Spontaneous DNA Synapsis by Forming Noncanonical Intermolecular Structures
Abstract
1. Introduction
2. Materials and Methods
2.1. Synthesis, Purification, and MS Characterisation of Oligonucleotides
2.2. Amplification of Human and N. Gonorrhoeae DNA Fragments Containing PQS
2.3. Construction of Model DNA Duplexes for AFM
2.4. Non-Denaturing PAGE
2.5. Sanger Sequencing
2.6. The Design of an Asymmetric Holliday Junction
2.7. AFM Sample Preparation, Image Acquisition and Processing
2.8. Molecular Modelling and Molecular Dynamic Simulation
3. Results
3.1. G4/IM-Synaptic Structure Formation by DNA Duplexes Containing PQS
3.2. Synthesis of DNA Constructs for AFM
3.3. Structure of G4/IM-Synaptic Complexes
3.4. Antibody Analysis of the G4/IM-Synaptic Complexes
3.5. G4/IM-Synaptic Complexes and Recombination
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Bochman, M.L.; Paeschke, K.; Zakian, V. DNA secondary structures: Stability and function of G-quadruplex structures. Nat. Rev. Genet. 2012, 13, 770–780. [Google Scholar] [CrossRef] [PubMed]
- Day, H.A.; Pavlou, P.; Waller, Z.A.E. i-Motif DNA: Structure, stability and targeting with ligands. Bioorganic Med. Chem. 2014, 22, 4407–4418. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.-B.; Liu, G.-C.; Gu, L.-Q.; Huang, Z.-S.; Tan, J.-H. Identification of small molecules capable of regulating conformational changes of telomeric G-quadruplex. J. Mol. Struct. 2018, 1154, 1–7. [Google Scholar] [CrossRef]
- Carvalho, J.; Ferreira, J.; Pereira, P.; Coutinho, E.; Guedin, A.; Nottelet, P.; Salgado, G.F.; Mergny, J.-L.; Queiroz, J.A.; Sousa, F.; et al. Stabilization of novel immunoglobulin switch regions G-quadruplexes by naphthalene and quinoline-based ligands. Tetrahedron 2016, 72, 1229–1237. [Google Scholar] [CrossRef]
- Besnard, E.; Babled, A.; Lapasset, L.; Milhavet, O.; Parrinello, H.; Dantec, C.; Marin, J.-M.; Lemaitre, J.-M. Unraveling cell type–specific and reprogrammable human replication origin signatures associated with G-quadruplex consensus motifs. Nat. Struct. Mol. Biol. 2012, 19, 837–844. [Google Scholar] [CrossRef]
- Stanton, A.; Harris, L.M.; Graham, G.; Merrick, C.J. Recombination events among virulence genes in malaria parasites are associated with G-quadruplex-forming DNA motifs. BMC Genomics 2016, 17, 859. [Google Scholar] [CrossRef]
- Kuryavyi, V.; Cahoon, L.A.; Seifert, H.S.; Patel, D.J. RecA-binding pilE G4 sequence essential for pilin antigenic variation forms monomeric and 5’ end-stacked dimeric parallel G-quadruplexes. Structure 2012, 20, 2090–2102. [Google Scholar] [CrossRef]
- Rigo, R.; Palumbo, M.; Sissi, C. G-quadruplexes in human promoters: A challenge for therapeutic applications. Biochim. Biophys. Acta (BBA) Gen. Subj. 2017, 1861, 1399–1413. [Google Scholar] [CrossRef]
- Bose, P.; Hermetz, K.E.; Conneely, K.N.; Rudd, M.K. Tandem repeats and G-rich sequences are enriched at human CNV breakpoints. PLoS ONE 2014, 9, e101607. [Google Scholar]
- Kejnovsky, E.; Tokan, V.; Lexa, M. Transposable elements and G-quadruplexes. Chromosome Res. 2015, 23, 615–623. [Google Scholar] [CrossRef]
- Sekridova, A.V.; Varizhuk, A.M.; Tatarinova, O.N.; Severov, V.V.; Barinov, N.A.; Smirnov, I.P.; Lazarev, V.N.; Klinov, D.V.; Pozmogova, G.E. Conformational polymorphysm of G-rich fragments of DNA ALU-repeats. I. Potential noncanonical structures. Biomeditsinskaia Khimiia 2016, 62, 535–543. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Varizhuk, A.M.; Sekridova, A.V.; Tankevich, M.V.; Podgorsky, V.S.; Smirnov, I.P.; Pozmogova, G.E. Conformational polymorphysm of G-rich fragments of DNA Alu-repeats. II. The putative role of G-quadruplex structures in genomic rearrangements. Biomeditsinskaia Khimiia 2016, 62, 630–637. [Google Scholar] [CrossRef] [PubMed]
- Mendoza, O.; Bourdoncle, A.; Boule, J.-B.; Brosh, R.M., Jr.; Mergny, J.-L. G-quadruplexes and helicases. Nucleic Acids Res. 2016, 44, 1989–2006. [Google Scholar] [CrossRef] [PubMed]
- Varizhuk, A.; Ischenko, D.; Tsvetkov, V.; Novikov, R.; Kulemin, N.; Kaluzhny, D.; Vlasenok, M.; Naumov, V.; Smirnov, I.; Pozmogova, G. The expanding repertoire of G4 DNA structures. Biochimie 2017, 135, 54–62. [Google Scholar] [CrossRef]
- Kudlicki, A.S. G-quadruplexes involving both strands of genomic DNA are highly abundant and colocalize with functional sites in the human genome. PLoS ONE 2016, 11, e0146174. [Google Scholar] [CrossRef]
- Siddiqui-Jain, A.; Grand, C.L.; Bearss, D.J.; Hurley, L.H. Direct evidence for a G-quadruplex in a promoter region and targeting with a small molecule to repress c-MYC transcription. Proc. Natl. Acad. Sci. USA 2002, 99, 11593–11598. [Google Scholar] [CrossRef]
- Hershman, S.G.; Chen, Q.; Lee, J.Y.; Kozak, M.L.; Yue, P.; Wang, L.-S.; Johnson, F.B. Genomic distribution and functional analyses of potential G-quadruplex-forming sequences in Saccharomyces cerevisiae. Nucleic Acids Res. 2008, 36, 144–156. [Google Scholar] [CrossRef]
- Robinson, J.; Raguseo, F.; Nuccio, S.P.; Liano, D.; Antonio, M.D. DNA G-quadruplex structures: More than simple roadblocks to transcription? Nucleic Acids Res. 2021, 49, 8419–8431. [Google Scholar] [CrossRef]
- Valton, A.-L.; Hassan-Zadeh, V.; Lema, I.; Boggetto, N.; Alberti, P.; Saintome, C.; Riou, J.-F.; Prioleau, M.-N. G4 motifs affect origin positioning and efficiency in two vertebrate replicators. EMBO J. 2014, 33, 732–746. [Google Scholar] [CrossRef]
- Walia, R.; Chaconas, G. Suggested role for G4 DNA in recombinational switching at the antigenic variation locus of the Lyme disease spirochete. PLoS ONE 2013, 8, e57792. [Google Scholar] [CrossRef]
- Kruisselbrink, E.; Guryev, V.; Brouwer, K.; Pontier, D.B.; Cuppen, E.; Tijsterman, M. Mutagenic capacity of endogenous G4 DNA underlies genome instability in FANCJ-defective C. elegans. Curr. Biol. 2008, 18, 900–905. [Google Scholar] [CrossRef] [PubMed]
- Ribeyre, C.; Lopes, J.; Boule, J.-B.; Piazza, A.; Guedin, A.; Zakian, V.A.; Mergny, J.-L.; Nicolas, A. The yeast Pif1 helicase prevents genomic instability caused by G-quadruplex-forming CEB1 sequences in vivo. PLoS Genet. 2009, 5, e1000475. [Google Scholar] [CrossRef] [PubMed]
- Lemmens, B.; Schendel, R.; Tijsterman, M. Mutagenic consequences of a single G-quadruplex demonstrate mitotic inheritance of DNA replication fork barriers. Nat. Commun. 2015, 6, 8909. [Google Scholar] [CrossRef]
- Hoffmann, R.F.; Moshkin, Y.M.; Mouton, S.; Grzeschik, N.A.; Kalicharan, R.D.; Kuipers, J.; Wolters, A.H.G.; Nishida, K.; Romashchenko, A.V.; Postberg, J.; et al. Guanine quadruplex structures localize to heterochromatin. Nucleic Acids Res. 2016, 44, 152–163. [Google Scholar] [CrossRef] [PubMed]
- Henderson, A.; Wu, Y.; Huang, Y.C.; Chavez, E.A.; Platt, J.; Johnson, F.B.; Brosh, R.M.; Sen, D.; Lansdorp, P.M. Detection of G-quadruplex DNA in mammalian cells. Nucleic Acids Res. 2014, 42, 860–869. [Google Scholar] [CrossRef] [PubMed]
- Wright, E.P.; Huppert, J.L.; Waller, Z.A.E. Identification of multiple genomic DNA sequences which form i-motif structures at neutral pH. Nucleic Acids Res. 2017, 45, 2951–2959. [Google Scholar] [CrossRef]
- Zeraati, M.; Langley, D.B.; Schofield, P.; Moye, A.L.; Rouet, R.; Hughes, W.E.; Bryan, T.M.; Dinger, M.E.; Christ, D. I-motif DNA structures are formed in the nuclei of human cells. Nat. Chem. 2018, 10, 631–637. [Google Scholar] [CrossRef]
- Varizhuk, A.M.; Protopopova, A.D.; Tsvetkov, V.B.; Barinov, N.A.; Podgorsky, V.V.; Tankevich, M.V.; Vlasenok, M.A.; Severov, V.V.; Smirnov, I.P.; Dubrovin, E.V.; et al. Polymorphism of G4 associates: From stacks to wires via interlocks. Nucleic Acids Res. 2018, 46, 8978–8992. [Google Scholar] [CrossRef]
- Protopopova, A.D.; Tsvetkov, V.B.; Varizhuk, A.M.; Barinov, N.A.; Podgorsky, V.V.; Klinov, D.V.; Pozmogova, G.E. The structural diversity of C-rich DNA aggregates: Unusual self-assembly of beetle-like nanostructures. Phys. Chem. Chem. Phys. 2018, 20, 3543–3553. [Google Scholar] [CrossRef]
- Zhang, J.Y.; Xia, Y.; Hao, Y.H.; Tan, Z. DNA:RNA hybrid G-quadruplex formation upstream of transcription strat site. Sci. Rep. 2020, 10, 7429. [Google Scholar] [CrossRef]
- Hegyi, H. Enhancer-promoter interaction facilitated by transiently forming G-quadruplexes. Sci. Rep. 2015, 5, 9165. [Google Scholar] [CrossRef] [PubMed]
- Roy, S.S.; Mukherjee, A.K.; Chowdhury, S. Insights about genome function from spatial organization of the genome. Hum. Genom. 2018, 12, 8–16. [Google Scholar] [CrossRef] [PubMed]
- Sen, D.; Gilbert, W. Formation of parallel four-stranded complexes by guanine-rich motifs in DNA and its implications for meiosis. Nature 1988, 334, 364–366. [Google Scholar] [CrossRef] [PubMed]
- Venczel, E.A.; Sen, D. Synapsable DNA. J. Mol. Biol. 1996, 257, 219–224. [Google Scholar] [CrossRef] [PubMed]
- Fahlman, R.P.; Sen, D. “Synapsable” DNA double helices: Self-selective modules for assembling DNA superstructures. J. Am. Chem. Soc. 1999, 121, 11079–11085. [Google Scholar] [CrossRef]
- Fahlman, R.P.; Sen, D. Cation-regulated self-association of “synapsable” DNA duplexes. J. Mol. Biol. 1998, 280, 237–244. [Google Scholar] [CrossRef]
- Klinov, D.; Dwir, B.; Kapon, E.; Borovok, N.; Molotsky, T.; Kotlyar, A. High-resolution atomic force microscopy of duplex and triplex DNA molecules. Nanotechnology 2007, 18, 225102. [Google Scholar] [CrossRef]
- Bose, K.; Lech, C.J.; Heddi, B.; Phan, A.T. High-resolution AFM structure of DNA G-wires in aqueous solution. Nat. Commun. 2018, 9, 1959. [Google Scholar] [CrossRef]
- Hessari, N.M.; Spindler, L.; Troha, T.; Lam, W.C.; Drevensek, I.; da Silva, M.W. Programmed self-assembly of a quadruplex DNA nanowire. Chem. A Eur. J. 2014, 20, 3626–3630. [Google Scholar] [CrossRef]
- Mendez, M.A.; Szalai, V.A. Synapsable quadruplex-mediated fibers. Nanoscale Res. Lett. 2013, 8, 210. [Google Scholar] [CrossRef]
- Ambrus, A.; Chen, D.; Dai, J.; Jones, R.A.; Yang, D. Solution structure of the biologically relevant G-quadruplex element in the human c-MYC promoter. Implications for G-quadruplex stabilization. Biochemistry 2005, 44, 2048–2058. [Google Scholar] [CrossRef] [PubMed]
- Cogoi, S.; Rapozzi, V.; Cauci, S.; Xodo, L.E. Critical role of hnRNP A1 in activating KRAS transcription in pancreatic cancer cells: A molecular mechanism involving G4 DNA. Biochim. Biophys. Acta (BBA) Gen. Subj. 2017, 1861, 1389–1398. [Google Scholar] [CrossRef] [PubMed]
- Maniatis, T.; Fritsch, E.F.; Sambrook, J. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1982; p. 426. [Google Scholar]
- Case, D.A.; Belfon, K.; Ben-Shalom, I.Y.; Brozell, S.R.; Cerutti, D.S.; Cheatham, T.E., III; Cruzeiro, V.W.D.; Darden, T.A.; Duke, R.E.; Giambasu, G.; et al. AMBER 2020; University of California: San Francisco, CA, USA, 2020. [Google Scholar]
- Izadi, S.; Onufriev, A.V. Accuracy limit of rigid 3-point water models. J. Chem. Phys. 2016, 145, 074501. [Google Scholar] [CrossRef] [PubMed]
- Zgarbova, M.; Luque, F.J.; Sponer, J.; Cheatham, T.E., III; Otyepka, M.; Jurecka, P. Toward improved description of DNA backbone: Revisiting epsilon and zeta torsion force field parameters. J. Chem. Theory Comput. 2013, 9, 2339–2354. [Google Scholar] [CrossRef] [PubMed]
- Zgarbova, M.; Sponer, J.; Otyepka, M.; Cheatham, T.E., III; Galindo-Murillo, R.; Jurecka, P. Refinement of the sugar-phosphate backbone torsion beta for AMBER force fields improves the description of Z- and B-DNA. J. Chem. Theory Comput. 2015, 12, 5723–5736. [Google Scholar] [CrossRef]
- Onufriev, A.; Case, D.A.; Bashford, D. Effective Born radii in the generalized Born approximation: The importance of being perfect. J. Comput. Chem. 2002, 23, 1297–1304. [Google Scholar] [CrossRef]
- Mandelkern, M.; Elias, J.G.; Eden, D.; Crothers, D.M. The dimensions of DNA in solution. J. Mol. Biol. 1981, 152, 153–161. [Google Scholar] [CrossRef]
- Wenzel, J.J.; Rossmann, H.; Fottner, C.; Neuwirth, S.; Neukirch, C.; Lohse, P.; Bickmann, J.K.; Minnemann, T.; Musholt, T.J.; Schneider-Ratzke, B.; et al. Identification and prevention of genotyping errors caused by G-quadruplex– and i-motif–like sequences. Clin. Chem. 2009, 55, 1361–1371. [Google Scholar] [CrossRef]
- Bhattacharyya, D.; Arachchilage, G.M.; Basu, S. Metal cations in G-quadruplex folding and stability. Front. Chem. 2016, 4, 38. [Google Scholar] [CrossRef]
- Cui, Y.; Kong, D.; Ghimire, C.; Xu, C.; Mao, H. Mutually exclusive formation of G-quadruplex and i-motif is a general phenomenon governed by steric hindrance in duplex DNA. Biochemistry 2016, 55, 2291–2299. [Google Scholar] [CrossRef]
- Kelley, S.; Boroda, S.; Musier-Forsyth, K.; Kankia, B.I. HIV-integrase aptamer folds into a parallel quadruplex: A thermodynamic study. Biophys. Chem. 2011, 155, 82–88. [Google Scholar] [CrossRef] [PubMed]
- Lushnikov, A.Y.; Bogdanov, A.; Lyubchenko, Y.L. DNA recombination: Holliday junctions dynamics and branch migration. J. Biol. Chem. 2003, 278, 43130–43134. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Zhang, Y.; You, H. Characterization of G-quadruplexes folding/unfolding dynamics and interactions with proteins from single-molecule force spectroscopy. Biomolecules 2021, 11, 1579. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Singh, N. DNA melting in presence of molecular crowders. Phys. Chem. Chem. Phys. 2017, 19, 19452–19460. [Google Scholar] [CrossRef]
- Singh, A.; Singh, N. Effect of salt concentration on the stability of heterogeneous DNA. Phys. A Stat. Mech. Its Appl. 2015, 419, 328–334. [Google Scholar] [CrossRef]
- Timsit, Y. DNA-directed base pair opening. Molecules 2012, 17, 11947–11964. [Google Scholar] [CrossRef]
- Varnai, P.; Timsit, Y. Differential stability of DNA crossovers in solution mediated by divalent cations. Nucleic Acids Res. 2010, 38, 4163–4172. [Google Scholar] [CrossRef]
- Arora, A.; Nair, D.R.; Maiti, S. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition. FEBS J. 2009, 276, 3628–3640. [Google Scholar] [CrossRef]











| Code | Sequence | m/z [M+H]+, Found (Calculated) |
|---|---|---|
| R_NG | 5′-TCATCTGCCGGTTGCATAGA | 6108 (6108) |
| F_NG | 5′-CAGTTTTAGTGCCGATTTTCGT | 6722 (6722) |
| R_cMyc | 5′-GTGGGCGGAGATTAGCGAGA | 6288 (6287) |
| F_cMyc | 5′-AATGGTAGGCGCGCGTAGTT | 6213 (6213) |
| R_0Myc | 5′-AAGTGGAGAGCTTGTGGACC | 6223 (6222) |
| F_0Myc | 5′-CACGGAAGTAATACTCCTCTCCTC | 7232 (7232) |
| R_kRas | 5′-CACCCTAGACCGCCCCAG | 5374 (5374) |
| F_kRas | 5′-CGCAGAGGGCAGAGCTATC | 5862 (5862) |
| 5′-fl | 5′-GTAGTGAGACTCCTGAAAGAAGTATCTGACCAACTTACAGATAATATTAAAGCTCTACACGAGAC | 20,043 (20,041) |
| 3′-fl | 5′-p-GTCATGTTCCTGACTTTAGACGTATCTGACCAACTTACAGATAAGGAATCCATCTAGACTCAGCG | 20,023 (20,021) |
| mid_0 | 5′-p-CTCCAATGTGATCAGCTGCACGTATCTGACCAACTTACAGATAAGCCAAGTGTGATCAGCTGCAC | 20,017 (20,016) |
| mid_2 | 5′-p-CTCCAATGTGATCAGCTGCACGTATCTGACCCACCCACAGATAAGCCAAGTGTGATCAGCTGCAC | 19,962 (19,961) |
| mid_3 | 5′-p-CTCCAATGTGATCAGCTGCACGTATCTGACCCACCCACCCATAAGCCAAGTGTGATCAGCTGCAC | 19,897 (19,897) |
| mid_4 | 5′-p-CTCCAATGTGATCAGCTGCACGTATCCCACCCACCCACCCATAAGCCAAGTGTGATCAGCTGCAC | 19,843 (19,842) |
| mid_5 | 5′-p-CTCCAATGTGATCAGCTGCACGTCCCACCCACCCACCCACCCAAGCCAAGTGTGATCAGCTGCAC | 19,788 (19,788) |
| mid_6 | 5′-p-CTCCAATGTGATCAGCTGCACCCCACCCACCCACCCACCCACCCGCCAAGTGTGATCAGCTGCAC | 19,710 (19,709) |
| 5′-fl_5 | 5′-p-GTAGTGAGACTCCTGAAAGAAGTCCCACCCACCCACCCACCCAATATTAAAGCTCTACACGAGAC | 19,893 (19,892) |
| Lig1 | 5′-CTGATCACATTGGAGGTCTCGTGTAGAGCTT | 9557 (9557) |
| Lig2 | 5′-AAGTCAGGAACATGACGTGCAGCTGATCAC | 9250 (9249) |
| Pr | 5′-GTAGTGAGACTCCTGAAAGAA | 6503 (6503) |
| Pf | 5′-CGCTGAGTCTAGATGGATTC | 6149 (6148) |
| Hol-1 | 5′-p-TATCCATCGCTTGAATGGTCGACAATTGTTCCTTGTAATCTTTAGCGTTAATGACAGCAA | 18,510 (18,508) |
| Hol-2 | 5′-p-GATTACAAGGAACAATTGTCCAACTCTTTATTTTCAGTGGTTTAGCGTTAATGACAGCAA | 18,566 (18,565) |
| Hol-3 | 5′-p-CCACTGAAAATAAAGAGTTGAGGCGGTTGTTTTAGACAAATTTAGCGTTAATGACAGCAA | 18,697 (18,697) |
| Hol-4 | 5′-p-TTTGTCTAAAACAACCGCCTGACCATTCAAGCGATGGATATTTAGCGTTAATGACAGCAA | 18,530 (18,529) |
| Hol-fs | 5′-p-CTGTAAGTTGGTCAGATACTTCTTTCAGGAGTCTCACTAC | 12,332 (12,331) |
| Hol-fl | 5′-GTAGTGAGACTCCTGAAAGAAGTATCTGACCAACTTACAGTTGCTGTCATTAACGCTAAA | 18,490 (18,490) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Severov, V.; Tsvetkov, V.; Barinov, N.; Babenko, V.; Klinov, D.; Pozmogova, G. Spontaneous DNA Synapsis by Forming Noncanonical Intermolecular Structures. Polymers 2022, 14, 2118. https://doi.org/10.3390/polym14102118
Severov V, Tsvetkov V, Barinov N, Babenko V, Klinov D, Pozmogova G. Spontaneous DNA Synapsis by Forming Noncanonical Intermolecular Structures. Polymers. 2022; 14(10):2118. https://doi.org/10.3390/polym14102118
Chicago/Turabian StyleSeverov, Viacheslav, Vladimir Tsvetkov, Nikolay Barinov, Vladislav Babenko, Dmitry Klinov, and Galina Pozmogova. 2022. "Spontaneous DNA Synapsis by Forming Noncanonical Intermolecular Structures" Polymers 14, no. 10: 2118. https://doi.org/10.3390/polym14102118
APA StyleSeverov, V., Tsvetkov, V., Barinov, N., Babenko, V., Klinov, D., & Pozmogova, G. (2022). Spontaneous DNA Synapsis by Forming Noncanonical Intermolecular Structures. Polymers, 14(10), 2118. https://doi.org/10.3390/polym14102118

