Recent Advances in Nucleic Acid Modulation for Functional Nanozyme
Abstract
1. From “Enzyme” to “Nucleic Acid Modulation for Functional Nanozyme”
1.1. Enzyme
1.2. Nanozyme
1.3. Functional Nanozyme
1.4. Nucleic Acid Modulation for Functional Nanozyme
2. Crosstalk between Nanozyme and Nucleic Acid
2.1. Self-Assembly Nanozyme
2.2. Irreversible Binding Nanozyme
2.3. Reversible Binding Nanozyme
3. Functional Nanozyme-Based Energy Conversion Events
3.1. “Self-Assembled Nanozyme”-Based Energy Conversion Events
3.2. “Irreversible Binding Nanozyme”-Based Biosensors
3.3. “Reversible Binding Nanozyme”-Based Energy Conversion Events
3.3.1. Physical Properties Changes
3.3.2. Chemical Properties Changes
4. Conclusions and Outlook
- (1)
- It should be admitted that there are conflicting conclusions about nucleic acid-modulated nanozymes in the current reported research. Perhaps there were differences in the morphology and composition of nanozymes in different studies or there are other reasons for the differences, so in-depth research is needed.
- (2)
- Self-assembled nanozymes require a relatively long assembly time, irreversible binding nanozymes have a relatively high cost, and reversible binding nanozymes require further study of the mechanism of their effective modulation. These three points are the focus of future research.
- (3)
- At present, most functional nanozymes require solution systems for reactions. Therefore, it is still a huge challenge to extend the reaction to solid-phase systems (such as paper-based systems) and to construct cheap, portable integrated devices without sacrificing the activity of the interface components.
- (4)
- Nanozymes have high catalytic activity and excellent biocompatibility. Nanozymes have been used as antibacterial agents to promote wound healing [130,131]; to assist in tumor cell therapy (such as magnetic hyperthermia, chemodynamic therapy, photothermal therapy, and photodynamic therapy [132,133,134,135,136]); and to alleviate the symptoms of metabolic diseases (such as glucose metabolism: diabetes [45], immune metabolism: inflammation and cancer [137,138]). Most of the nanozymes reported are metal oxides (such as iron oxide, manganese oxide, copper oxide, cerium oxide, etc.) or noble metals (silver, gold, platinum, palladium, cobalt, etc.). They can be degraded and metabolized in the body, and the released metal ions are cytotoxic. Therefore, it is necessary to study the modulation mechanism of biomacromolecules with nanozymes to solve the biocompatibility, targeting, and safety issues of nanozymes in the biomedical field.
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Zeng, Z.; Zhang, C.; Li, J.; Cui, D.; Jiang, Y.; Pu, K. Activatable Polymer Nanoenzymes for Photodynamic Immunometabolic Cancer Therapy. Adv. Mater. 2021, 33, e2007247. [Google Scholar] [CrossRef]
- Singh, N.; Naveenkumar, S.K.; Geethika, M.; Mugesh, G. A Cerium Vanadate Nanozyme with Specific Superoxide Dismutase Activity Regulates Mitochondrial Function and ATP Synthesis in Neuronal Cells. Angew. Chem. 2020, 60, 3121–3130. [Google Scholar] [CrossRef]
- Wei, H.; Wang, E. Nanomaterials with enzyme-like characteristics (nanozymes): Next-generation artificial enzymes. Chem. Soc. Rev. 2013, 42, 6060–6093. [Google Scholar] [CrossRef]
- Wang, X.; Hu, Y.; Wei, H. Nanozymes in bionanotechnology: From sensing to therapeutics and beyond. Inorg. Chem. Front. 2016, 3, 41–60. [Google Scholar] [CrossRef]
- Xiong, X.; Huang, Y.; Lin, C.; Liu, X.Y.; Lin, Y. Recent advances in nanoparticulate biomimetic catalysts for combating bacteria and biofilms. Nanoscale 2019, 11, 22206–22215. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Wang, X.; Wang, Q.; Lou, Z.; Li, S.; Zhu, Y.; Qin, L.; Wei, H. Nanomaterials with enzyme-like characteristics (nanozymes): Next-generation artificial enzymes (II). Chem. Soc. Rev. 2018, 42, 1004–1067. [Google Scholar] [CrossRef] [PubMed]
- Breslow, R. Biomimetic Chemistry and Artificial Enzymes: Catalysis by Design. Acc. Chem. Res. 1995, 28, 146–153. [Google Scholar] [CrossRef]
- Breslow, R.; Overman, L.E. "Artificial enzyme" combining a metal catalytic group and a hydrophobic binding cavity. J. Am. Chem. Soc. 1970, 92, 1075–1077. [Google Scholar] [CrossRef]
- Huang, Y.; Ren, J.; Qu, X. Nanozymes: Classification, Catalytic Mechanisms, Activity Regulation, and Applications. Chem. Rev. 2019, 119, 4357–4412. [Google Scholar] [CrossRef]
- Dutta, A.K.; Das, S.; Samanta, P.K.; Roy, S.; Adhikary, B.; Biswas, P. Non–enzymatic amperometric sensing of hydrogen peroxide at a CuS modified electrode for the determination of urine H2O2. Electrochim. Acta 2014, 144, 282–287. [Google Scholar] [CrossRef]
- Manea, F.; Houillon, F.B.; Pasquato, L.; Scrimin, P. Nanozymes: Gold-Nanoparticle-Based Transphosphorylation Catalysts. Angew. Chem. Int. Ed. 2004, 116, 6291–6295. [Google Scholar] [CrossRef]
- Zhou, Y.; Liu, B.; Yang, R.; Liu, J. Filling in the Gaps between Nanozymes and Enzymes: Challenges and Opportunities. Bioconjug. Chem. 2017, 28, 2903–2909. [Google Scholar] [CrossRef] [PubMed]
- Cheng, H.; Liu, Y.; Hu, Y.; Ding, Y.; Lin, S.; Cao, W.; Wang, Q.; Wu, J.; Muhammad, F.; Zhao, X. Monitoring of Heparin Activity in Live Rats Using Metal-Organic Framework Nanosheets as Peroxidase Mimics. Anal. Chem. 2017, 89, 11552–11559. [Google Scholar] [CrossRef] [PubMed]
- Gao, L.; Zhuang, J.; Nie, L.; Zhang, J.; Zhang, Y.; Gu, N.; Wang, T.; Feng, J.; Yang, D.; Perrett, S. Intrinsic peroxidase-like ac-tivity of ferromagnetic nanoparticles. Nat. Nanotechnol. 2007, 2, 577–583. [Google Scholar] [CrossRef]
- Jiang, B.; Duan, D.; Gao, L.; Zhou, M.; Fan, K.; Tang, Y.; Xi, J.; Bi, Y.; Tong, Z.; Gao, G.F.; et al. Standardized assays for determining the catalytic activity and kinetics of peroxidase-like nanozymes. Nat. Protoc. 2018, 13, 1506–1520. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; Ren, J.; Qu, X. Catalytically Active Nanomaterials: A Promising Candidatefor Artificial Enzymes. Acc. Chem. Res. 2014, 47, 1097–1105. [Google Scholar] [CrossRef]
- Zhu, X.; Tang, L.; Wang, J.; Peng, B.; Ouyang, X.; Tan, J.; Yu, J.; Feng, H.; Tang, J. Enhanced peroxidase-like activity of boron nitride quantum dots anchored porous CeO2 nanorods by aptamer for highly sensitive colorimetric detection of kanamycin. Sens. Actuators B Chem. 2020, 330, 129318. [Google Scholar] [CrossRef]
- Aiba, Y.; Sumaoka, J.; Komiyama, M. Artificial DNA cutters for DNA manipulation and genome engineering. Chem. Soc. Rev. 2011, 40, 5657–5668. [Google Scholar] [CrossRef]
- Maruthupandy, M.; Rajivgandhi, G.; Muneeswaran, T.; Vennila, T.; Quero, F.; Song, J.M. Chitosan/silver nanocomposites for colorimetric detection of glucose molecules—ScienceDirect. Int. J. Biol. Macromol. 2019, 121, 822–828. [Google Scholar] [CrossRef] [PubMed]
- Gooding, J.J. Big Moves in Biosensing. ACS Sens. 2016, 1, 633. [Google Scholar] [CrossRef][Green Version]
- Gooding, J.J. The Exciting World of Single Molecule Sensors. Acs Sens. 2016, 1, 1163–1164. [Google Scholar] [CrossRef]
- Gooding, J.J.; Gaus, K. Single-Molecule Sensors: Challenges and Opportunities for Quantitative Analysis. Angew. Chem. Int. Ed. 2016, 55, 11354–11366. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Li, S.; Wei, H. Integrated nanozymes: Facile preparation and biomedical applications. Chem. Commun. 2018, 54, 6520–6530. [Google Scholar] [CrossRef]
- Liang, M.; Yan, X. Nanozymes: From New Concepts, Mechanisms, and Standards to Applications. Acc. Chem. Res. 2019, 52, 2190–2200. [Google Scholar] [CrossRef]
- Guo, L.; Huang, K.; Liu, H. Biocompatibility selenium nanoparticles with an intrinsic oxidase-like activity. J. Nanoparticle Res. 2016, 18, 1–10. [Google Scholar] [CrossRef]
- Pu, F.; Ren, J.; Qu, X. Nucleobases, nucleosides, and nucleotides: Versatile biomolecules for generating functional nanomaterials. Chem. Soc. Rev. 2018, 47, 11285–11306. [Google Scholar]
- Zhang, X.; Liu, Y.; Gopalakrishnan, S.; Castellanos-Garcia, L.; Li, G.; Malassine, M.; Uddin, I.; Huang, R.; Luther, D.C.; Vachet, R.W.; et al. Intracellular Activation of Bioorthogonal Nanozymes through Endosomal Proteolysis of the Protein Corona. ACS Nano 2020, 14, 4767–4773. [Google Scholar] [CrossRef]
- Wang, Y.M.; Liu, J.W.; Adkins, G.B.; Shen, W.; Trinh, M.P.; Duan, L.Y.; Jiang, J.H.; Zhong, W. Enhancement of the Intrinsic Peroxidase-Like Activity of Graphitic Carbon Nitride Nanosheets by ssDNAs and Its Application for Detection of Exosomes. Anal. Chem. 2017, 89, 12327–12333. [Google Scholar] [CrossRef]
- Li, X.; Zhao, Y. Synthetic glycosidases for the precise hydrolysis of oligosaccharides and polysaccharides. Chem. Sci. 2021, 12, 374–383. [Google Scholar] [CrossRef]
- Zhang, D.; Zhao, Y.X.; Gao, Y.J.; Gao, F.P.; Fan, Y.S.; Li, X.J.; Duan, Z.Y.; Wang, H. Anti-bacterial and in vivo tumor treatment by reactive oxygen species generated by magnetic nanoparticles. J. Mater. Chem. B 2013, 1, 5100–5107. [Google Scholar] [CrossRef]
- Ma, J.; Qiu, J.; Wang, S. Nanozymes for Catalytic Cancer Immunotherapy. ACS Appl. Nano Mater. 2020, 3, 4925–4943. [Google Scholar] [CrossRef]
- Taoli, D.; Jing, Y.; Victor, P.; Nan, Z.; Zuhong, L.; Yonggang, K.; Cheng, Z. DNA nanotechnology assisted nanopore-based analysis. Nucleic Acids Res. 2020, 48, 2791–2806. [Google Scholar]
- Sivakova, S.; Rowan, S.J. Nucleobases as Supramolecular Motifs. Chem. Form. 2005, 34, 9–21. [Google Scholar]
- Zhou, P.; Shi, R.; Yao, J.F.; Sheng, C.F.; Li, H. Supramolecular self-assembly of nucleotide–metal coordination complexes: From simple molecules to nanomaterials. Coord. Chem. Rev. 2016, 46, 107–143. [Google Scholar]
- Verma, S.; Mishra, A.K.; Kumar, J. The Many Facets of Adenine: Coordination, Crystal Patterns, and Catalysis. Acc. Chem. Res. 2010, 43, 79–91. [Google Scholar] [CrossRef] [PubMed]
- Ciesielski, A.; Garah, M.E.; Masiero, S.; Samorì, P. Self-assembly of Natural and Unnatural Nucleobases at Surfaces and Interfaces. Small 2015, 12, 83–95. [Google Scholar] [CrossRef] [PubMed]
- Peters, G.M.; Davis, J.T. Supramolecular Gels Made from Nucleobase, Nucleoside and Nucleotide Analogs. Chem. Soc. Rev. 2016, 45, 3188–3206. [Google Scholar] [CrossRef]
- CRC Press. DNA Nanotechnology; CRC Press: Boca Raton, FL, USA, 2014. [Google Scholar]
- Lu, C.H.; Cecconello, A.; Willner, I. Recent Advances in the Synthesis and Functions of Reconfigurable Interlocked DNA Nanostructures. J. Am. Chem. Soc. 2016, 138, 5172–5185. [Google Scholar] [CrossRef]
- Aoki, K.; Murayama, K. Nucleic Acid-Metal Ion Interactions in the Solid State. In Interplay between Metal Ions and Nucleic Acids; Sigel, A., Sigel, H., Sigel, R.K., Eds.; Springer Science Business Media: Berlin, Germany, 2012; Volume 10, pp. 43–102. [Google Scholar] [CrossRef]
- Sigel, H.; Griesser, R. Nucleoside 5′-triphosphates: Self-association, Acid–base, and Metal Ion-binding propErties in Solution. Chem. Soc. Rev. 2005, 34, 875–900. [Google Scholar] [CrossRef]
- Shen, X.; Liu, W.; Gao, X.; Lu, Z.; Wu, X.; Gao, X. Mechanisms of Oxidase and Superoxide Dismutation-like Activities of Gold, Silver, Platinum, and Palladium, and Their Alloys: A General Way to the Activation of Molecular Oxygen. J. Am. Chem. Soc. 2015, 137, 15882–15891. [Google Scholar] [CrossRef]
- Weerathunge, P.; Ramanathan, R.; Torok, V.A.; Hodgson, K.; Xu, Y.; Goodacre, R.; Behera, B.K.; Bansal, V. Ultrasensitive Colorimetric Detection of Murine Norovirus Using NanoZyme Aptasensor. Anal. Chem. 2019, 91, 3270–3276. [Google Scholar] [CrossRef] [PubMed]
- Zhan, L.; Li, C.M.; Wu, W.B.; Huang, C.Z. A Colorimetric Immunoassay for Respiratory Syncytial Virus Detection Based on gold Nanoparticles–Graphene Oxide Hybrids with Mercury-Enhanced Peroxidase-like Activity. Chem. Commun. 2014, 50, 11526–11528. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Liu, C.; Yu, Y.; Yin, M.; Sun, J.; Huang, J.; Chen, N.; Wang, H.; Fan, C.; Song, H. An Organelle-Specific Nanozyme for Diabetes Care in Genetically or Diet-Induced Models. Adv. Mater. 2020, 32, 2003708. [Google Scholar] [CrossRef]
- Gao, P.; Chang, X.; Zhang, D.; Cai, Y.; Chen, G.; Wang, H.; Wang, T.; Kong, T. Synergistic Integration of Metal Nanoclusters and Biomolecules as Hybrid Systems for Therapeutic Applications. Acta Pharm. Sin. B 2020. [Google Scholar] [CrossRef]
- Wei, M.; Qiao, Y.; Zhao, H.; Liang, J.; Li, T.S.; Luo, Y.; Lu, S.; Shi, X.; Lu, W.; Sun, X. Electrochemical Non-enzymatic Glucose Sensors: Recent Progress and Perspectives. Chem. Commun. 2020, 56, 14553–14569. [Google Scholar] [CrossRef]
- Lo, N.; Hsu, W.; Chen, Y.; Sun, I.; Chen, P. Facile Nonenzymatic Glucose Electrode Composed of Commercial CuO Powder and Ionic Liquid Binder. Electroanalysis 2020. [Google Scholar] [CrossRef]
- Qian, X.; Westensee, I.N.; Brodszkij, E.; Städler, B. Cell mimicry as a Bottom-up Strategy for Hierarchical Engineering of Nature-inspired Entities. Wiley Interdiscip. Rev. Nanomed. Nanobiotechnol. 2021, 13, e1683. [Google Scholar] [CrossRef] [PubMed]
- Goswami, N.; Zheng, K.; Xie, J. Bio-NCs--the marriage of ultrasmall metal nanoclusters with biomolecules. Nanoscale 2014, 6, 13328–13347. [Google Scholar] [CrossRef]
- Tao, X.; Wang, X.; Liu, B.; Liu, J. Conjugation of antibodies and aptamers on nanozymes for developing biosensors. Biosens. Bioelectron. 2020, 168, 112537. [Google Scholar] [CrossRef]
- Shang, L.; Dong, S.; Nienhaus, G.U. Ultra-small fluorescent metal nanoclusters: Synthesis and biological applications. Nano Today 2011, 6, 401–418. [Google Scholar] [CrossRef]
- Tanaka, S.I.; Miyazaki, J.; Tiwari, D.K.; Jin, T.; Inouye, Y. Fluorescent Platinum Nanoclusters: Synthesis, Purification, Characterization, and Application to Bioimaging. Angew. Chem. Int. Ed. 2011, 123, 451–455. [Google Scholar] [CrossRef]
- Kawasaki, H.; Yamamoto, H.; Fujimori, H.; Arakawa, R.; Inada, M.; Iwasaki, Y. Surfactant-free solution synthesis of fluorescent platinum subnanoclusters. Chem. Commun. 2010, 46, 3759–3761. [Google Scholar] [CrossRef]
- Dahm, R. Friedrich Miescher and the discovery of DNA. Dev. Biol. 2005, 278, 274–288. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Zhao, X.; Zhang, J.; Li, W. DNA-Based Platinum Nanozymes for Peroxidase Mimetics. J. Phys. Chem. C 2014, 118, 18116–18125. [Google Scholar] [CrossRef]
- Sun, Y.; Wang, J.; Li, W.; Zhang, J.; Zhang, Y.; Fu, Y. DNA-stabilized bimetallic nanozyme and Its application on colorimetric assay of biothiols. Biosens. Bioelectron. 2015, 74, 1038–1046. [Google Scholar] [CrossRef]
- Chen, W.; Fang, X.; Li, H.; Cao, H.; Kong, J. DNA-mediated inhibition of peroxidase-like activities on platinum nanoparticles for simple and rapid colorimetric detection of nucleic acids. Biosens. Bioelectron. 2017, 94, 169. [Google Scholar] [CrossRef]
- Chen, W.; Fang, X.; Ye, X.; Wang, X.; Kong, J. Colorimetric DNA assay by exploiting the DNA-controlled peroxidase mimicking activity of mesoporous silica loaded with platinum nanoparticles. Microchim. Acta 2018, 185, 544. [Google Scholar] [CrossRef]
- Higuchi, A.; Siao, Y.D.; Yang, S.T.; Hsieh, P.V.; Fukushima, H.; Chang, Y.; Ruaan, R.C.; Chen, W.Y. Preparation of a DNA aptamer-Pt complex and its use in the colorimetric sensing of thrombin and anti-thrombin antibodies. Anal. Chem. 2008, 80, 6580–6586. [Google Scholar] [CrossRef] [PubMed]
- Kumar, C.V.; Asuncion, E.H. DNA binding studies and site selective fluorescence sensitization of an anthryl probe. J. Am. Chem. Soc. 1993, 115, 8547–8553. [Google Scholar] [CrossRef]
- Moradi, S.Z.; Nowroozi, A.; Sadrjavadi, K.; Moradi, S.; Mansouri, K.; Hosseinzadeh, L.; Shahlaei, M. Direct evidences for the groove binding of the Clomifene to double stranded DNA. Int. J. Biol. Macromol. 2018, 114, 40–53. [Google Scholar] [CrossRef]
- Hu, P.; Han, L.; Zhu, C.; Dong, S.J. Nanoreactors: A novel biosensing platform for protein assay. Chem. Commun. 2013, 49, 1705–1707. [Google Scholar] [CrossRef]
- Zhang, L.; Qi, Z.; Zou, Y.; Zhang, J.; Tang, Z. Engineering DNA-Nanozyme Interfaces for Rapid Detection of Dental Bacteria. ACS Appl. Mater. Interfaces 2019, 11, 30640–30647. [Google Scholar] [CrossRef]
- Zhang, L.; Huang, R.; Liu, W.; Liu, H.; Zhou, X.; Xing, D. Rapid and visual detection of Listeria monocytogenes based on nanoparticle cluster catalyzed signal amplification. Biosens. Bioelectron. 2016, 86, 1–7. [Google Scholar] [CrossRef]
- Zhang, Z.; Wang, Z.; Wang, X.; Yang, X. Magnetic nanoparticle-linked colorimetric aptasensor for the detection of thrombin. Sens. Actuators B Chem. 2010, 147, 428–433. [Google Scholar]
- Sun, D.; Lin, X.; Lu, J.; Wei, P.; Zhang, L. DNA nanotetrahedron-assisted electrochemical aptasensor for cardiac troponin I detection based on the co-catalysis of hybrid nanozyme, natural enzyme and artificial DNAzyme. Biosens. Bioelectron. 2019, 142, 111578. [Google Scholar] [CrossRef]
- Dehghani, Z.; Nguyen, T.; Golabi, M.; Hosseini, M.; Rezayan, A.H.; Mohammadnejad, J.; Wolff, A.; Vinayaka, A.C. Magnetic beads modified with Pt/Pd nanoparticle and aptamer as a catalytic nano-bioprobe in combination with loop mediated isothermal amplification for the on-site detection of Salmonella Typhimurium in food and fecal samples. Food Control. 2021, 121, 107664. [Google Scholar] [CrossRef]
- Wu, Y.; Li, G.; Zou, L.; Lei, S.; Yu, Q.; Ye, B. Highly active DNAzyme-peptide hybrid structure coupled porous palladium for high-performance electrochemical aptasensing platform. Sens. Actuators 2018, 259, 372–379. [Google Scholar] [CrossRef]
- An, J.; Li, G.; Zhang, Y.; Zhang, T.; Fan, H. Recent Advances in Enzyme-Nanostructure Biocatalysts with Enhanced Activity. Catalysts 2020, 10, 338. [Google Scholar] [CrossRef]
- Liu, B.; Liu, J. Surface modification of nanozymes. Nano Res. 2017, 10, 1125–1148. [Google Scholar] [CrossRef]
- Zhao, Y.; Dai, X.; Wang, F.; Zhang, X.; Fan, C.; Liu, X. Nanofabrication based on DNA nanotechnology. Nano Today 2019, 26, 123–148. [Google Scholar] [CrossRef]
- Ito, Y.; Hasuda, H. Immobilization of DNAzyme as a thermostable biocatalyst. Biotechnol. Bioeng. 2010, 86, 72–77. [Google Scholar] [CrossRef]
- Santos, F.D.J.N.D.; Ximenes, V.F.; da Fonseca, L.M.; Oliveira, O.M.M.D.F.; Brunetti, I.L. Horseradish Peroxidase-Catalyzed Oxidation of Rifampicin: Reaction Rate Enhancement by Co-oxidation with Anti-inflammatory Drugs. Biol. Pharm. Bull. 2005, 28, 1822–1826. [Google Scholar] [CrossRef] [PubMed]
- Sentchouk, V.V.; Grintsevich, E.E. Oxidation of benzidine and its derivatives by thyroid peroxidase. Biochem. Biokhimiia 2004, 69, 201. [Google Scholar] [CrossRef] [PubMed]
- Fan, J.; Yin, J.-J.; Ning, B.; Wu, X.; Hu, Y.; Ferrari, M.; Anderson, G.J.; Wei, J.; Zhao, Y.; Nie, G. Direct evidence for catalase and peroxidase activities of ferritin–platinum nanoparticles. Biomaterials 2011, 32, 1611–1618. [Google Scholar] [CrossRef] [PubMed]
- Fan, C.; Pei, H. Special Issue of "DNA Nanotechnology". Chin. J. Chem. 2016. [Google Scholar] [CrossRef]
- Yao, G.; Li, J.; Chao, J.; Pei, H.; Liu, H.; Zhao, Y.; Shi, J.; Huang, Q.; Wang, L.; Huang, W.; et al. Gold-Nanoparticle-Mediated Jigsaw-Puzzle-like Assembly of Supersized Plasmonic DNA Origami. Angew. Chem. 2015. [Google Scholar] [CrossRef]
- Chen, F.; Bai, M.; Cao, K.; Zhao, Y.; Wei, J.; Zhao, Y. Fabricating MnO2 Nanozymes as Intracellular Catalytic DNA Circuit Generators for Versatile Imaging of Base-Excision Repair in Living Cells. Adv. Funct. Mater. 2017, 27, 1702748. [Google Scholar] [CrossRef]
- Wang, H.; Yang, R.; Yang, L.; Tan, W. Nucleic Acid Conjugated Nanomaterials for Enhanced Molecular Recognition. ACS Nano 2009, 3, 2451. [Google Scholar] [CrossRef]
- Liu, J. Adsorption of DNA onto gold nanoparticles and graphene oxide: Surface science and applications. Phys. Chem. Chem.l Phys. 2012, 14, 10485–10496. [Google Scholar] [CrossRef]
- Pautler, R.; Kelly, E.Y.; Huang, P.J.J.; Cao, J.; Liu, B.; Liu, J. Attaching DNA to Nanoceria: Regulating Oxidase Activity and Fluorescence Quenching. ACS Appl. Mater. Interfaces 2013, 5, 6820–6825. [Google Scholar] [CrossRef]
- Yang, R.; Jin, J.; Chen, Y.; Shao, N.; Tan, W. Carbon Nanotube-Quenched Fluorescent Oligonucleotides: Probes that Fluoresce upon Hybridization. J. Am. Chem. Soc. 2008, 130, 8351–8358. [Google Scholar] [CrossRef]
- Lu, C.H.; Yang, H.H.; Zhu, C.L.; Chen, X.; Chen, G.N. A Graphene Platform for Sensing Biomolecules &dagger. Angew. Chem. 2009, 48, 4785–4787. [Google Scholar]
- He, S.; Song, B.; Li, D.; Zhu, C.; Qi, W.; Wen, Y.; Wang, L.; Song, S.; Fang, H.; Fan, C. A Graphene Nanoprobe for Rapid, Sensitive, and Multicolor Fluorescent DNA Analysis. Adv. Funct. Mater. 2010, 20, 453–459. [Google Scholar] [CrossRef]
- Li, H.; Rothberg, L.J. Label-Free Colorimetric Detection of Specific Sequences in PCR amplified DNA. In Proceedings of the 2005 NSTI Nanotechnology Conference and Trade Show (NSTI Nanotech 2005), Anaheim, CA, USA, 8–12 May 2005; Volume 1. [Google Scholar]
- Zhang, X.; Liu, B.; Dave, N.; Servos, M.R.; Liu, J. Instantaneous Attachment of an Ultrahigh Density of Nonthiolated DNA to Gold Nanoparticles and Its Applications. Langmuir ACS J. Surf. Colloids 2012, 28, 17053–17060. [Google Scholar] [CrossRef]
- Pei, H.; Li, F.; Wan, Y.; Wei, M.; Fan, C. Designed Diblock Oligonucleotide for the Synthesis of Spatially Isolated and Highly Hybridizable Functionalization of DNA–Gold Nanoparticle Nanoconjugates. J. Am. Chem. Soc. 2012, 134, 11876–11879. [Google Scholar] [CrossRef]
- Saha, K.; Agasti, S.S.; Kim, C.; Li, X.; Rotello, V.M. Gold Nanoparticles in Chemical and Biological Sensing. Chem. Rev. 2012, 112, 2739–2779. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Song, J.; Chen, B.L.; Wang, B.; Li, R.; Jiang, H.M.; Liu, J.F.; Li, C.Z. A label-free colorimetric assay for detection of c-Myc mRNA based on peptide nucleic acid and silver nanoparticles. Sci. Bull. 2016, 61, 1–6. [Google Scholar] [CrossRef]
- Bülbül, G.; Hayat, A.; Andreescu, S. ssDNA-Functionalized Nanoceria: A Redox-Active Aptaswitch for Biomolecular Recognition. Adv. Heal. Mater. 2016, 5, 822–828. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.; Chiuman, W.; Lam, J.C.; McManus, S.A.; Chen, W.; Cui, Y.; Pelton, R.; Brook, M.A.; Li, Y. DNA Aptamer Folding on Gold Nanoparticles: From Colloid Chemistry to Biosensors. J. Am. Chem. Soc. 2008, 130, 3610–3618. [Google Scholar] [CrossRef]
- Wang, L.; Huang, Z.; Liu, Y.; Wu, J.; Liu, J. Fluorescent DNA Probing Nanoscale MnO2: Adsorption, Dissolution by Thiol, and Nanozyme Activity. Langmuir 2018, 34, 3094–3101. [Google Scholar] [CrossRef]
- Liu, B.; Liu, J. Accelerating peroxidase mimicking nanozymes using DNA. Nanoscale 2015, 7, 13831–13835. [Google Scholar] [CrossRef]
- Li, S.; Zhao, X.; Yu, X.; Wan, Y.; Wang, H. Fe3O4 Nanozymes with Aptamer-Tuned Catalysis for Selective Colorimetric Analysis of ATP in Blood. Anal. Chem. 2019, 91, 14737–14742. [Google Scholar] [CrossRef]
- Huo, Y.; Qi, L.; Lv, X.J.; Lai, T.; Zhang, J.; Zhang, Z.Q. A sensitive aptasensor for colorimetric detection of adenosine triphosphate based on the protective effect of ATP-aptamer complexes on unmodified gold nanoparticles. Biosens. Bioelectron. 2016, 78, 315–320. [Google Scholar] [CrossRef]
- Zhang, C.; Rissman, R.A.; Feng, J. Characterization of ATP Alternations in an Alzheimer’s Transgenic Mouse Model. J. Alzheimer Dis. 2015, 44, 375–378. [Google Scholar] [CrossRef] [PubMed]
- Deng, J.; Wang, K.; Wang, M.; Yu, P.; Mao, L. Mitochondria Targeted Nanoscale Zeolitic Imidazole Framework-90 (ZIF-90) for ATP Imaging in Live Cells. J. Am. Chem. Soc. 2017, 139, 5877–5882. [Google Scholar] [CrossRef]
- Woong, J.Y.; Wang, T.; Sekyu, H.; Dokyoung, K.; Ma, D.; Hean, K.K.; Sungjee, K.; Junyang, J.; Han, A.K. A Ratiometric Two-Photon Fluorescent Probe for Tracking the Lysosomal ATP Level: Direct in cellulo Observation of Lysosomal Membrane Fusion Processes. Angew. Chem. Int. Ed. 2018, 130, 10299–10304. [Google Scholar]
- Kim, J.H.; Ahn, J.H.; Barone, P.W.; Jin, H.; Strano, M.S. A Luciferase/Single-Walled Carbon Nanotube Conjugate for Near-Infrared Fluorescent Detection of Cellular ATP. Angew. Chem. Int. Ed. 2010, 49, 1456–1459. [Google Scholar] [CrossRef]
- Lindsay, V.N.G.; Viart, H.M.-F.; Sarpong, R.; And, H.M.-F.V. ChemInform Abstract: Stereodivergent Intramolecular C(sp3)-H Functionalization of Azavinyl Carbenes: Synthesis of Saturated Heterocycles and Fused N-Heterotricycles. Chemin 2015, 46, 8368. [Google Scholar] [CrossRef]
- Kashefi-Kheyrabadi, L.; Mehrgardi, M.A. Aptamer-conjugated silver nanoparticles for electrochemical detection of adenosine triphosphate. Biosens. Bioelectron. 2012, 37, 94–98. [Google Scholar] [CrossRef]
- Wang, J.; Wang, L.; Liu, X.; Liang, Z.; Song, S.; Li, W.; Li, G.; Fan, C. A Gold Nanoparticle-Based Aptamer Target Binding Readout for ATP Assay. Adv. Mater. 2007, 19, 3943–3946. [Google Scholar] [CrossRef]
- Hizir, M.S.; Top, M.; Balcioglu, M.; Rana, M.; Robertson, N.M.; Shen, F.; Sheng, J.; Yigit, M.V. Multiplexed Activity of perAuxidase: DNA-Capped AuNPs Act as Adjustable Peroxidase. Anal. Chem. 2016, 88, 600–605. [Google Scholar] [CrossRef]
- Li, Z.-M.; Zhong, X.-L.; Wen, S.-H.; Zhang, L.; Liang, R.-P.; Qiu, J.-D. Colorimetric detection of methyltransferase activity based on the enhancement of CoOOH nanozyme activity by ssDNA. Sens. Actuators B Chem. 2019, 281, 1073–1079. [Google Scholar] [CrossRef]
- Liu, B.; Huang, Z.; Liu, J. Boosting the oxidase mimicking activity of nanoceria by fluoride capping: Rivaling protein enzymes and ultrasensitive F−detection. Nanoscale 2016, 8, 13562–13567. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.; Fa, M.; Gao, L.; Zhao, R.; Luo, Y.; Yao, X. The Effect of DNA on the Oxidase Activity of Nanoceria with Different Morphologies. Nanotechnology 2018, 29, 385101. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhou, K.; Zhai, Y.; Qin, F.; Pan, L.; Yao, X. Crystal plane effects of nano-CeO2 on its antioxidant activity. Rsc Adv. 2014, 4, 50325–50330. [Google Scholar] [CrossRef]
- Heckert, E.G.; Karakoti, A.S.; Seal, S.; Self, W.T. The role of cerium redox state in the SOD mimetic activity of nanoceria. Biomaterials 2008, 29, 2705–2709. [Google Scholar] [CrossRef] [PubMed]
- Pirmohamed, T.; Dowding, J.M.; Singh, S.; Wasserman, B.; Heckert, E.; Karakoti, A.S.; King, J.E.S.; Seal, S.; Self, W.T. Nanoceria exhibit redox state-dependent catalase mimetic activity. Chem. Commun. 2010, 46, 2736–2738. [Google Scholar] [CrossRef] [PubMed]
- Ge, C.; Fang, G.; Shen, X.; Chong, Y.; Wamer, W.G.; Gao, X.; Chai, Z.; Chen, C.; Yin, J.J. Facet Energy versus Enzyme-like Activities: The Unexpected Protection of Palladium Nanocrystals against Oxidative Damage. Acs Nano 2016, 10, 10436. [Google Scholar] [CrossRef] [PubMed]
- Peterson, G.W.; Lu, A.X.; Epps, I.; Thomas, H. Tuning the Morphology and Activity of Electrospun Polystyrene/ UiO-66-NH2 Metal-Organic Framework Composites to Enhance Chemical Warfare Agent Removal. ACS Appl. Mater. Interfaces 2017, 9, 32248–32254, acsami.7b09209. [Google Scholar] [CrossRef]
- Singh, N.; Geethika, M.; Mugesh, G.; Motika, G.; Eswarappa, S.M. Manganese-Based Nanozymes: Multienzyme Redox Activity and Effect on the Nitric Oxide Produced by Endothelial Nitric Oxide Synthase. Chem. A Eur. J. 2018, 24, 8393–8403. [Google Scholar] [CrossRef]
- Fang, G.; Li, W.; Shen, X.; Perez-Aguilar, J.M.; Chong, Y.; Gao, X.; Chai, Z.; Chen, C.; Ge, C.; Zhou, R. Differential Pd-nanocrystal facets demonstrate distinct antibacterial activity against Gram-positive and Gram-negative bacteria. Nat. Commun. 2018, 9, 1–9. [Google Scholar] [CrossRef]
- Baldim, V.; Bedioui, F.; Mignet, N.; Margaill, I.; Berret, J.F. The enzyme-like catalytic activity of cerium oxide nanoparticles and its dependency on Ce3+ surface area concentration. Nanoscale 2018, 10, 6971–6980. [Google Scholar] [CrossRef]
- Zhang, W.; Dong, J.; Wu, Y.; Cao, P.; Song, L.; Ma, M.; Gu, N.; Zhang, Y. Shape-dependent enzyme-like activity of Co3O4 nanoparticles and their conjugation with his-tagged EGFR single-domain antibody. Colloids Surf. B Biointerfaces 2017, 154, 55–62. [Google Scholar] [CrossRef]
- Schaate, A.; Roy, P.; Godt, A.; Lippke, J.; Waltz, F.; Wiebcke, M.; Behrens, P. Modulated Synthesis of Zr-Based Metal–Organic Frameworks: From Nano to Single Crystals. Chem. A Eur. J. 2011, 17, 6643–6651. [Google Scholar] [CrossRef] [PubMed]
- Peng, F.F.; Zhang, Y.; Gu, N. Size-dependent peroxidase-like catalytic activity of Fe3O4 nanoparticles. Chin. Chem. Lett. 2008, 19, 730–733. [Google Scholar] [CrossRef]
- Asati, A.; Santra, S.; Kaittanis, C.; Nath, S.; Perez, J.M. Oxidase-Like Activity of Polymer-Coated Cerium Oxide Nanoparticles. Angew. Chem. 2009, 121, 2344–2348. [Google Scholar] [CrossRef]
- Huang, L.; Chen, K.; Zhang, W.; Zhu, W.; Liu, X.; Wang, J.; Wang, R.; Hu, N.; Suo, Y.; Wang, J. ssDNA-tailorable oxidase-mimicking activity of spinel MnCo2O4 for sensitive biomolecular detection in food sample. Sens. Actuators B Chem. 2018, 269, 79–87. [Google Scholar] [CrossRef]
- Zhao, L.; Wang, J.; Su, D.; Zhang, Y.; Lu, H.; Yan, X.; Bai, J.; Gao, Y.; Lu, G. The DNA controllable peroxidase mimetic activity of MoS2 nanosheets for constructing a robust colorimetric biosensor. Nanoscale 2020, 12, 12. [Google Scholar] [CrossRef] [PubMed]
- Kitajima, N.; Fukuzumi, S.; Ono, Y. Formation of superoxide ion during the decomposition of hydrogen peroxide on supported metal oxides. J. Phys. Chem. 1978, 82, 1505–1509. [Google Scholar] [CrossRef]
- Mochida, I.; Takeshita, K. Transition metal ions on molecular sieves. II. Catalytic activities of transition metal ions on molecular sieves for the decomposition of hydrogen peroxide. J. Phys. Chem. 1974, 78, 1653–1657. [Google Scholar] [CrossRef]
- Ma, M.; Zhang, Y.; Gu, N. Peroxidase-like catalytic activity of cubic Pt nanocrystals. Colloids Surf. A Physicochem. Eng. Asp. 2011, 373, 6–10. [Google Scholar] [CrossRef]
- Chen, X.; Su, B.; Cai, Z.; Chen, X.; Oyama, M. PtPd nanodendrites supported on graphene nanosheets: A peroxidase-like catalyst for colorimetric detection of H2O2. Sens. Actuators B Chem. 2014, 201, 286–292. [Google Scholar] [CrossRef]
- Aiuchi, T.; Nakajo, S.; Nakaya, K. Reducing Activity of Colloidal Platinum Nanoparticles for Hydrogen Peroxide, 2,2-Diphenyl-1-picrylhydrazyl Radical and 2,6-Dichlorophenol Indophenol. Biol. Pharm. Bull. 2004, 27, 736–738. [Google Scholar] [CrossRef] [PubMed]
- Sriphathoorat, R.; Wang, K.; Luo, S.; Tang, M.; Du, H.; Du, X.; Shen, P.K. Well-defined PtNiCo core–shell nanodendrites with enhanced catalytic performance for methanol oxidation. J. Mater. Chem. A 2016, 4, 18015–18021. [Google Scholar] [CrossRef]
- Vinita, N.N.; Nirala, N.R.; Prakash, R. One step synthesis of AuNPs@MoS2 -QDs composite as a robust peroxidase- mimetic for instant unaided eye detection of glucose in serum, saliva and tear. Sens. Actuators B Chem. 2018, 263, 109–119, S0925400518303630. [Google Scholar] [CrossRef]
- Wu, X.; Chen, T.; Wang, J.; Yang, G. Few-layered MoSe2 nanosheets as an efficient peroxidase nanozyme for highly sensitive colorimetric detection of H2O2 and xanthine. J. Mater. Chem. B 2018, 6, 105–111. [Google Scholar] [CrossRef] [PubMed]
- Hu, W.C.; Younis, M.R.; Zhou, Y.; Wang, C.; Xia, X.H. Antibacterial Therapy: In Situ Fabrication of Ultrasmall Gold Nanoparticles/2D MOFs Hybrid as Nanozyme for Antibacterial Therapy. Small 2020, 16, 2070130. [Google Scholar] [CrossRef]
- Niu, J.; Sun, Y.; Wang, F.; Zhao, C.; Ren, J.; Qu, X. Photo-modulated Nanozyme Used for Gram-Selective Antimicrobial. Chem. Mater. 2018, 30, 7027–7033. [Google Scholar] [CrossRef]
- Sang, Y.; Cao, F.; Li, W.; Zhang, L.; You, Y.; Deng, Q.; Dong, K.; Ren, J.; Qu, X. Bioinspired Construction of a Nanozyme-Based H2O2 Homeostasis Disruptor for Intensive Chemodynamic Therapy. J. Am. Chem. Soc. 2020, 142, 5177–5183. [Google Scholar] [CrossRef] [PubMed]
- Qiu, K.; Wang, J.; Rees, T.W.; Ji, L.; Zhang, Q.; Chao, H. A mitochondria-targeting photothermogenic nanozyme for MRI-guided mild photothermal therapy. Chem. Commun. 2018, 54, 14108–14111. [Google Scholar] [CrossRef]
- Li, X.; Zhao, C.; Deng, G.; Liu, W.; Shao, J.; Zhou, Z.; Liu, F.; Yang, H.; Yang, S. Nanozyme-Augmented Tumor Catalytic Therapy by Self-Supplied H2O2 Generation. ACS Appl. Bio Mater. 2020, 3, 1769–1778. [Google Scholar] [CrossRef]
- Chang, M.; Wang, M.; Wang, M.; Shu, M.; Ding, B.; Li, C.; Pang, M.; Cui, S.; Hou, Z.; Lin, J. A Multifunctional Cascade Bio reactor Based on Hollow-Structured Cu2MoS4 for Synergetic Cancer Chemo-Dynamic Therapy/Starvation Therapy/Phototherapy/Immunotherapy with Remarkably Enhanced Efficacy. Adv. Mater. 2019, 31, 1905271. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Shang, L.; Xu, B.; Wang, S.; Gu, K.; Wu, Q.; Sun, Y.; Zhang, Q.; Yang, H.; Zhang, F.; et al. A Nanozyme with Photo-Enhanced Dual Enzyme-Like Activities for Deep Pancreatic Cancer Therapy. Angew. Chem. Int. Ed. 2019, 58, 12624–12631. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Liu, J.; Deng, H.; Ma, R.; Liao, J.-Y.; Liang, H.; Hu, J.; Li, J.; Guo, Z.; Cai, J.; et al. Targeting Mitochondria-Located circRNA SCAR Alleviates NASH via Reducing mROS Output. Cell 2020, 183, 76–93. [Google Scholar] [CrossRef] [PubMed]
- Feng, L.; Liu, B.; Xie, R.; Wang, D.; Qian, C.; Zhou, W.; Liu, J.; Jana, D.; Yang, P.; Zhao, Y. An Ultrasmall SnFe2O4 Nanozyme with Endogenous Oxygen Generation and Glutathione Depletion for Synergistic Cancer Therapy. Adv. Funct. Mater. 2020, 31, 2006216. [Google Scholar] [CrossRef]
Nanozyme | Target | Nucleic Acid | Enzyme Activity Changes | Strategy for Target Assay | LOD | References |
---|---|---|---|---|---|---|
Fe3O4 | Thrombin | 5′-NH2-(CH2)6-TTTTTTTTTTGGTTGGTGTGGTTGG-3′ | Inhibition | Target block the substrate diffusion | 0.19 nM | [63] |
Fe3O4 | Thrombin | 1,5′-biotin-(CH2)6-AGTCCGTGGTAGGGCAGGTTGGGGTGACT-3′ | Enhancement | Target bound aptamer-nanozyme | 1 nM | [66] |
Fe3O4 | Streptococcus mutans | 5′-biotin-TTTATACTATCGCATTCCTTCCGAGGGGGGGGGGGGGGGGGGGGGGGGGGGTCGGT-3′ | Inhibition | Target block the substrate diffusion | 12 CFU/mL | [64] |
Fe3O4 | Listeria monocytogenes | 5′-NH2-TTTTTTTTTTATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT-3′ | Enhancement | Target bound aptamer-nanozyme | 5.4 × 103 CFU/mL | [65] |
Fe3O4 | Cardiac troponin I | 5′-CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC-3′ | Enhancement | Target bound aptamer-nanozyme | 3–10 CFU/mL | [67] |
Pt/Pd | Salmonella | 5′-biotin-ATAGGAGTCACG ACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT-3′ | Inhibition | Target block the substrate diffusion | 3–10 CFU/mL | [68] |
Pd | Carcinoembryonic antigen CEA | 3′-NH2-AGGGGGTGAAGGGATACCC-5′ | Enhancement | Target bound aptamer-nanozyme | 20 fg/mL | [69] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Xu, Y.; Cheng, N.; Wang, X.; Huang, K.; Luo, Y. Recent Advances in Nucleic Acid Modulation for Functional Nanozyme. Catalysts 2021, 11, 638. https://doi.org/10.3390/catal11050638
Wang X, Xu Y, Cheng N, Wang X, Huang K, Luo Y. Recent Advances in Nucleic Acid Modulation for Functional Nanozyme. Catalysts. 2021; 11(5):638. https://doi.org/10.3390/catal11050638
Chicago/Turabian StyleWang, Xin, Yuancong Xu, Nan Cheng, Xinxian Wang, Kunlun Huang, and Yunbo Luo. 2021. "Recent Advances in Nucleic Acid Modulation for Functional Nanozyme" Catalysts 11, no. 5: 638. https://doi.org/10.3390/catal11050638
APA StyleWang, X., Xu, Y., Cheng, N., Wang, X., Huang, K., & Luo, Y. (2021). Recent Advances in Nucleic Acid Modulation for Functional Nanozyme. Catalysts, 11(5), 638. https://doi.org/10.3390/catal11050638