Design, Synthesis, and Comparison of PLA-PEG-PLA and PEG-PLA-PEG Copolymers for Curcumin Delivery to Cancer Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Force Field
2.2. Copolymers and Biomembrane Preparation
2.3. MD Simulations
2.4. Binding Free Energy Analysis
2.5. Materials
2.6. Synthesis of PLA-PEG-PLA Copolymer
2.7. Synthesis of PEG-PLA-PEG Copolymer
2.8. Measurement of Curcumin-Encapsulation Efficiency
2.9. In Vitro Release Study
2.10. Cell Culture
2.11. In Vitro Cell Viability Assay
2.12. Gene Expression Studies
2.13. Statistical Analysis
3. Results
3.1. Preliminary Molecular Dynamics Analysis
3.2. Prediction of Block Copolymer Properties
3.3. Membrane Penetration
3.4. Energy Calculations
3.5. Characterization of Synthesized Copolymers
3.6. Encapsulation Efficiency and Drug Loading
3.7. In Vitro Drug-Release Study
3.8. Cell Viability Studies
3.9. Gene Expression Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Behl, A.; Chhillar, A.K. Nano-Based Drug Delivery of Anticancer Chemotherapeutic Drugs Targeting Breast Cancer. Recent Pat Anticancer Drug Discov. 2023, 18, 325–342. [Google Scholar]
- Narvekar, M.; Xue, H.Y.; Eoh, J.Y.; Wong, H.L. Nanocarrier for poorly water-soluble anticancer drugs--barriers of translation and solutions. AAPS PharmSciTech 2014, 15, 822–833. [Google Scholar] [CrossRef]
- Veselov, V.V.; Nosyrev, A.E.; Jicsinszky, L.; Alyautdin, R.N.; Cravotto, G. Targeted Delivery Methods for Anticancer Drugs. Cancers 2022, 14, 622. [Google Scholar] [CrossRef] [PubMed]
- Asemaneh, H.R.; Rajabi, L.; Dabirian, F.; Rostami, N.; Derakhshan, A.A.; Davarnejad, R. Functionalized Graphene Oxide/Polyacrylonitrile Nanofibrous Composite: Pb2+ and Cd2+ Cations Adsorption. Int. J. Eng. 2020, 33, 1048–1053. [Google Scholar]
- Kumari, P.; Ghosh, B.; Biswas, S. Nanocarriers for cancer-targeted drug delivery. J. Drug Target. 2016, 24, 179–191. [Google Scholar] [CrossRef]
- Khan, N.H.; Mir, M.; Qian, L.; Baloch, M.; Ali Khan, M.F.; Rehman, A.U.; Ngowi, E.E.; Wu, D.D.; Ji, X.Y. Skin cancer biology and barriers to treatment: Recent applications of polymeric micro/nanostructures. J. Adv. Res. 2022, 36, 223–247. [Google Scholar] [CrossRef]
- Kuperkar, K.; Patel, D.; Atanase, L.I.; Bahadur, P. Amphiphilic Block Copolymers: Their Structures, and Self-Assembly to Polymeric Micelles and Polymersomes as Drug Delivery Vehicles. Polymers 2022, 14, 4702. [Google Scholar] [CrossRef]
- Lv, Y.; Yang, B.; Jiang, T.; Li, Y.M.; He, F.; Zhuo, R.X. Folate-conjugated amphiphilic block copolymers for targeted and efficient delivery of doxorubicin. Colloids Surf B Biointerfaces 2014, 115, 253–259. [Google Scholar] [CrossRef]
- Alvarez-Lorenzo, C.; Sosnik, A.; Concheiro, A. PEO-PPO block copolymers for passive micellar targeting and overcoming multidrug resistance in cancer therapy. Curr. Drug Targets 2011, 12, 1112–1130. [Google Scholar] [CrossRef] [PubMed]
- Bai, T.; Shao, D.; Chen, J.; Li, Y.; Xu, B.B.; Kong, J. pH-responsive dithiomaleimide-amphiphilic block copolymer for drug delivery and cellular imaging. J. Colloid Interface Sci. 2019, 552, 439–447. [Google Scholar] [CrossRef] [PubMed]
- Sahkulubey Kahveci, E.L.; Kahveci, M.U.; Celebi, A.; Avsar, T.; Derman, S. Glycopolymer and Poly(β-amino ester)-Based Amphiphilic Block Copolymer as a Drug Carrier. Biomacromolecules 2022, 23, 4896–4908. [Google Scholar] [CrossRef]
- Xu, H.; Yang, P.; Ma, H.; Yin, W.; Wu, X.; Wang, H.; Xu, D.; Zhang, X. Amphiphilic block copolymers-based mixed micelles for noninvasive drug delivery. Drug Deliv. 2016, 23, 3063–3071. [Google Scholar] [CrossRef]
- Wei, J.; Lin, F.; You, D.; Qian, Y.; Wang, Y.; Bi, Y. Self-Assembly and Enzyme Responsiveness of Amphiphilic Linear-Dendritic Block Copolymers Based on Poly(N-vinylpyrrolidone) and Dendritic Phenylalanyl-lysine Dipeptides. Polymers 2019, 11, 1625. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Guo, X.; Hao, L.; Zhang, X.; Lin, Q.; Sheng, R. Charge-Convertible and Reduction-Sensitive Cholesterol-Containing Amphiphilic Copolymers for Improved Doxorubicin Delivery. Materials 2022, 15, 6476. [Google Scholar] [CrossRef] [PubMed]
- Qian, X.; Xia, C.; Chen, X.; Li, Q.; Li, D. Self-assembled amphiphilic copolymers-doxorubicin conjugated nanoparticles for gastric cancer therapy with low in vivo toxicity and high efficacy. J. Biomater. Sci. Polym. Ed. 2022, 33, 2202–2219. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Olofsson, K.; Fan, Y.; Sánchez, C.C.; Andrén, O.C.J.; Qin, L.; Fortuin, L.; Jonsson, E.M.; Malkoch, M. Novel Therapeutic Platform of Micelles and Nanogels from Dopa-Functionalized Triblock Copolymers. Small 2021, 17, e2007305. [Google Scholar] [CrossRef]
- Wu, W.; Chen, M.; Luo, T.; Fan, Y.; Zhang, J.; Zhang, Y.; Zhang, Q.; Sapin-Minet, A.; Gaucher, C.; Xia, X. ROS and GSH-responsive S-nitrosoglutathione functionalized polymeric nanoparticles to overcome multidrug resistance in cancer. Acta Biomater. 2020, 103, 259–271. [Google Scholar] [CrossRef]
- Li, M.; Xu, J.W.; Li, J.; Wang, W.; Luo, C.; Han, H.; Xu, Z.K.; Yao, K. A novel gatifloxacin-loaded intraocular lens for prophylaxis of postoperative endophthalmitis. Bioact. Mater. 2023, 20, 271–285. [Google Scholar] [CrossRef]
- Ahmad, R.; Bae, A.J.; Su, Y.J.; Pozveh, S.G.; Bodenschatz, E.; Pumir, A.; Gholami, A. Bio-hybrid micro-swimmers propelled by flagella isolated from C. reinhardtii. Soft Matter 2022, 18, 4767–4777. [Google Scholar] [CrossRef]
- Amani, A.; Kabiri, T.; Shafiee, S.; Hamidi, A. Preparation and Characterization of PLA-PEG-PLA/PEI/DNA Nanoparticles for Improvement of Transfection Efficiency and Controlled Release of DNA in Gene Delivery Systems. Iran. J. Pharm. Res. 2019, 18, 125–141. [Google Scholar]
- Ghasemi, R.; Abdollahi, M.; Emamgholi Zadeh, E.; Khodabakhshi, K.; Badeli, A.; Bagheri, H.; Hosseinkhani, S. mPEG-PLA and PLA-PEG-PLA nanoparticles as new carriers for delivery of recombinant human Growth Hormone (rhGH). Sci. Rep. 2018, 8, 9854. [Google Scholar] [CrossRef] [PubMed]
- Liu, K.; Zhang, H.L.; Pan, L.H.; Li, Q.M.; Luo, J.P.; Zha, X.Q. The nanomicelles consisting of lotus root amylopectin and quinoa protein: Construction and encapsulation for quercetin. Food Chem. 2022, 387, 132924. [Google Scholar] [CrossRef] [PubMed]
- Machado, M.G.C.; Pound-Lana, G.; de Oliveira, M.A.; Lanna, E.G.; Fialho, M.C.P.; de Brito, A.C.F.; Barboza, A.P.M.; Aguiar-Soares, R.D.O.; Mosqueira, V.C.F. Labeling PLA-PEG nanocarriers with IR780: Physical entrapment versus covalent attachment to polylactide. Drug Deliv. Transl. Res. 2020, 10, 1626–1643. [Google Scholar] [CrossRef]
- Rostami, N.; Davarnejad, R. Characterization of folic acid-functionalized PLA-PEG nanomicelle to deliver Letrozole: A nanoinformatics study. IET Nanobiotechnol. 2022, 16, 103–114. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; MacKerell, A.D., Jr. CHARMM36 all-atom additive protein force field: Validation based on comparison to NMR data. J. Comput. Chem. 2013, 34, 2135–2145. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; Klauda, J.B. Update of the CHARMM36 United Atom Chain Model for Hydrocarbons and Phospholipids. J. Phys. Chem. B 2020, 124, 6797–6812. [Google Scholar] [CrossRef]
- Jo, S.; Cheng, X.; Lee, J.; Kim, S.; Park, S.J.; Patel, D.S.; Beaven, A.H.; Lee, K.I.; Rui, H.; Park, S.; et al. CHARMM-GUI 10 years for biomolecular modeling and simulation. J. Comput. Chem. 2017, 38, 1114–1124. [Google Scholar] [CrossRef]
- Mahmoudi Gomari, M.; Rostami, N.; Ghodrati, A.; Hernandez, Y.; Fadaie, M.; Sadegh Eslami, S.; Tarighi, P. Implementation of docking, molecular dynamics and free energy to investigate drug potency of novel BCR-ABLT315I inhibitors as an alternative to ponatinib. Comput. Toxicol. 2021, 20, 100180. [Google Scholar] [CrossRef]
- Pandit, S.A.; Bostick, D.; Berkowitz, M.L. Molecular Dynamics Simulation of a Dipalmitoylphosphatidylcholine Bilayer with NaCl. Biophys. J. 2003, 84, 3743–3750. [Google Scholar] [CrossRef]
- Van Der Spoel, D.; Lindahl, E.; Hess, B.; Groenhof, G.; Mark, A.E.; Berendsen, H.J. GROMACS: Fast, flexible, and free. J. Comput. Chem. 2005, 26, 1701–1718. [Google Scholar] [CrossRef]
- Kutzner, C.; Páll, S.; Fechner, M.; Esztermann, A.; de Groot, B.L.; Grubmüller, H. More bang for your buck: Improved use of GPU nodes for GROMACS 2018. J. Comput. Chem. 2019, 40, 2418–2431. [Google Scholar] [CrossRef] [PubMed]
- Karwasra, R.; Fatihi, S.; Raza, K.; Singh, S.; Khanna, K.; Sharma, S.; Sharma, N.; Varma, S. Filgrastim loading in PLGA and SLN nanoparticulate system: A bioinformatics approach. Drug Dev. Ind. Pharm. 2020, 46, 1354–1361. [Google Scholar] [CrossRef] [PubMed]
- Gomari, M.M.; Tarighi, P.; Choupani, E.; Abkhiz, S.; Mohamadzadeh, M.; Rostami, N.; Sadroddiny, E.; Baammi, S.; Uversky, V.N.; Dokholyan, N.V. Structural evolution of Delta lineage of SARS-CoV-2. Int. J. Biol. Macromol. 2023, 226, 1116–1140. [Google Scholar] [CrossRef] [PubMed]
- Gupta, R.; Badhe, Y.; Mitragotri, S.; Rai, B. Permeation of nanoparticles across the intestinal lipid membrane: Dependence on shape and surface chemistry studied through molecular simulations. Nanoscale 2020, 12, 6318–6333. [Google Scholar] [CrossRef]
- Dos Santos, M.A.F.; Habitzreuter, M.A.; Schwade, M.H.; Borrasca, R.; Antonacci, M.; Gonzatti, G.K.; Netz, P.A.; Barbosa, M.C. Dynamical aspects of supercooled TIP3P-water in the grooves of DNA. J. Chem. Phys. 2019, 150, 235101. [Google Scholar] [CrossRef] [PubMed]
- Yousefpour, A.; Modarress, H.; Goharpey, F.; Amjad-Iranagh, S. Interaction of PEGylated anti-hypertensive drugs, amlodipine, atenolol and lisinopril with lipid bilayer membrane: A molecular dynamics simulation study. Biochim. Biophys. Acta 2015, 1848, 1687–1698. [Google Scholar] [CrossRef]
- Watanabe, C.; Watanabe, H.; Fukuzawa, K.; Parker, L.J.; Okiyama, Y.; Yuki, H.; Yokoyama, S.; Nakano, H.; Tanaka, S.; Honma, T. Theoretical Analysis of Activity Cliffs among Benzofuranone-Class Pim1 Inhibitors Using the Fragment Molecular Orbital Method with Molecular Mechanics Poisson-Boltzmann Surface Area (FMO+MM-PBSA) Approach. J. Chem. Inf. Model. 2017, 57, 2996–3010. [Google Scholar] [CrossRef]
- Kumari, R.; Kumar, R.; Lynn, A. g_mmpbsa—A GROMACS tool for high-throughput MM-PBSA calculations. J. Chem. Inf. Model. 2014, 54, 1951–1962. [Google Scholar] [CrossRef]
- Kricheldorf, H.R.; Weidner, S.M. The Ring-Opening Polymerization-Polycondensation (ROPPOC) Approach to Cyclic Polymers. Macromol. Rapid Commun. 2020, 41, e2000152. [Google Scholar] [CrossRef]
- Puttreddy, R.; Rautiainen, J.M.; Mäkelä, T.; Rissanen, K. Strong N-X···O-N Halogen Bonds: A Comprehensive Study on N-Halosaccharin Pyridine N-Oxide Complexes. Angew. Chem. Int. Ed. Engl. 2019, 58, 18610–18618. [Google Scholar] [CrossRef]
- Mutalik, S.; Suthar, N.A.; Managuli, R.S.; Shetty, P.K.; Avadhani, K.; Kalthur, G.; Kulkarni, R.V.; Thomas, R. Development and performance evaluation of novel nanoparticles of a grafted copolymer loaded with curcumin. Int. J. Biol. Macromol. 2016, 86, 709–720. [Google Scholar] [CrossRef]
- Rostami, N.; Gomari, M.M.; Abdouss, M.; Moeinzadeh, A.; Choupani, E.; Davarnejad, R.; Heidari, R.; Bencherif, S.A. Synthesis and Characterization of Folic Acid-Functionalized DPLA-co-PEG Nanomicelles for the Targeted Delivery of Letrozole. ACS Appl. Bio Mater. 2023, 6, 1806–1815. [Google Scholar] [CrossRef]
- Fan, Y.; Marioli, M.; Zhang, K. Analytical characterization of liposomes and other lipid nanoparticles for drug delivery. J. Pharm. Biomed. Anal. 2021, 192, 113642. [Google Scholar] [CrossRef] [PubMed]
- Joudeh, N.; Linke, D. Nanoparticle classification, physicochemical properties, characterization, and applications: A comprehensive review for biologists. J. Nanobiotechnol. 2022, 20, 262. [Google Scholar] [CrossRef] [PubMed]
- Puig-Rigall, J.; Fernández-Rubio, C.; González-Benito, J.; Houston, J.E.; Radulescu, A.; Nguewa, P.; González-Gaitano, G. Structural characterization by scattering and spectroscopic methods and biological evaluation of polymeric micelles of poloxamines and TPGS as nanocarriers for miltefosine delivery. Int. J. Pharm. 2020, 578, 119057. [Google Scholar] [CrossRef] [PubMed]
- Ahmad Fauzi, A.A.; Osman, A.F.; Alosime, E.M.; Ibrahim, I.; Abdul Halim, K.A.; Ismail, H. Strategies towards Producing Non-Polar Dolomite Nanoparticles as Nanofiller for Copolymer Nanocomposite. Int. J. Mol. Sci. 2022, 23, 12620. [Google Scholar] [CrossRef]
- Abdulkareem, U.; Kartha, T.R.; Madhurima, V. Radial distribution and hydrogen bonded network graphs of alcohol-aniline binary mixture. J. Mol. Model. 2023, 29, 151. [Google Scholar] [CrossRef]
- Mirzaei, H.; Shakeri, A.; Rashidi, B.; Jalili, A.; Banikazemi, Z.; Sahebkar, A. Phytosomal curcumin: A review of pharmacokinetic, experimental and clinical studies. Biomed. Pharmacother. 2017, 85, 102–112. [Google Scholar] [CrossRef]
- Hardwick, J.M.; Soane, L. Multiple functions of BCL-2 family proteins. Cold Spring Harb. Perspect. Biol. 2013, 5, a008722. [Google Scholar] [CrossRef] [PubMed]
- Cosentino, K.; Hertlein, V.; Jenner, A.; Dellmann, T.; Gojkovic, M.; Peña-Blanco, A.; Dadsena, S.; Wajngarten, N.; Danial, J.S.H.; Thevathasan, J.V.; et al. The interplay between BAX and BAK tunes apoptotic pore growth to control mitochondrial-DNA-mediated inflammation. Mol. Cell 2022, 82, 933–949.e939. [Google Scholar] [CrossRef] [PubMed]
- Rahman, R.; Latonen, L.; Wiman, K.G. hTERT antagonizes p53-induced apoptosis independently of telomerase activity. Oncogene 2005, 24, 1320–1327. [Google Scholar] [CrossRef] [PubMed]
Name | Molecular Formula | 3D Structure | PubChem ID |
---|---|---|---|
DL-Lactic acid | CH3CHOHCOOH | 612 | |
Ethane-1,2-diol | HOCH2CH2OH | 174 |
Gene Name | Primer Sequence | Strand | Product Size |
---|---|---|---|
BAX | AAACTGGTGCTCAAGGCCC | Plus | 81 |
CCGGAGGAAGTCCAATGTCC | Minus | ||
BCL2 | TGGGATCGTTGCCTTATGCA | Plus | 101 |
GTCTACTTCCTCTGTGATGTTGT | Minus | ||
hTERT | AACCTTCCTCAGGACCCTGG | Plus | 128 |
CCGGCATCTGAACAAAAGCC | Minus | ||
GAPDH | TGGAAGGACTCATGACCACA | Plus | 119 |
AGAGGCAGGGATGATGTTCT | Minus |
Copolymer | Energy (kJ/mol) | ||||
---|---|---|---|---|---|
Van der Waal Energy | Electrostatic Energy | Polar Solvation Energy | SASA Energy | Entropy | |
PLA-PEG-PLA | −11.203 | −5.649 | 36.657 | −1.936 | 9.747 |
PEG-PLA-PEG | −3.859 | −2.884 | 27.055 | −0.878 | 9.088 |
Systems | Ratio (w/w) CUR: Copolymers | DL (%) | EE (%) |
---|---|---|---|
Curcumin-PLA-PEG-PLA | 1:50 | 1.9 ± 0.3 | 43.9 ± 2.1 |
1:20 | 4.4 ± 0.1 | 51.7 ± 2.5 | |
1:10 | 6.3 ± 0.2 | 61.4 ± 1.4 | |
Curcumin-PEG-PLA-PEG | 1:50 | 1.2 ± 0.1 | 36.2 ± 1.9 |
1:20 | 3.6 ± 0.3 | 40.3 ± 2.8 | |
1:10 | 4.8 ± 0.6 | 52.3 ± 1.3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rostami, N.; Faridghiasi, F.; Ghebleh, A.; Noei, H.; Samadzadeh, M.; Gomari, M.M.; Tajiki, A.; Abdouss, M.; Aminoroaya, A.; Kumari, M.; et al. Design, Synthesis, and Comparison of PLA-PEG-PLA and PEG-PLA-PEG Copolymers for Curcumin Delivery to Cancer Cells. Polymers 2023, 15, 3133. https://doi.org/10.3390/polym15143133
Rostami N, Faridghiasi F, Ghebleh A, Noei H, Samadzadeh M, Gomari MM, Tajiki A, Abdouss M, Aminoroaya A, Kumari M, et al. Design, Synthesis, and Comparison of PLA-PEG-PLA and PEG-PLA-PEG Copolymers for Curcumin Delivery to Cancer Cells. Polymers. 2023; 15(14):3133. https://doi.org/10.3390/polym15143133
Chicago/Turabian StyleRostami, Neda, Farzaneh Faridghiasi, Aida Ghebleh, Hadi Noei, Meisam Samadzadeh, Mohammad Mahmoudi Gomari, Alireza Tajiki, Majid Abdouss, Alireza Aminoroaya, Manisha Kumari, and et al. 2023. "Design, Synthesis, and Comparison of PLA-PEG-PLA and PEG-PLA-PEG Copolymers for Curcumin Delivery to Cancer Cells" Polymers 15, no. 14: 3133. https://doi.org/10.3390/polym15143133
APA StyleRostami, N., Faridghiasi, F., Ghebleh, A., Noei, H., Samadzadeh, M., Gomari, M. M., Tajiki, A., Abdouss, M., Aminoroaya, A., Kumari, M., Heidari, R., Uversky, V. N., & Smith, B. R. (2023). Design, Synthesis, and Comparison of PLA-PEG-PLA and PEG-PLA-PEG Copolymers for Curcumin Delivery to Cancer Cells. Polymers, 15(14), 3133. https://doi.org/10.3390/polym15143133