Growth Inhibition of Two Prenylated Chalcones on Prostate Cancer Cells through the Regulation of the Biological Activity and Protein Translation of Bloom Helicase
Abstract
1. Introduction
2. Results
2.1. Prenylated Chalcones Inhibited the Proliferation of PC3 Cells
2.2. Prenylated Chalcones Induced Apoptosis and Arrested the Cell Cycle in PC3 Cells
2.3. Prenylated Chalcones Down-Regulated the Protein Expression of BLM Helicase Gene in PC3 Cells
2.4. Effects of Two Prenylated Chalcones on the DNA-Binding Activity of BLM Helicase
2.5. Effect of the Two Prenylated Chalcones on the DNA-Unwinding Activity of BLM Helicase
2.6. Effect of the Two Prenylated Chalcones on the ATPase Activity of BLM Helicase
3. Discussion
4. Materials and Methods
4.1. Cells and Reagents
4.2. DNA Substrates
4.3. Cell Culture
4.4. Cell Proliferation Assay
4.5. Cell Apoptosis Assay
4.5.1. Hoechst 33,258 Staining
4.5.2. Flow Cytometry Assay
4.6. Cell Cycle Analysis
4.7. Differential Expression of RecQ Helicases
4.7.1. mRNA Expression
4.7.2. BLM Protein Expression
4.8. Biological Activity Assay
4.8.1. Recombinant BLM Helicase
4.8.2. DNA-Binding Activity Assays
4.8.3. DNA Unwinding Activity Assay
4.8.4. ATPase Activity Assay
4.8.5. Agarose Gel Mobility Shift Assay
4.9. Statistical Analysis
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Brosh, R.M., Jr.; Matson, S.W. History of DNA Helicases. Genes 2020, 11, 255. [Google Scholar] [CrossRef]
- Pham, X.H.; Tuteja, N. Potent inhibition of DNA unwinding and ATPase activities of pea DNA helicase 45 by DNA-binding agents. Biochem. Biophys. Res. Commun. 2002, 294, 334–339. [Google Scholar] [CrossRef]
- Bachrati, C.Z.; Hickson, I.D. RecQ helicases: Suppressors of tumorigenesis and premature aging. Biochem. J. 2003, 374 Pt 3, 577–606. [Google Scholar] [CrossRef]
- Amor-Guéret, M. Bloom syndrome, genomic instability and cancer: The SOS-like hypothesis. Cancer. Lett. 2006, 236, 1–12. [Google Scholar] [CrossRef]
- Wong, I.; Moore, K.J.; Bjornson, K.P.; Hsieh, J.; Lohman, T.M. ATPase activity of Escherichia coli Rep helicase is dramatically dependent on DNA ligation and protein oligomeric states. Biochemistry 1996, 35, 5726–5734. [Google Scholar] [CrossRef]
- Hickson, I.D.; Davies, S.L.; Li, J.L.; Levitt, N.C.; Mohaghegh, P.; North, P.S.; Wu, L. Role of the Bloom’s syndrome helicase in maintenance of genome stability. Biochem. Soc. Trans. 2001, 29 Pt 2, 201–204. [Google Scholar] [CrossRef]
- Sharma, S.; Doherty, K.M.; Brosh, R.M., Jr. DNA helicases as targets for anti-cancer drugs. Curr. Med. Chem. Anticancer Agents 2005, 5, 183–199. [Google Scholar] [CrossRef]
- German, J.; Roe, A.M.; Leppert, M.F.; Ellis, N.A. Bloom syndrome: An analysis of consanguineous families assigns the locus mutated to chromosome band 15q26.1. Proc. Natl. Acad. Sci. USA 1994, 91, 6669–6673. [Google Scholar] [CrossRef]
- Cunniff, C.; Bassetti, J.A.; Ellis, N.A. Bloom’s Syndrome: Clinical Spectrum, Molecular Pathogenesis, and Cancer Predisposition. Mol. Syndromol. 2017, 8, 4–23. [Google Scholar] [CrossRef]
- Wu, L.; Hickson, I.D. The Bloom’s syndrome helicase suppresses crossing over during homologous recombination. Nature 2003, 426, 870–874. [Google Scholar] [CrossRef]
- Janscak, P.; Garcia, P.L.; Hamburger, F.; Makuta, Y.; Shiraishi, K.; Imai, Y.; Ikeda, H.; Bickle, T.A. Characterization and mutational analysis of the RecQ core of the bloom syndrome protein. J. Mol. Biol. 2003, 330, 29–42. [Google Scholar] [CrossRef]
- Hickson, I.D. RecQ helicases: Caretakers of the genome. Nat. Rev. Cancer 2003, 3, 169–178. [Google Scholar] [CrossRef]
- Kitao, S.; Ohsugi, I.; Ichikawa, K.; Goto, M.; Furuichi, Y.; Shimamoto, A. Cloning of two new human helicase genes of the RecQ family: Biological significance of multiple species in higher eukaryotes. Genomics 1998, 54, 443–452. [Google Scholar] [CrossRef]
- Van Maldergem, L.; Siitonen, H.A.; Jalkh, N.; Chouery, E.; De Roy, M.; Delague, V.; Muenke, M.; Jabs, E.W.; Cai, J.; Wang, L.L.; et al. Revisiting the craniosynostosis-radial ray hypoplasia association: Baller-Gerold syndrome caused by mutations in the RECQL4 gene. J. Med. Genet. 2006, 43, 148–152. [Google Scholar] [CrossRef]
- Xi, X.G. Helicases as antiviral and anticancer drug targets. Curr. Med. Chem. 2007, 14, 883–915. [Google Scholar] [CrossRef]
- Ahmad, W.; Jantan, I.; Jasamai, M. Syed Nasir Abbas Bukhari. Review of Methods and Various Catalysts Used for Chalcone Synthesis. Mini-Rev. Org. Chem. 2013, 10, 73–83. [Google Scholar] [CrossRef]
- Orlikova, B.; Tasdemir, D.; Golais, F.; Dicato, M.; Diederich, M. Dietary chalcones with chemopreventive and chemotherapeutic potential. Genes. Nutr. 2011, 6, 125–147. [Google Scholar] [CrossRef]
- Wen, Z.; Zhang, Y.; Wang, X.; Zeng, X.; Hu, Z.; Liu, Y.; Xie, Y.; Liang, G.; Zhu, J.; Luo, H.; et al. Novel 3′,5′-diprenylated chalcones inhibited the proliferation of cancer cells in vitro by inducing cell apoptosis and arresting cell cycle phase. Eur. J. Med. Chem. 2017, 133, 227–239. [Google Scholar] [CrossRef]
- Peng, F.; Wang, G.; Li, X.; Cao, D.; Yang, Z.; Ma, L.; Ye, H.; Liang, X.; Ran, Y.; Chen, J.; et al. Rational design, synthesis, and pharmacological properties of pyranochalcone derivatives as potent anti-inflammatory agents. Eur. J. Med. Chem. 2012, 54, 272–280. [Google Scholar] [CrossRef]
- Brosh, R.M., Jr.; Karow, J.K.; White, E.J.; Shaw, N.D.; Hickson, I.D.; Bohr, V.A. Potent inhibition of werner and bloom helicases by DNA minor groove binding drugs. Nucleic Acids Res. 2000, 28, 2420–2430. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, X.; Zou, G.; Peng, S.; Liu, C.; Zhou, X. Detection and Application of 5-Formylcytosine and 5-Formyluracil in DNA. Acc. Chem. Res. 2019, 52, 1016–1024. [Google Scholar] [CrossRef]
- Ni, L.; Yamada, T.; Nakatani, K. Assembly of ruthenium complexes on double stranded DNA using mismatch binding ligands. Chem. Commun. 2020, 56, 5227–5230. [Google Scholar] [CrossRef]
- Moraca, F.; Amato, J.; Ortuso, F.; Artese, A.; Pagano, B.; Novellino, E.; Alcaro, S.; Parrinello, M.; Limongelli, V. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations. Proc. Natl. Acad. Sci. USA 2017, 114, E2136–E2145. [Google Scholar] [CrossRef]
- Pfitzer, L.; Moser, C.; Gegenfurtner, F.; Arner, A.; Foerster, F.; Atzberger, C.; Zisis, T.; Kubisch-Dohmen, R.; Busse, J.; Smith, R.; et al. Targeting actin inhibits repair of doxorubicin-induced DNA damage: A therapeutic approach for combination therapy. Cell Death Dis. 2019, 10, 302. [Google Scholar] [CrossRef]
- Zhang, B.; Zhang, A.H.; Chen, L.; Xi, X.G. Inhibition of DNA helicase, ATPase and DNA-binding activities of E. coli RecQ helicase by chemotherapeutic agents. J. Biochem. 2008, 143, 773–779. [Google Scholar] [CrossRef]
- Zhu, X.; Sun, B.; Luo, M.; Yu, J.; Zhang, Y.; Xu, H.Q.; Luo, H. Bloom helicase explicitly unwinds 3’-tailed G4DNA structure in prostate cancer cells. Int. J. Biol. Macromol. 2021, 180, 578–589. [Google Scholar] [CrossRef]
- Xue, C.; Daley, J.M.; Xue, X.; Steinfeld, J.; Kwon, Y.; Sung, P.; Greene, E.C. Single-molecule visualization of human BLM helicase as it acts upon double- and single-stranded DNA substrates. Nucleic Acids Res. 2019, 47, 11225–11237. [Google Scholar] [CrossRef]
- Luo, H.; Xu, H.Q.; Chen, X.; Ding, M.; Yang, Q.X.; Li, K. Potent in vitro interference of fleroxacin in DNA-binding, unwinding and ATPase activities of Bloom helicase. Biomed. Environ. Sci. 2013, 26, 231–242. [Google Scholar] [CrossRef]
- Ma, Y.; Xu, B.; Yu, J.; Huang, L.; Zeng, X.; Shen, X.; Ren, C.; Ben-David, Y.; Luo, H. Fli-1 Activation through Targeted Promoter Activity Regulation Using a 3′,5′-diprenylated Chalcone Inhibits Growth and Metastasis of Prostate Cancer Cells. Int. J. Mol. Sci. 2020, 21, 2216. [Google Scholar] [CrossRef]
- Dou, S.X.; Wang, P.Y.; Xu, H.Q.; Xi, X.G. The DNA binding properties of the Escherichia coli RecQ helicase. J. Biol. Chem. 2004, 279, 6354–6363. [Google Scholar] [CrossRef]
- George, J.W.; Ghate, S.; Matson, S.W.; Besterman, J.M. Inhibition of DNA helicase II unwinding and ATPase activities by DNA-interacting ligands. Kinetics and specificity. J. Biol. Chem. 1992, 267, 10683–10689. [Google Scholar] [CrossRef]
- Xu, H.Q.; Zhang, A.H.; Auclair, C.; Xi, X.G. Simultaneously monitoring DNA binding and helicase-catalyzed DNA unwinding by fluorescence polarization. Nucleic Acids Res. 2003, 31, e70. [Google Scholar] [CrossRef] [PubMed][Green Version]











| BLM Helicase | ATPase | ||||
|---|---|---|---|---|---|
| Concentrations | Vmax | Km | Kcat | Kcat/Km | |
| µmol/L | μmol/min | μmol/L | s−1 | s−1/μmol−1 | |
| Control | — | 146.2 ± 25.6 | 187.6 ± 2.4 | 6.1 ± 1.7 | 0.033 ± 0.004 |
| WZH-43 | 0.1 | 118.9 ± 9.5 ** | 105.4 ± 3.5 ** | 5.0 ± 0.7 * | 0.047 ± 0.003 * |
| 0.2 | 86.6 ± 4.8 ** | 47.3 ± 3.9 ** | 3.6 ± 0.3 * | 0.076 ± 0.004 * | |
| WZH-10 | 0.1 | 104.3 ± 11.3 ** | 98.6 ± 7.9 ** | 4.4 ± 0.6 * | 0.045 ± 0.006 * |
| 0.2 | 71.9 ± 3.2 ** | 35.4 ± 2.4 ** | 3.0 ± 0.4 * | 0.085 ± 0.005 * | |
| ML216 | 0.1 | 121.4 ± 7.7 ** | 129.4 ± 9.6 ** | 4.3 ± 0.5 * | 0.034 ± 0.007 |
| 0.2 | 81.2 ± 4.2 ** | 68.7 ± 5.4 ** | 3.2 ± 0.4 * | 0.048 ± 0.010 * | |
| Substrate | Length/Mer | Sequence |
|---|---|---|
| A1 | 45 | 5′AATCCGTCGAGCAGAGTTAGGttaggttaggttagtttttttttt3′ |
| A2 | 21 | 3′FAM-TTAGGCAGCTCGTCTCAATCC5′ |
| B1 | 20 | 5′ TGACCATCAGTTTTTTTTTT 3′ |
| Genes | Primers | Sequences |
|---|---|---|
| BLM | Primer F | 5′-GGATCCTGGTTCCGTCCGC-3′ |
| Primer R | 5′-CCTCAGTCAAATCTATTTGCTCG-3′ | |
| WRN | Primer F | 5′-AGACCTGGAGCCTTAACAGTC-3′ |
| Primer R | 5′-AACCAGCATAAGCATCAGTGG-3′ | |
| RECQL1 | Primer F | 5′-CTCCGAGTTAAAGCTGATTTATGTG-3′ |
| Primer R | 5′-GGGAACTGCCGCTTTAAGA-3′ | |
| GAPDH | Primer F | 5′-GGAGCGAGATCCCTCCAAAAT-3′ |
| Primer R | 5′-GGCTGTTGTCATACTTCTCATGG-3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, B.-F.; Zhu, X.-H.; Hou, J.; Li, L.-L.; Qin, Y.-K.; Yu, J.; Cheng, S.; Xu, B.-X.; Song, F.-J.; Luo, H. Growth Inhibition of Two Prenylated Chalcones on Prostate Cancer Cells through the Regulation of the Biological Activity and Protein Translation of Bloom Helicase. Catalysts 2022, 12, 582. https://doi.org/10.3390/catal12060582
Sun B-F, Zhu X-H, Hou J, Li L-L, Qin Y-K, Yu J, Cheng S, Xu B-X, Song F-J, Luo H. Growth Inhibition of Two Prenylated Chalcones on Prostate Cancer Cells through the Regulation of the Biological Activity and Protein Translation of Bloom Helicase. Catalysts. 2022; 12(6):582. https://doi.org/10.3390/catal12060582
Chicago/Turabian StyleSun, Bao-Fei, Xu-Hui Zhu, Jing Hou, Lan-Lan Li, Yuan-Kun Qin, Jia Yu, Sha Cheng, Bi-Xue Xu, Fa-Jun Song, and Heng Luo. 2022. "Growth Inhibition of Two Prenylated Chalcones on Prostate Cancer Cells through the Regulation of the Biological Activity and Protein Translation of Bloom Helicase" Catalysts 12, no. 6: 582. https://doi.org/10.3390/catal12060582
APA StyleSun, B.-F., Zhu, X.-H., Hou, J., Li, L.-L., Qin, Y.-K., Yu, J., Cheng, S., Xu, B.-X., Song, F.-J., & Luo, H. (2022). Growth Inhibition of Two Prenylated Chalcones on Prostate Cancer Cells through the Regulation of the Biological Activity and Protein Translation of Bloom Helicase. Catalysts, 12(6), 582. https://doi.org/10.3390/catal12060582

