [CrossRef]
Primer | Species | Sequence |
---|---|---|
EPFw1 1 | Erysiphe pisi | GCTCAGTCGTGGCATCTGCT 2 |
EPFw2 | Erysiphe pisi | AGGCTCAGTCGTGGCATCTGCT |
EPRv | Erysiphe pisi | GGCCCGCCAAAGCAACAAGA |
ETFw1 | Erysiphe trifolii | GTCGCTGTTCGCAAGGA |
ETRv1 | Erysiphe trifolii | AGCTGAGACGACACAAACAA |
ETFw2 | Erysiphe trifolii | TACAGAGTGCGAGGCTCA |
ETRv2 | Erysiphe trifolii | GCAGGTCCTTGCGAACA |
Primer Pair | Species | ||
---|---|---|---|
E. pisi | E. trifolii | Pisum sativum | |
EPFw1/EPRv | 16.45 | 31.02 | 31.93 |
ETFw2/ETFw2 | 34.44 | 16.46 | 36.99 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fondevilla, S.; González-Bernal, M.J.; Omri Ben Youssef, N.; Rubiales, D. Development of Quantitative Real-Time PCR Assays to Quantify Erysiphe pisi and Erysiphe trifolii and Its Implementation for Monitoring Their Relative Prevalence in Pea Crops in Spain and Tunisia. Agronomy 2022, 12, 334. https://doi.org/10.3390/agronomy12020334
Fondevilla S, González-Bernal MJ, Omri Ben Youssef N, Rubiales D. Development of Quantitative Real-Time PCR Assays to Quantify Erysiphe pisi and Erysiphe trifolii and Its Implementation for Monitoring Their Relative Prevalence in Pea Crops in Spain and Tunisia. Agronomy. 2022; 12(2):334. https://doi.org/10.3390/agronomy12020334
Chicago/Turabian StyleFondevilla, Sara, Mª José González-Bernal, Noura Omri Ben Youssef, and Diego Rubiales. 2022. "Development of Quantitative Real-Time PCR Assays to Quantify Erysiphe pisi and Erysiphe trifolii and Its Implementation for Monitoring Their Relative Prevalence in Pea Crops in Spain and Tunisia" Agronomy 12, no. 2: 334. https://doi.org/10.3390/agronomy12020334
APA StyleFondevilla, S., González-Bernal, M. J., Omri Ben Youssef, N., & Rubiales, D. (2022). Development of Quantitative Real-Time PCR Assays to Quantify Erysiphe pisi and Erysiphe trifolii and Its Implementation for Monitoring Their Relative Prevalence in Pea Crops in Spain and Tunisia. Agronomy, 12(2), 334. https://doi.org/10.3390/agronomy12020334