Next Article in Journal
Determination of Cassava Leaf Area for Breeding Programs
Previous Article in Journal
A Novel Operational Rice Mapping Method Based on Multi-Source Satellite Images and Object-Oriented Classification
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 12
Issue 12
10.3390/agronomy12123011
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ultraviolet-B Irradiation Induces Resistance against Powdery Mildew in Cucumber (Cucumis sativus L.) through a Different Mechanism Than That of Heat Shock-Induced Resistance

by
Dinar Mindrati Fardhani
1,†,
Agung Dian Kharisma
2,†,
Tomoyuki Kobayashi
3,
Nur Akbar Arofatullah
4,
Makoto Yamada
5,
Sayuri Tanabata
6,
Yumi Yokoda
7,
Ani Widiastuti
4,* and
Tatsuo Sato
6,*
1
Faculty of Science and Technology, Universitas Aisyiyah Yogyakarta, Yogyakarta 55592, Indonesia
2
United Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Fuchu 183-0054, Tokyo, Japan
3
Fukushima Prefectural Government, Fukushima 960-8670, Fukushima, Japan
4
Faculty of Agriculture, Universitas Gadjah Mada, Yogyakarta 55281, Indonesia
5
Panasonic Corporation, Kadoma 571-8686, Osaka, Japan
6
Center for International Field Agriculture, College of Agriculture, Ibaraki University, Ami, Inashiki 300-0331, Ibaraki, Japan
7
Fukushima Agricultural Technology Centre, Koriyama 963-0531, Fukushima, Japan
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2022, 12(12), 3011; https://doi.org/10.3390/agronomy12123011
Submission received: 31 October 2022 / Revised: 24 November 2022 / Accepted: 25 November 2022 / Published: 29 November 2022
(This article belongs to the Section Pest and Disease Management)
Browse Figures
Review Reports Versions Notes

Abstract

:
Heat shock treatment (HST) and UV-B irradiation can reduce pathogen infection in crops. However, information on the mechanism of UV-B action is limited. Here, we investigated the mechanism of UV-B-induced resistance against powdery mildew in cucumber and compared it to that of heat-shock-induced resistance. We measured the percentage of leaf area showing disease symptoms and examined the expression levels of defense- and heat-shock-related genes across treatment groups. UV-B irradiation (intensity, 5 µW/cm2) for 4 h/d followed by pathogen inoculation reduced the appearance of powdery mildew by 21.17% compared with the control group. Unlike HST—which induces systemic resistance—UV-B irradiation induced local resistance in cucumber, as indicated by local changes in gene expression (Chi2 and ETR2). UV-B-treated plants inoculated with powdery mildew showed higher expression levels of Chi2, ETR2, and LOX6 than plants that were either treated with UV-B or inoculated. UV-B had no major effects on systemic acquired resistance or heat shock transcription factors, which are known to be affected by HST. Combined HST and UV-B had a strong synergistic effect in reducing powdery mildew in cucumber. Our results indicate that UV-B treatment likely operates through a different mechanism than HST in triggering cucumber resistance against powdery mildew infection.

1. Introduction

Chemical fungicides have been used to control pathogenic infections in crops since the 19th century. Chemical pesticides have been used as the primary control measure for more than five decades, and dependence on them has increased over time [1]. As such, problems due to their overuse have become apparent in recent years [2]. Several studies have suggested alternative strategies to reduce the use of fungicides in the field, and one of these strategies involves the induction of plant defense mechanisms. Recent studies have suggested that various abiotic stress factors—including high temperature [3,4,5,6,7,8,9] and ultraviolet-B (UV-B) irradiation [10,11,12]—can help develop disease resistance in plants by activating plant immune responses. The mechanisms by which these abiotic stresses induce plant defense systems have been described individually in previous studies [3,4,5,6,7,8,9,10,11,12,13,14,15]. However, it is unknown whether they can induce plant defenses via the same underlying mechanism. This knowledge is important because the integration of these mechanisms may lead to the development of alternative approaches to controlling plant pathogens in the future.
Heat shock treatment (HST) induces plant defense responses against pathogens in various crops [16,17,18]. As such, heat disinfection with hot water has been proposed as an alternative measure to control powdery mildew in strawberries [19,20]. HST induces plant defenses through a specific mechanism known as heat shock-induced resistance (HSIR). Studies by Widiastuti et al. [4], Arofatullah et al. [6,21], and Kharisma et al. [7] have implicated at least two pathways—systemic acquired resistance (SAR) and heat shock transcription factor (HSF)-mediated signaling—in the induction of plant disease resistance after heat shock. Widiastuti et al. [5] observed the accumulation of salicylic acid after HST in strawberries and thus concluded that SAR was involved in activating the defense system.
Although UV-B irradiation has been in practical use since before the application of HST in strawberries, its mechanism of action remains to be elucidated. UV-B effectively suppresses several pathogenic infections in cucumber [11,22], grapevine [23], lettuce [24], rose [10], and strawberry [13]. Moreover, UV-B irradiation prevents powdery mildew through two distinct modes of action: a direct effect on the pathogen and an indirect effect on active plant resistance. The direct effect of UV-B has been suggested as the possible mode of action in the inhibition of mycelial growth [25] and conidial germination [10]. However, gene expression analyses of defense-related genes and assays of defense-related enzymes by Kanto et al. [13,26], Oka et al. [27], and Satou et al. [25] strongly suggest that the indirect effects of UV-B irradiation on plant resistance are the main mode of action through which it suppresses powdery mildew. Distinguishing the two mechanisms is difficult because continuous UV-B irradiation is provided daily during field tests. UV-B treatment significantly promotes the activities of phytohormones and pathogenesis-related proteins (PR-1 and PDF1.2b) [28], increases the levels of jasmonic acid (JA), and promotes ethylene production in Arabidopsis [29]. UV-B also promotes salicylic acid (SA) in tobacco [30]. However, the expression patterns of defense-related genes in leaves untreated with UV-B have not been investigated [31]. Therefore, it is unclear whether SAR is involved in the mechanism of action of UV-B.
Similar to HST, UV-B irradiation helps prevent pathogenic infections, although it does not provide a therapeutic effect after infection. Yoshino et al. [32] and Widiastuti et al. [5] discovered that HST induces systemic resistance following partial heat shock treatment. Casati and Walbot [33] also reported possible systemic resistance induced by UV-B irradiation in maize. Generally, UV-B is regarded to induce only local resistance, as diseases are likely to occur in shaded areas that are not directly exposed to UV-B. It is unknown whether HSF continues to upregulate defense-related genes under UV-B irradiation. The mechanism of SAR in plant response to UV-B is still unclear, and UV-B-induced resistance in plants may involve pathways other than SAR. To date, researchers have failed to find UV-induced changes in the expression of defense-related genes in shielded (untreated) leaves [31]. Here, we investigate whether SAR- and HSF-related pathways that are involved in HST-induced plant resistance are affected by UV-B irradiation.
The objectives of this study were to evaluate the effect of UV-B irradiation on powdery mildew in cucumber, clarify its mechanism of action, and compare its mechanisms of action to that of HST-induced HSIR. We investigated the mechanism of UV-B and compared it to that of HST by evaluating the effects of UV-B irradiation, HST, and a combination of both treatments on powdery mildew infection. We also evaluated the expression patterns of defense-related genes (Chi2, PR1, Lox6, and ETR2) after both treatments and of heat-shock-associated genes (HSP70, HSFA2, and HSFB2) after UV-B treatment. Our results indicate that the mechanism of action of UV-B differs from that of HSIR in controlling powdery mildew infection in cucumbers.

2. Materials and Methods

2.1. Growth Conditions of the Plant and Pathogen

Cucumber (Cucumis sativus L. ‘Shimoshirazujibai’) seedlings were grown in plastic pots with 3 × 6 cells filled with nursery soil (Super Mix A, Sakata Co. Ltd., Yokohama, Kanagawa, Japan). The seedlings were grown at 25 °C with a 16:8 h light: dark photoperiod until the second true leaves were fully expanded, and 14-day-old cucumber plants were used in experiments. Powdery mildew cultures were obtained from the Fukushima Agricultural Research Centre (Fukushima, Japan) and were maintained on cucumber plants in a greenhouse for 7 d before the inoculation test. Thereafter, the conidia of powdery mildew were collected, measured as described by Widiastuti et al. [34], and used for inoculation.

2.2. UV-B Irradiation and Heat Shock Treatment

UV-B irradiation was provided by a UV-B lamp (PWFD24UB1PAP, Panasonic Lighting Devices, Osaka, Japan) placed in a greenhouse that was separated by a UV-impermeable plastic film (Vegetaron Super UV cut, Sekisui Film Co. Ltd., Osaka, Japan). UV-B irradiation was applied at strong (15 µW/cm2) and medium (5 µW/cm2) intensities to determine the optimal intensity for inducing resistance against powdery mildew. Irradiation was provided for 3 d from 22:00 to 2:00. Non-irradiated plants were used as negative controls. In the HST, the first leaf of each cucumber plant was dipped into hot water (50 °C) for 20 s, as described by Kharisma et al. [7]. In the combination treatment involving exposure to both UV-B and HST, plants were exposed to UV-B 24 h after HST. Plants were partially treated with UV-B irradiation as follows: one of two leaves of a cucumber plant was covered with aluminum foil, and the other leaf was exposed to UV-B for 3 d from 22:00 to 2:00. Following partial treatments with UV-B and HST, as well as the combined treatment with UV-B irradiation and pathogen infection, the expression levels of defense-related genes were measured. All experiments consisted of 6 plants per treatment, except for experiments on the intensity of UV-B irradiation (9 replicates) and combination treatment with UV-B and HST (3 replicates).

2.3. Pathogen Inoculation

A 2–3 mL aliquot of the conidial suspension of powdery mildew was sprayed as a fine mist on each treated plant 12 h after the final day of UV irradiation. Plants in the following groups were inoculated in this manner: UV-B optimization, partial UV-B treatment, combination treatment with UV-B and HST, and combination treatment with UV-B exposure and pathogen infection. Thereafter, the plants were maintained in a greenhouse with separate places for infected plants and non-infected plants. Disease severity was estimated based on observations of individual leaves 7 d post-inoculation in all treatments except in the combination treatment with UV-B and HST, where disease severity was observed 33 d post-inoculation. The disease index was scored based on the percentage area of leaves that showed symptoms of disease as follows: 1 ≤ 10% leaf area with disease symptoms; 2 = 20–30% leaf area with disease symptoms; 3 = 40–50% leaf area with disease symptoms; 4 ≥ 50% leaf area with disease symptoms or complete wilting. The disease index (DI) was measured using the following formula:
DI = [Ʃ(n × v)/(N × Z)] × 100%,
where n is the score class, v is the number of samples in the score class, N is the highest score value, and Z is the total number of samples.

2.4. RNA Extraction and Gene Expression Analysis

To determine gene expression patterns, leaves were harvested 12 h after pathogen inoculation. Total RNA was extracted from the first leaf of each plant treated with a combination of UV-B treatment and pathogen infection. Total RNA was extracted using Sepasol-RNA I (Nacalai Tesque, Kyoto, Japan) and then reverse-transcribed using the PrimeScript RT reagent kit (Takara Bio Inc., Shiga, Japan) following the manufacturer’s instructions. In the partial-treatment groups (UV-B and HST), total RNA was extracted independently from the first and second leaves at 24 h after treatment. First-strand cDNA synthesis was performed and the product was used as a template for quantitative real-time polymerase chain reaction (qRT-PCR). qRT-PCR was performed using the KOD SYBR qPCR Mix (TOYOBO, Osaka, Japan) on a CFX Connect Real-Time PCR System (Bio-Rad, Hercules, CA, USA) with the following conditions: initial denaturation at 98 °C for 120 s, followed by 40 cycles of denaturation at 98 °C for 10 s, annealing at 60 °C for 15 s, and extension at 68 °C for 30 s. Gene-specific primer pairs for actin (Act), acidic endochitinase 2 (Chi2), lipoxygenase 6 (LOX6), and ethylene receptor 2 (ETR2) (Table 1) were designed as described by Widiastuti et al. [34]. Three technical replicates of each qPCR reaction were used for each biological replicate. All changes in the transcript levels for the corresponding genes were normalized to Act expression [7].

2.5. Statistical Analysis

Tukey’s multiple comparison test was used to analyze the data in the EZR (Easy R) software [35].

3. Results and Discussion

3.1. UV-B-Induced Resistance to Powdery Mildew in Cucumber

UV-B lamps with medium (5 μW/cm2) and strong (15 μW/cm2) intensities were used to evaluate the preventive effects of UV-B against powdery mildew in cucumber. After exposure to 15 μW/cm2 of UV-B (Figure 1), powdery mildew infection was significantly reduced by 88.03% at 7 d post-inoculation. Compared with the control group (NT; no UV-B treatment), medium-intensity UV-B treatment reduced powdery mildew infection by 21.17%. Strong-intensity UV-B irradiation has been reported to cause visible leaf injury and discoloration [36]. Moreover, cucumber is more sensitive to UV-B irradiation in low light and more susceptible to damage than strawberry [11]. Therefore, the medium-intensity UV-B treatment was considered more suitable for use in subsequent experiments. Medium-intensity UV-B irradiation reduced the symptoms of powdery mildew at 33 d post-inoculation in subsequent experiments. These results suggest that medium-intensity UV-B has a preventive effect against powdery mildew infection in cucumber. Similar results regarding UV-B-induced enhancements in plant resistance against powdery mildew have also been reported in strawberries [13,37] and rose [10].
After partial UV-B treatment, the appearance of powdery mildew was significantly reduced only on the first leaf of treated plants (Figure 2). This suggested that unlike HST, UV-B did not induce a systemic resistance against powdery mildew in cucumber. HST has been shown to induce systemic resistance against Botrytis cinerea in cucumber [7,32]. Researchers have suggested that this may be due to the accumulation of SA [30] and systemic changes in gene expression [4,7,32,33]. Both pieces of evidence imply that this mechanism is associated with SAR, which is part of the HSIR mechanism following HST. However, our results showed that UV-B irradiation did not induce systemic resistance in cucumbers, indicating that it likely operates through a different mechanism compared to HSIR. Therefore, UV-B irradiation may not use the SAR pathway when inducing resistance to powdery mildew in cucumber.

3.2. Expression Levels of Defense-Related Genes after UV-B Irradiation and HST

The expression levels of defense-related genes were monitored to elucidate the mechanism of action of UV-B irradiation and HST in cucumber. These genes included Chi2 (a gene marker of SAR) and LOX6 and ETR2 (gene markers of JA and ethylene production) [38]. Chi2 and ETR2 were remarkably upregulated in UV-B-treated leaves compared with the corresponding untreated leaves in the NT group (Figure 3a–c). However, there was no significant difference in LOX6 expression among treatments. This suggested that UV-B treatment induced local resistance in cucumber, which was consistent with the local reduction in powdery mildew after UV-B treatment (Figure 2). The upregulation of ETR after UV-B treatment also suggested that UV-B induced resistance through a non-SAR pathway that may be involved in the ethylene signaling pathway. Chi2 was upregulated in the first and second leaves at 24 h after partial HST, whereas LOX6 and ETR2 were not (Figure 4). This confirmed that HST induced systemic resistance, which is consistent with results of Kharisma et al. [7] and Yoshino et al. [32]. The nondifferent expression of LOX6 and ETR2 among treatments indicated that the JA/ethylene signaling pathways were not involved in the HST-induced defense mechanism of cucumber. These results are consistent with the notion that unlike HST, UV-B irradiation induces local resistance (Figure 2). Thus, we conclude that UV-B and HST act differently when inducing resistance in cucumber plants.
The continued effects of UV-B irradiation on plant resistance to powdery mildew were confirmed by combining UV-B irradiation with pathogen inoculation. At 7 d post-inoculation, there was no difference in the expression levels of Chi2, ETR2, and LOX6 between the UV-B and NT groups. However, when UV-B treatment was combined with pathogen inoculation, the expression levels of Chi2, ETR2, and LOX6 increased by 75.0%, 48.8%, and 48.1%, respectively, compared with plants treated with UV-B irradiation only (Figure 5a,b,d). PR1 was significantly upregulated by UV-B treatment (Figure 5c), which suggests the possibility of a slight increase in SAR. An increase in SAR can be determined by examining the accumulation of SA. However, the results of the inoculation test indicate that even if SAR is induced, its efficacy may be negligible. Despite the transient upregulation of defense-related genes after UV-B irradiation, these effects were stronger and more enduring after pathogen inoculation. The expression levels of all genes were similar between the pathogen-inoculated and NT groups. In contrast, plants inoculated with the pathogen after UV-B treatment showed higher expression levels of some genes than plants treated with UV-B alone. Thus, pathogen inoculation after UV-B treatment likely led to the upregulation of Chi2, ETR2, and LOX6. Our results suggest that although the initial treatment with UV-B did not have any major effect on gene expression, the secondary stimulus from powdery mildew inoculation strongly upregulated Chi2, ETR2, and LOX6. This combination of stimulants had a strong effect on the plant’s immune system, and may be an example of the priming effect [39]. However, this assumption is still unconfirmed. Further research is required to confirm the mode of action of UV-B and to clarify whether it has a priming effect in cucumber.
UV-B irradiation did not upregulate HSP70 (a heat shock protein) or HSFA2 and HSFB2 (heat shock transcriptional factors); however, inoculation with powdery mildew upregulated HSFA2 (Figure 6). Several studies have reported the involvement of HSFs in HST-induced HSIR, including HSFA2 and HSFB1 in tomatoes [6] and HSFB2 and HSFA2 in cucumbers [7,34]. This indicates that HSFs and SAR are jointly involved in HSIR. However, our results show that UV-B irradiation does not activate these HSF-mediated pathways and does not activate the SAR pathway to an adequate degree. Heat-shock-related genes were not strongly induced by UV-B irradiation, which supports the data shown in Figure 2 and Figure 3. Overall, these findings indicate that HSIR and UV-B operate via different underlying mechanisms. Expression of some genes were maintained even after 24 h of UV-B irradiation, suggesting the presence of a “memory” effect [40] in UV-B. After HS treatment, disease resistance persists for several days [9], but salicylic acid accumulation and PR gene expression show periodicity during this period [4,6,34]. This can be explained by the interpretation that HSIR has multiple pathways for inducing resistance, and that these pathways peak at different times, thus sustaining the effect. Similarly, the memory effect of UV-B may be explained by a combination of multiple reaction pathways, such as the production of flavonoid phytoalexin [41] by UV-B, Therefore, chronological change of gene expression, or preferentially, comprehensive analysis, such as transcriptome profiling is desirable.
UV-B irradiation and HST had similar preventive effects on powdery mildew infection in cucumber. When plants treated with UV-B irradiation or HST were inoculated with powdery mildew, infection was diminished and the plants showed no visible leaf injury under optimum conditions. Plant defense responses are activated through unidentified signaling pathways by both UV-B (280–320 nm) [30,42] and UV-C [43,44,45] irradiation. In this study, UV-B irradiation reduced disease severity and upregulated the expression of defense-related genes only in the UV-B-treated leaves. In other words, UV-B irradiation induced local resistance that was not signaled systemically. Although the signaling pathway of UV-B-induced resistance is still unclear at the level of photoproducts [32,46], our findings suggest that the basic mechanism of UV-induced resistance may differ from that of HST-induced HSIR.
The synergic effects of UV-B and HST were investigated to explore their effectiveness in reducing the symptoms of powdery mildew in cucumbers. Disease symptoms were significantly reduced by the UV-B (63.7%), heat shock (31.6%), and combined (72.0%) treatments (Figure 7). The combination treatment, where UV-B was applied 24 h after HST, was most effective at reducing the symptoms of powdery mildew, although it is not significantly different from UV-B alone. Several studies have reported the effects of UV-B and HST on inducing plant defense systems against pathogen infection. UV-B irradiation has been reported to reduce powdery mildew in strawberries [25] and rice blast fungus in rice [14]. Moreover, HST has been shown to induce plant resistance against gray mold [7,32] and powdery mildew [34] in cucumber and bacterial blight in tomato [6]. However, this study is the first to describe the potential synergistic effects of UV-B and HST in controlling the appearance of powdery mildew in cucumbers. Our results indicate that combined HST and UV-B reduce the symptoms of powdery mildew to a greater degree than UV-B or HST alone. Further, future investigation is needed to confirm the possible synergistic effect of both treatment in reducing PM infection in cucumber.

4. Conclusions

In conclusion, we investigated the mechanisms by which UV-B induces disease resistance in cucumber and compared them to the well-studied mechanisms of HST. Our findings suggest that UV-B likely uses a different mechanism from that of HST. Thus, using both treatments simultaneously will likely have greater preventive effects. Approximately 10 years have passed since the launch of the UV-B lighting system and detailed research into the mechanism of HSIR. Although there is limited knowledge in this field, future research into the practical applications of these technologies is expected to help develop integrated pest management systems.

Author Contributions

Conceptualization, D.M.F. and T.S.; methodology, D.M.F., A.D.K., N.A.A. and T.S.; software, D.M.F., A.D.K. and N.A.A.; validation, D.M.F., A.D.K. and T.S.; formal analysis, D.M.F., A.D.K. and T.S.; investigation, D.M.F., A.D.K., T.K., Y.Y. and T.S.; resources, D.M.F., A.D.K. and T.S.; data curation, D.M.F., A.D.K. and T.S.; writing—original draft preparation, D.M.F., A.D.K., A.W. and T.S.; writing—review and editing, A.D.K. and T.S.; visualization, D.M.F., A.D.K. and T.S.; supervision, M.Y., A.W., S.T. and T.S.; project administration, A.W. and T.S.; funding acquisition, T.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Japanese Ministry of Agriculture, Forestry and Fisheries under the plan “A Scheme to Revitalize Agriculture and Fisheries in Disaster Area through Deploying Highly Advanced Technology” and JSPS KAKENHI (grant number 17K07637).

Data Availability Statement

Not applicable.

Acknowledgments

The authors are grateful to the Ibaraki University Gene Research Center for technical support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Hirooka, T.; Ishii, H. Chemical control of plant diseases. Jpn. J. Phytopathol. 2014, 80, S172–S178. [Google Scholar] [CrossRef]
  2. Alewu, B.; Nosiri, C. Pesticides and human health. In Pesticides in the Modern World—Effects of Pesticides Exposure; Stoytcheva, M., Ed.; IntechOpen: London, UK, 2011. [Google Scholar] [CrossRef] [Green Version]
  3. Konishi, K.; Ogawara, T.; Shimamoto, K.; Tomita, Y. Hot water spraying for the control of anthracnose and gray mold on strawberry. Boll. Hortic. Inst. Ibaraki Agric. Cent. 2010, 17, 43–46. [Google Scholar]
  4. Widiastuti, A.; Yoshino, M.; Hasegawa, M.; Nitta, Y.; Sato, T. Heat shock-induced resistance increases chitinase-1 gene expression and stimulates salicylic acid production in melon (Cucumis melo L.). Physiol Mol. Plant Pathol. 2013, 82, 51–55. [Google Scholar] [CrossRef]
  5. Widiastuti, A.; Yoshino, M.; Saito, H.; Maejima, K.; Zhou, S.; Odani, H.; Narisawa, K.; Hasegawa, M.; Nitta, Y.; Sato, T. Heat shock-induced resistance in strawberry against crown rot fungus Colletotrichum gloeosporioides. Physiol. Mol. Plant Pathol. 2013, 84, 86–91. [Google Scholar] [CrossRef]
  6. Arofatullah, N.A.; Hasegawa, M.; Tanabata, S.; Ogiwara, I.; Sato, T. Heat shock-induced resistance against Pseudomonas syringae pv. tomato (Okabe) Young. et al via heat shock transcription factors in tomato. Agronomy 2019, 9, 2. [Google Scholar] [CrossRef] [Green Version]
  7. Kharisma, A.D.; Arofatullah, N.A.; Yamane, K.; Tanabata, S.; Sato, T. Regulation of defense responses via heat shock transcription factors in Cucumis sativus L. against Botrytis cinerea. J. Gen. Plant Pathol. 2022, 88, 17–28. [Google Scholar] [CrossRef]
  8. Sato, T.; Saito, H.; Maejima, K.; Kuba, K.; Widiastuti, A.; Yoshino, M. Preventive effect and mode of action of repetitive hot water spraying against powdery mildew in strawberry. Hortic. J. 2018, 87, 193–199. [Google Scholar] [CrossRef] [Green Version]
  9. Widiastuti, A.; Yoshino, M.; Saito, H.; Maejima, K.; Zhou, S.; Odani, H.; Hasegawa, M.; Nitta, Y.; Sato, T. Induction of disease resistance against Botrytis cinerea by heat shock treatment in melon (Cucumis melo L.). Physiol. Mol. Plant Pathol. 2011, 75, 157–162. [Google Scholar] [CrossRef]
  10. Kobayashi, M.; Kanto, T.; Fujikawa, T.; Yamada, M.; Ishiwata, M.; Satou, M.; Hisamatsu, T. Supplemental UV radiation controls rose powdery mildew disease under the greenhouse conditions. Environ. Control. Biol. 2014, 51, 157–163. [Google Scholar] [CrossRef]
  11. Kobayashi, T.; Ito, K.; Yokoda, Y.; Sato, T.; Yamada, M. Control of powdery mildew disease in cucumber and tomato seedlings by supplemental UV-B irradiation. Hort. Res. 2019, 18, 65–71. [Google Scholar] [CrossRef]
  12. Meyer, P.; Van de Poel, B.; De Coninck, B. UV-B light and its application potential to reduce disease and pest incidence in crops. Hortic. Res. 2021, 8, 194. [Google Scholar] [CrossRef]
  13. Kanto, T.; Matsuura, K.; Yamada, M.; Usami, T.; Amemiya, Y. UV-B radiation for control of strawberry powdery mildew. Acta Hortic. 2009, 842, 359–362. [Google Scholar] [CrossRef]
  14. Li, X.; He, Y.; Xie, C.; Zu, Y.; Zhan, F.; Mei, X.; Xia, Y.; Li, Y. Effects of UV-B radiation on the infectivity of Magnaporthe oryzae and rice disease-resistant physiology in Yuanyang terraces. Photochem. Photobiol. Sci. 2018, 17, 8–17. [Google Scholar] [CrossRef]
  15. Demkura, P.V.; Ballaré, C.L. UVR8 mediates UV-B-induced Arabidopsis defense responses against Botrytis cinerea by controlling sinapate accumulation. Mol. Plant 2012, 5, 642–652. [Google Scholar] [CrossRef]
  16. Stermer, B.A.; Hammerschmidt, R. Heat shock induces resistance to Cladosporium cucumerinum and enhances peroxidase activity in cucumbers. Physiol. Plant Pathol. 1984, 25, 239–249. [Google Scholar] [CrossRef]
  17. Sato, T.; Kubo, M. Reducing the need for chemical spraying of summer greenhouse cucumber: Heat-shock controls disease and insect damage. Acta Hortic. 2002, 588, 165–170. [Google Scholar] [CrossRef]
  18. Sato, T.; Kubo, M.; Watanabe, S. Heat shock induces a systemic acquired resistance (SAR)-related gene via salicylic acid accumulation in cucumber (Cucumis sativus L.). Trop. Agric. 2003, 47, 77–82. [Google Scholar]
  19. Okayama, K.; Sugimura, T.; Matsutani, S. Effects of heat and high humidity treatment on the occurrence of strawberry powdery mildew. Boll. Nara Agric. Exp. Stn. 1997, 28, 29–34. [Google Scholar]
  20. Koitabashi, M.; Nakashima, M.; Kashio, T.; Nishimura, N. Pest control test of powdery mildew and spider mite by hot water treatment on strawberry. Jpn. J. Phytopathol. 2002, 68, 197. [Google Scholar]
  21. Arofatullah, N.A.; Widiastuti, A.; Chinta, Y.D.; Kobayashi, T.; Tanabata, S.; Sato, T. Prevention of powdery mildew disease in tomato nursery by improved hot water spraying device. Jpn. J. Farm. Work Res. 2019, 54, 15–23. [Google Scholar] [CrossRef] [Green Version]
  22. Suthaparan, A.; Stensvand, A.; Solhaug, K.A.; Torre, S.; Telfer, K.H.; Ruud, A.K.; Mortensen, L.M.; Gadoury, D.M.; Seem, R.C.; Gislerød, H.R. Suppression of cucumber powdery mildew by supplemental UV-B radiation in greenhouses can be augmented or reduced by background radiation quality. Plant Dis. 2014, 98, 1349–1357. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Austin, C.N.; Wilcox, W.F. Effects of sunlight exposure on grapevine powdery mildew development. Phytopathology 2012, 102, 857–866. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Wargent, J.J.; Taylor, A.; Paul, N.D. UV supplementation for growth regulation and disease control. Acta Hortic. 2006, 711, 333–338. [Google Scholar] [CrossRef]
  25. Satou, M.; Kobayashi, M.; Kanto, T.; Sugawara, K.; Yamada, M.; Ishiwata, M. Suppression of anthracnose of Russel prairie gentian by UV-B irradiation. Annu. Rep. Kanto-Tosan Plant Prot. Soc. 2013, 60, 79–81. [Google Scholar] [CrossRef]
  26. Kanto, T.; Matsuura, K.; Ogawa, T.; Yamada, M.; Ishiwata, M.; Usami, T.; Amemiya, Y. A new UV-B lighting system controls powdery mildew of strawberry. Acta Hortic. 2014, 1049, 655–660. [Google Scholar] [CrossRef]
  27. Oka, K.; Yamada, M.; Ishiwata, M.; Okada, K. Expression of UV-B-induced resistant response in eggplant and control of leaf mold on greenhouse-grown eggplant. Jpn. J. Phytopathol. 2011, 77, 23–27. [Google Scholar] [CrossRef] [Green Version]
  28. He, Y.; Li, X.; Zhan, F.; Xie, C.; Zu, Y.; Li, Y.; Yue, M. Resistance-related physiological response of rice leaves to the compound stress of enhanced UV-B radiation and Magnaporthe oryzae. J. Plant Interact. 2018, 13, 321–328. [Google Scholar] [CrossRef] [Green Version]
  29. Mackerness, S.A.-H.; Surplus, S.L.; Blake, P.; John, C.F.; Buchanan-Wollaston, V.; Jordan, B.R.; Thomas, B. Ultraviolet-B-induced stress and changes in gene expression in Arabidopsis thaliana: Role of signalling pathways controlled by jasmonic acid, ethylene and reactive oxygen species. Plant Cell Environ. 1999, 22, 1413–1423. [Google Scholar] [CrossRef]
  30. Fujibe, T.; Watanabe, K.; Nakajima, N.; Ohashi, Y.; Mitsuhara, I.; Yamamoto, K.T.; Takeuchi, Y. Accumulation of pathogenesis-related proteins in tobacco leaves irradiated with UV-B. J. Plant Res. 2000, 113, 387–394. [Google Scholar] [CrossRef]
  31. Green, R.; Fluhr, R. UV-B-induced PR-1 accumulation is mediated by active oxygen species. Plant Cell 1995, 7, 203–212. [Google Scholar] [CrossRef] [Green Version]
  32. Yoshino, M.; Widiastuti, A.; Hasegawa, M.; Sato, T. Induction of disease resistance against gray mold by heat shock using hot water dipping in cucumber and its underlying mechanism. Hort. Res. 2011, 10, 429–433. [Google Scholar] [CrossRef] [Green Version]
  33. Casati, P.; Walbot, V. Rapid transcriptome responses of maize (Zea mays) to UV-B in irradiated and shielded tissues. Genome Biol. 2004, 5, R16. [Google Scholar] [CrossRef] [Green Version]
  34. Widiastuti, A.; Arofatullah, N.A.; Kharisma, A.D.; Sato, T. Upregulation of heat shock transcription factors, Hsp70, and defense-related genes in heat shock-induced resistance against powdery mildew in cucumber. Physiol. Mol. Plant Pathol. 2021, 116, 101730. [Google Scholar] [CrossRef]
  35. Kanda, Y. Investigation of the freely available easy-to-use software ‘EZR’ for medical statistics. Bone Marrow TransPlant 2013, 48, 452–458. [Google Scholar] [CrossRef] [Green Version]
  36. Suthaparan, A.; Torre, S.; Mortensen, L.M.; Gislerød, H.R.; Stensvand, A.; Solhaug, K.A.; Gadoury, D.M. Interruption of the night period by UV-B suppresses powdery mildew of rose and cucumber. Acta Hortic. 2012, 956, 617–620. [Google Scholar] [CrossRef]
  37. Suthaparan, A.; Solhaug, K.A.; Bjugstad, N.; Gislerød, H.R.; Gadoury, D.M.; Stensvand, A. Suppression of powdery mildews by UV-B: Application frequency and timing, dose, reflectance, and automation. Plant Dis. 2016, 100, 1643–1650. [Google Scholar] [CrossRef] [Green Version]
  38. Shoresh, M.; Yedidia, I.; Chet, I. Involvement of jasmonic acid/ethylene signaling pathway in the systemic resistance induced in cucumber by Trichoderma asperellum T203. Phytopathology 2005, 95, 76–84. [Google Scholar] [CrossRef] [Green Version]
  39. Conrath, U.; Pieterse, C.M.; Mauch-Mani, B.; Mauch-Mani, B. Priming in plant-pathogen interactions. Trends Plant Sci. 2002, 7, 210–216. [Google Scholar] [CrossRef] [Green Version]
  40. Oyoshi, K.; Katano, K.; Yunose, M.; Suzuki, N. Memory of 5-min heat stress in Arabidopsis thaliana. Plant Signal. Behav. 2020, 8, 1778919. [Google Scholar] [CrossRef]
  41. Fawe, A.; Abou-Zaid, M.; Menzies, J.G.; Bélanger, R.R. Silicon-Mediated Accumulation of Flavonoid Phytoalexins in Cucumber. Biochem. Cell Biol. 1998, 8, 396–401. [Google Scholar] [CrossRef] [Green Version]
  42. Sävenstrand, H.; Brosché, M.; Strid, A. Ultraviolet-B signalling: Arabidopsis brassinosteroid mutants are defective in UV-B regulated defence gene expression. Plant Physiol. Biochem. 2004, 42, 687–694. [Google Scholar] [CrossRef] [PubMed]
  43. Kunz, B.A.; Dando, P.K.; Grice, D.M.; Mohr, P.G.; Schenk, P.M.; Cahill, D.M. UV-induced DNA damage promotes resistance to the biotrophic pathogen Hyaloperonospora parasitica in Arabidopsis. Plant Physiol. 2008, 148, 1021–1031. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. El Ghaouth, A.; Wilson, C.L.; Callahan, A.M. Induction of chitinase, β-1,3-glucanase, and phenylalanine ammonia lyase in peach fruit by UV-C treatment. Phytopathology 2003, 93, 349–355. [Google Scholar] [CrossRef] [PubMed]
  45. Bonomelli, A.; Mercier, L.; Franchel, J.; Baillieul, F.; Benizri, E.; Mauro, M.C. Response of grapevine defenses to UV-C exposure. Am. J. Enol. Vitic. 2004, 55, 51–59. [Google Scholar] [CrossRef]
  46. Kalbin, G.; Hidema, J.; Brosché, M.; Kumagai, T.; Bornman, J.F.; Strid, Å. UV-B-induced DNA damage and expression of defence genes under UV-B stress: Tissue-specific molecular marker analysis in leaves. Plant Cell Environ. 2001, 24, 983–990. [Google Scholar] [CrossRef]
Agronomy 12 03011 g001 550
Figure 1. Preventive effect of UV-B treatment against powdery mildew in cucumber. NT: non-treatment; 5:5 μW/cm2 for 4 h/d; 15:15 μW/cm2 for 4 h/d. The disease index is based on a 0–4 rating scale applied to the first leaf on each plant 7 d post-inoculation. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 9; Tukey’s test, p < 0.05).
Figure 1. Preventive effect of UV-B treatment against powdery mildew in cucumber. NT: non-treatment; 5:5 μW/cm2 for 4 h/d; 15:15 μW/cm2 for 4 h/d. The disease index is based on a 0–4 rating scale applied to the first leaf on each plant 7 d post-inoculation. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 9; Tukey’s test, p < 0.05).
Agronomy 12 03011 g001
Agronomy 12 03011 g002 550
Figure 2. Preventive effect of partial UV-B treatment against powdery mildew in cucumber. NT: non-treatment; shading +: one of two leaves shaded by aluminum foil; shading −: non-shaded leaf. The disease index is based on a 0–4 rating scale applied to the first leaf on each plant 7 d post-inoculation. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 6; Tukey’s test, p < 0.05).
Figure 2. Preventive effect of partial UV-B treatment against powdery mildew in cucumber. NT: non-treatment; shading +: one of two leaves shaded by aluminum foil; shading −: non-shaded leaf. The disease index is based on a 0–4 rating scale applied to the first leaf on each plant 7 d post-inoculation. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 6; Tukey’s test, p < 0.05).
Agronomy 12 03011 g002
Agronomy 12 03011 g003 550
Figure 3. Relative expression levels of Chi2, ETR2, and LOX6 in cucumber leaves after partial UV-B treatment. (a) Chi2, (b) LOX6, (c) ETR2. NT: non-treatment; shading +: one of two leaves shaded by aluminum foil, shading −: non-shaded leaf. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 6). The transcript levels of each gene are normalized to Act expression.
Figure 3. Relative expression levels of Chi2, ETR2, and LOX6 in cucumber leaves after partial UV-B treatment. (a) Chi2, (b) LOX6, (c) ETR2. NT: non-treatment; shading +: one of two leaves shaded by aluminum foil, shading −: non-shaded leaf. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 6). The transcript levels of each gene are normalized to Act expression.
Agronomy 12 03011 g003
Agronomy 12 03011 g004 550
Figure 4. Relative expression levels of Chi2, ETR2, and LOX6 in cucumber leaves after partial heat shock (HS) treatment. (a) Chi2, (b) LOX6, (c) ETR2. NT: non-treatment. +: One of two leaves dipped into hot water at 50 °C for 20 s. −: leaves not treated with heat shock. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 6). The transcript levels of each gene are normalized to Act expression.
Figure 4. Relative expression levels of Chi2, ETR2, and LOX6 in cucumber leaves after partial heat shock (HS) treatment. (a) Chi2, (b) LOX6, (c) ETR2. NT: non-treatment. +: One of two leaves dipped into hot water at 50 °C for 20 s. −: leaves not treated with heat shock. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 6). The transcript levels of each gene are normalized to Act expression.
Agronomy 12 03011 g004
Agronomy 12 03011 g005 550
Figure 5. Relative expression levels of Chi2, ETR2, PR1, and LOX6 in cucumber leaves after treatment with UV-B, powdery mildew inoculation, or combined UV-B + powdery mildew inoculation. (a) Chi2, (b) ETR2, (c) PR1, (d) LOX6. NT: no UV-B irradiation; UV: UV-B irradiation; I: powdery mildew inoculation; UV+I: UV-B irradiation followed by powdery mildew inoculation 24 h after UV treatment. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 6; Tukey’s test, p < 0.05). The transcript levels of each gene are normalized to Act expression.
Figure 5. Relative expression levels of Chi2, ETR2, PR1, and LOX6 in cucumber leaves after treatment with UV-B, powdery mildew inoculation, or combined UV-B + powdery mildew inoculation. (a) Chi2, (b) ETR2, (c) PR1, (d) LOX6. NT: no UV-B irradiation; UV: UV-B irradiation; I: powdery mildew inoculation; UV+I: UV-B irradiation followed by powdery mildew inoculation 24 h after UV treatment. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 6; Tukey’s test, p < 0.05). The transcript levels of each gene are normalized to Act expression.
Agronomy 12 03011 g005
Agronomy 12 03011 g006 550
Figure 6. Relative expression levels of HSFA2, HSFB2, and HSP70 in cucumber leaves after UV-B treatment, powdery mildew inoculation, or combined UV-B + powdery mildew inoculation. (a) HSFA2, (b) HSFB2, (c) HSP70. NT: non-treatment; UV: UV-B irradiation; I: powdery mildew inoculation; UV+I: UV-B irradiation followed by powdery mildew inoculation 24 h after UV treatment. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 6; Tukey’s test, p < 0.05). The transcript levels of each gene are normalized to Act expression.
Figure 6. Relative expression levels of HSFA2, HSFB2, and HSP70 in cucumber leaves after UV-B treatment, powdery mildew inoculation, or combined UV-B + powdery mildew inoculation. (a) HSFA2, (b) HSFB2, (c) HSP70. NT: non-treatment; UV: UV-B irradiation; I: powdery mildew inoculation; UV+I: UV-B irradiation followed by powdery mildew inoculation 24 h after UV treatment. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 6; Tukey’s test, p < 0.05). The transcript levels of each gene are normalized to Act expression.
Agronomy 12 03011 g006
Agronomy 12 03011 g007 550
Figure 7. Preventive effects of UV-B, HS, and combined HST and UV-B against powdery mildew in cucumber. HS+UVB: combined UVB and HST; UVB: UVB treatment; HST: heat shock treatment; NT: no UVB or HST. All treatments were followed by inoculation with powdery mildew. The disease index is based on a 0–4 rating scale applied to the first leaf on each plant 33 d post-inoculation. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 6; Tukey’s test, p < 0.05).
Figure 7. Preventive effects of UV-B, HS, and combined HST and UV-B against powdery mildew in cucumber. HS+UVB: combined UVB and HST; UVB: UVB treatment; HST: heat shock treatment; NT: no UVB or HST. All treatments were followed by inoculation with powdery mildew. The disease index is based on a 0–4 rating scale applied to the first leaf on each plant 33 d post-inoculation. Different letters above columns indicate a significant difference between treatments. Vertical bars represent the standard error of the mean (n = 6; Tukey’s test, p < 0.05).
Agronomy 12 03011 g007
Table
Table 1. Primers used for the amplification of cucumber genes related to pathogen resistance and heat shock.
Table 1. Primers used for the amplification of cucumber genes related to pathogen resistance and heat shock.
Target GenesPropertiesSequences (5′–3′)
Chi2acidic endochitinaseAGGTCCTCCTCTCTATCGGTG
NM_001308904.1GGCGCGGCAGATAAAATGAC
ETR2ethylene receptor 2GAGTGTCAGCGTGTGAGTGA
NM_001308840.1GGAAACCAGGGCGGTAAGAA
LOX6lipoxygenase 6CTGGGAGGTTGAAGGCTCTG
XM_004135257.3CATGGTCCCTCAGCCAAGAA
PR1pathogenesys-related protein 1CGGGACAGACTCACCTCAAG
XM_011660558.2GGCTTCTCATCCACCCACAA
HSFB2heat shock transcription factor B2CGGCAAGACAGGTGATGGAA
XM_031885273.1TCATCCAACGGTTCCGCTTT
HSFA2heat shock transcription factor A2AGAAGCACGTTAATGGCGGA
XM_031880532.1CACTTGGGCTGGCAGTTAGT
HSP70heat shock protein 70GGGACCAGTGAAGAAAGCCA
NM_001305774.1GAGGGGCAACGTCAAGAAGA
ActinActinTCTGTCCCTCTACGCTAGTGGAC
AB698859.1TCCAAACGGAGAATGGCATGAGG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Fardhani, D.M.; Kharisma, A.D.; Kobayashi, T.; Arofatullah, N.A.; Yamada, M.; Tanabata, S.; Yokoda, Y.; Widiastuti, A.; Sato, T. Ultraviolet-B Irradiation Induces Resistance against Powdery Mildew in Cucumber (Cucumis sativus L.) through a Different Mechanism Than That of Heat Shock-Induced Resistance. Agronomy 2022, 12, 3011. https://doi.org/10.3390/agronomy12123011

AMA Style

Fardhani DM, Kharisma AD, Kobayashi T, Arofatullah NA, Yamada M, Tanabata S, Yokoda Y, Widiastuti A, Sato T. Ultraviolet-B Irradiation Induces Resistance against Powdery Mildew in Cucumber (Cucumis sativus L.) through a Different Mechanism Than That of Heat Shock-Induced Resistance. Agronomy. 2022; 12(12):3011. https://doi.org/10.3390/agronomy12123011

Chicago/Turabian Style

Fardhani, Dinar Mindrati, Agung Dian Kharisma, Tomoyuki Kobayashi, Nur Akbar Arofatullah, Makoto Yamada, Sayuri Tanabata, Yumi Yokoda, Ani Widiastuti, and Tatsuo Sato. 2022. "Ultraviolet-B Irradiation Induces Resistance against Powdery Mildew in Cucumber (Cucumis sativus L.) through a Different Mechanism Than That of Heat Shock-Induced Resistance" Agronomy 12, no. 12: 3011. https://doi.org/10.3390/agronomy12123011

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop