Flux Enforcement for Fermentative Production of 5-Aminovalerate and Glutarate by Corynebacterium glutamicum
Abstract
:1. Introduction
2. Results
2.1. Design of the Study: Comparing Flux Enforcement with Either a Single or Two Coupling Sites
2.2. Proof of Principle: Putrescine Oxidases Oxidatively Deaminate Cadaverine in C. glutamicum
2.3. Deletion of Genes for Conversion of 5AVA to Glutarate and Change of the Microcultivation System Improved 5AVA Production
2.4. Flux Enforcement by Deletion of the l-Glutamic Acid Dehydrogenase Gene Improved Glutarate Production
3. Discussion
4. Materials and Methods
4.1. Microorganisms and Cultivation Conditions
4.2. Molecular Biology Methods
4.3. HPLC Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Bioplastics Market. Available online: https://www.european-bioplastics.org/market/ (accessed on 15 September 2020).
- Ali, M.A.; Kaneko, T. Polyamide Syntheses. In Encyclopedia of Polymeric Nanomaterials; Kobayashi, S., Müllen, K., Eds.; Springer: Berlin/Heidelberg, Germany, 2015; pp. 1750–1762. ISBN 978-3-642-29647-5. [Google Scholar]
- Ligon, S.C.; Liska, R.; Stampfl, J.; Gurr, M.; Mülhaupt, R. Polymers for 3D Printing and Customized Additive Manufacturing. Chem. Rev. 2017, 117, 10212–10290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Radzik, P.; Leszczyńska, A.; Pielichowski, K. Modern biopolyamide-based materials: Synthesis and modification. Polym. Bull. 2020, 77, 501–528. [Google Scholar] [CrossRef] [Green Version]
- Adkins, J.; Jordan, J.; Nielsen, D.R. Engineering Escherichia coli for renewable production of the 5-carbon polyamide building-blocks 5-aminovalerate and glutarate. Biotechnol. Bioeng. 2013, 110, 1726–1734. [Google Scholar] [CrossRef] [PubMed]
- Wendisch, V.F. Metabolic engineering advances and prospects for amino acid production. Metab. Eng. 2020, 58, 17–34. [Google Scholar] [CrossRef]
- Mimitsuka, T.; Sawai, H.; Hatsu, M.; Yamada, K. Metabolic Engineering of Corynebacterium glutamicum for Cadaverine Fermentation. Biosci. Biotechnol. Biochem. 2007, 71, 2130–2135. [Google Scholar] [CrossRef] [Green Version]
- Kind, S.; Kreye, S.; Wittmann, C. Metabolic engineering of cellular transport for overproduction of the platform chemical 1,5-diaminopentane in Corynebacterium glutamicum. Metab. Eng. 2011, 13, 617–627. [Google Scholar] [CrossRef]
- Wendisch, V.F.; Mindt, M.; Pérez-García, F. Biotechnological production of mono- and diamines using bacteria: Recent progress, applications, and perspectives. Appl. Microbiol. Biotechnol. 2018, 102, 3583–3594. [Google Scholar] [CrossRef]
- Jorge, J.M.P.; Pérez-García, F.; Wendisch, V.F. A new metabolic route for the fermentative production of 5-aminovalerate from glucose and alternative carbon sources. Bioresour. Technol. 2017. [Google Scholar] [CrossRef]
- Fothergill, J.C.; Guest, J.R. Catabolism of l-Lysine by Pseudomonas aeruginosa. J. Gen. Microbiol. 1977, 99, 139–155. [Google Scholar] [CrossRef] [Green Version]
- Rohles, C.M.; Gießelmann, G.; Kohlstedt, M.; Wittmann, C.; Becker, J. Systems metabolic engineering of Corynebacterium glutamicum for the production of the carbon-5 platform chemicals 5-aminovalerate and glutarate. Microb. Cell Factories 2016, 15. [Google Scholar] [CrossRef] [Green Version]
- Shin, J.H.; Park, S.H.; Oh, Y.H.; Choi, J.W.; Lee, M.H.; Cho, J.S.; Jeong, K.J.; Joo, J.C.; Yu, J.; Park, S.J.; et al. Metabolic engineering of Corynebacterium glutamicum for enhanced production of 5-aminovaleric acid. Microb. Cell Factories 2016, 15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chae, T.U.; Ahn, J.H.; Ko, Y.-S.; Kim, J.W.; Lee, J.A.; Lee, E.H.; Lee, S.Y. Metabolic engineering for the production of dicarboxylic acids and diamines. Metab. Eng. 2020, 58, 2–16. [Google Scholar] [CrossRef] [PubMed]
- Pérez-García, F.; Jorge, J.M.P.; Dreyszas, A.; Risse, J.M.; Wendisch, V.F. Efficient Production of the Dicarboxylic Acid Glutarate by Corynebacterium glutamicum via a Novel Synthetic Pathway. Front. Microbiol. 2018, 9, 2589. [Google Scholar] [CrossRef] [PubMed]
- Rohles, C.M.; Gläser, L.; Kohlstedt, M.; Gießelmann, G.; Pearson, S.; del Campo, A.; Becker, J.; Wittmann, C. A bio-based route to the carbon-5 chemical glutaric acid and to bionylon-6,5 using metabolically engineered Corynebacterium glutamicum. Green Chem. 2018, 20, 4662–4674. [Google Scholar] [CrossRef] [Green Version]
- Smirnov, S.V.; Kodera, T.; Samsonova, N.N.; Kotlyarova, V.A.; Rushkevich, N.Y.; Kivero, A.D.; Sokolov, P.M.; Hibi, M.; Ogawa, J.; Shimizu, S. Metabolic engineering of Escherichia coli to produce (2S, 3R, 4S)-4-hydroxyisoleucine. Appl. Microbiol. Biotechnol. 2010, 88, 719–726. [Google Scholar] [CrossRef]
- Theodosiou, E.; Breisch, M.; Julsing, M.K.; Falcioni, F.; Bühler, B.; Schmid, A. An artificial TCA cycle selects for efficient α-ketoglutarate dependent hydroxylase catalysis in engineered Escherichia coli: Strain Design for Proline Hydroxylation in Vivo. Biotechnol. Bioeng. 2017, 114, 1511–1520. [Google Scholar] [CrossRef] [Green Version]
- Kind, S.; Becker, J.; Wittmann, C. Increased lysine production by flux coupling of the tricarboxylic acid cycle and the lysine biosynthetic pathway—Metabolic engineering of the availability of succinyl-CoA in Corynebacterium glutamicum. Metab. Eng. 2013, 15, 184–195. [Google Scholar] [CrossRef]
- van Hellemond, E.W.; van Dijk, M.; Heuts, D.P.H.M.; Janssen, D.B.; Fraaije, M.W. Discovery and characterization of a putrescine oxidase from Rhodococcus erythropolis NCIMB 11540. Appl. Microbiol. Biotechnol. 2008, 78, 455–463. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.-I.; Jang, J.-H.; Yu, M.-J.; Kim, Y.-W. Construction of a Bifunctional Enzyme Fusion for the Combined Determination of Biogenic Amines in Foods. J. Agric. Food Chem. 2013, 61, 9118–9124. [Google Scholar] [CrossRef]
- Baumgart, M.; Unthan, S.; Rückert, C.; Sivalingam, J.; Grünberger, A.; Kalinowski, J.; Bott, M.; Noack, S.; Frunzke, J. Construction of a Prophage-Free Variant of Corynebacterium glutamicum ATCC 13032 for Use as a Platform Strain for Basic Research and Industrial Biotechnology. Appl. Environ. Microbiol. 2013, 79, 6006–6015. [Google Scholar] [CrossRef] [Green Version]
- Pérez-García, F.; Peters-Wendisch, P.; Wendisch, V.F. Engineering Corynebacterium glutamicum for fast production of l-lysine and l-pipecolic acid. Appl. Microbiol. Biotechnol. 2016, 100, 8075–8090. [Google Scholar] [CrossRef] [PubMed]
- Unthan, S.; Baumgart, M.; Radek, A.; Herbst, M.; Siebert, D.; Brühl, N.; Bartsch, A.; Bott, M.; Wiechert, W.; Marin, K.; et al. Chassis organism from Corynebacterium glutamicum—A top-down approach to identify and delete irrelevant gene clusters. Biotechnol. J. 2015, 10, 290–301. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Engels, V.; Lindner, S.N.; Wendisch, V.F. The global repressor SugR controls expression of genes of glycolysis and of the l-lactate dehydrogenase LdhA in Corynebacterium glutamicum. J. Bacteriol. 2008, 190, 8033–8044. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nguyen, A.Q.D.; Schneider, J.; Wendisch, V.F. Elimination of polyamine N-acetylation and regulatory engineering improved putrescine production by Corynebacterium glutamicum. J. Biotechnol. 2015, 201, 75–85. [Google Scholar] [CrossRef] [PubMed]
- Lubitz, D.; Jorge, J.M.P.; Pérez-García, F.; Taniguchi, H.; Wendisch, V.F. Roles of export genes cgmA and lysE for the production of l-arginine and l-citrulline by Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 2016, 100, 8465–8474. [Google Scholar] [CrossRef]
- Funke, M.; Diederichs, S.; Kensy, F.; Müller, C.; Büchs, J. The Baffled Microtiter Plate: Increased Oxygen Transfer and Improved Online Monitoring in Small Scale Fermentations. Biotechnol. Bioeng. 2009, 103, 1118–1128. [Google Scholar] [CrossRef]
- Duetz, W.A.; Rüedi, L.; Hermann, R.; O’Connor, K.; Büchs, J.; Witholt, B. Methods for Intense Aeration, Growth, Storage, and Replication of Bacterial Strains in Microtiter Plates. Appl. Environ. Microbiol. 2000, 66, 2641–2646. [Google Scholar] [CrossRef] [Green Version]
- Tesch, M.; de Graaf, A.A.; Sahm, H. In Vivo Fluxes in the Ammonium-Assimilatory Pathways in Corynebacterium glutamicum Studied by 15N Nuclear Magnetic Resonance. Appl. Environ. Microbiol. 1999, 65, 1099–1109. [Google Scholar] [CrossRef] [Green Version]
- Floris, G.; Finazzi Agrò, A. Amine Oxidases. In Encyclopedia of Biological Chemistry; Elsevier: Amsterdam, The Netherlands, 2013; pp. 87–90. ISBN 978-0-12-378631-9. [Google Scholar]
- Lee, J.-I.; Kim, Y.-W. Characterization of amine oxidases from Arthrobacter aurescens and application for determination of biogenic amines. World J. Microbiol. Biotechnol. 2013, 29, 673–682. [Google Scholar] [CrossRef]
- Nau, W.M.; Ghale, G.; Hennig, A.; Bakirci, H.; Bailey, D.M. Substrate-Selective Supramolecular Tandem Assays: Monitoring Enzyme Inhibition of Arginase and Diamine Oxidase by Fluorescent Dye Displacement from Calixarene and Cucurbituril Macrocycles. J. Am. Chem. Soc. 2009, 131, 11558–11570. [Google Scholar] [CrossRef]
- Milse, J.; Petri, K.; Rückert, C.; Kalinowski, J. Transcriptional response of Corynebacterium glutamicum ATCC 13032 to hydrogen peroxide stress and characterization of the OxyR regulon. J. Biotechnol. 2014, 190, 40–54. [Google Scholar] [CrossRef]
- Romero, E.; Gómez Castellanos, J.R.; Gadda, G.; Fraaije, M.W.; Mattevi, A. Same Substrate, Many Reactions: Oxygen Activation in Flavoenzymes. Chem. Rev. 2018, 118, 1742–1769. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Käß, F.; Prasad, A.; Tillack, J.; Moch, M.; Giese, H.; Büchs, J.; Wiechert, W.; Oldiges, M. Rapid assessment of oxygen transfer impact for Corynebacterium glutamicum. Bioprocess Biosyst. Eng. 2014, 37, 2567–2577. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jensen, R.A. Enzyme Recruitment in Evolution of New Function. Annu. Rev. Microbiol. 1976, 30, 409–425. [Google Scholar] [CrossRef] [Green Version]
- Wilding, M.; Peat, T.S.; Kalyaanamoorthy, S.; Newman, J.; Scott, C.; Jermiin, L.S. Reverse engineering: Transaminase biocatalyst development using ancestral sequence reconstruction. Green Chem. 2017, 19, 5375–5380. [Google Scholar] [CrossRef] [Green Version]
- Atkins, W.M. Biological messiness vs. biological genius: Mechanistic aspects and roles of protein promiscuity. J. Steroid Biochem. Mol. Biol. 2015, 151, 3–11. [Google Scholar] [CrossRef] [Green Version]
- Jorge, J.M.P.; Leggewie, C.; Wendisch, V.F. A new metabolic route for the production of gamma-aminobutyric acid by Corynebacterium glutamicum from glucose. Amino Acids 2016, 48, 2519–2531. [Google Scholar] [CrossRef]
- Gröger, H. Biocatalytic concepts for synthesizing amine bulk chemicals: Recent approaches towards linear and cyclic aliphatic primary amines and ω-substituted derivatives thereof. Appl. Microbiol. Biotechnol. 2019, 103, 83–95. [Google Scholar] [CrossRef]
- Breuer, M.; Ditrich, K.; Habicher, T.; Hauer, B.; Keßeler, M.; Stürmer, R.; Zelinski, T. Industrial Methods for the Production of Optically Active Intermediates. Angew. Chem. Int. Ed. 2004, 43, 788–824. [Google Scholar] [CrossRef]
- Grigoriou, S.; Kugler, P.; Kulcinskaja, E.; Walter, F.; King, J.; Hill, P.; Wendisch, V.F.; O’Reilly, E. Development of a Corynebacterium glutamicum bio-factory for self-sufficient transaminase reactions. Green Chem. 2020, 22, 4128–4132. [Google Scholar] [CrossRef]
- Klatte, S.; Wendisch, V.F. Redox self-sufficient whole cell biotransformation for amination of alcohols. Bioorganic Med. Chem. 2014, 22, 5578–5585. [Google Scholar] [CrossRef] [PubMed]
- Hennig, G.; Haupka, C.; Brito, L.F.; Rückert, C.; Cahoreau, E.; Heux, S.; Wendisch, V.F. Methanol-Essential Growth of Corynebacterium glutamicum: Adaptive Laboratory Evolution Overcomes Limitation due to Methanethiol Assimilation Pathway. Int. J. Mol. Sci. 2020, 21, 3617. [Google Scholar] [CrossRef] [PubMed]
- Tuyishime, P.; Wang, Y.; Fan, L.; Zhang, Q.; Li, Q.; Zheng, P.; Sun, J.; Ma, Y. Engineering Corynebacterium glutamicum for methanol-dependent growth and glutamate production. Metab. Eng. 2018, 49, 220–231. [Google Scholar] [CrossRef] [PubMed]
- Burkovski, A. Nitrogen Metabolism and Its Regulation. In Handbook of Corynebacterium Glutamicum; Eggeling, L., Bott, M., Eds.; CRC Press LLC: Boca Raton, FL, USA, 2005; pp. 335–352. ISBN 0-8493-1821-1. [Google Scholar]
- Tesch, M.; Eikmanns, B.J.; de Graaf, A.A.; Sahm, H. Ammonia assimilation in Corynebacterium glutamicum and a glutamate dehydrogenase-deficient mutant. Biotechnol. Lett. 1998, 20, 953–957. [Google Scholar] [CrossRef]
- Nolden, L.; Farwick, M.; Krämer, R.; Burkovski, A. Glutamine synthetases of Corynebacterium glutamicum: Transcriptional control and regulation of activity. FEMS Microbiol. Lett. 2001, 201, 91–98. [Google Scholar] [CrossRef] [PubMed]
- Wendisch, V.F.; Lee, J.-H. Metabolic Engineering in Corynebacterium glutamicum. In Corynebacterium Glutamicum; Inui, M., Toyoda, K., Eds.; Microbiology Monographs; Springer International Publishing: Cham, Switzerland, 2020; Volume 23, pp. 287–322. ISBN 978-3-030-39266-6. [Google Scholar]
- Arnold, F.H. Innovation by Evolution: Bringing New Chemistry to Life (Nobel Lecture). Angew. Chem. Int. Ed. 2019, 58, 14420–14426. [Google Scholar] [CrossRef] [Green Version]
- Tenaillon, O.; Barrick, J.E.; Ribeck, N.; Deatherage, D.E.; Blanchard, J.L.; Dasgupta, A.; Wu, G.C.; Wielgoss, S.; Cruveiller, S.; Médigue, C.; et al. Tempo and mode of genome evolution in a 50,000-generation experiment. Nature 2016, 536, 165–170. [Google Scholar] [CrossRef] [Green Version]
- Barrick, J.E.; Yu, D.S.; Yoon, S.H.; Jeong, H.; Oh, T.K.; Schneider, D.; Lenski, R.E.; Kim, J.F. Genome evolution and adaptation in a long-term experiment with Escherichia coli. Nature 2009, 461, 1243–1247. [Google Scholar] [CrossRef]
- Dragosits, M.; Mattanovich, D. Adaptive laboratory evolution—Principles and applications for biotechnology. Microb. Cell Factories 2013, 12, 64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Fan, L.; Tuyishime, P.; Liu, J.; Zhang, K.; Gao, N.; Zhang, Z.; Ni, X.; Feng, J.; Yuan, Q.; et al. Adaptive laboratory evolution enhances methanol tolerance and conversion in engineered Corynebacterium glutamicum. Commun. Biol. 2020, 3. [Google Scholar] [CrossRef]
- Leßmeier, L.; Wendisch, V.F. Identification of two mutations increasing the methanol tolerance of Corynebacterium glutamicum. BMC Microbiol. 2015, 15. [Google Scholar] [CrossRef] [Green Version]
- Hanahan, D. Techniques for transformation of E. coli. DNA Cloning Pract. Approach 1985, 1, 109–135. [Google Scholar]
- Eikmanns, B.J.; Thum-Schmitz, N.; Eggeling, L.; Lüdtke, K.U.; Sahm, H. Nucleotide sequence, expression and transcriptional analysis of the Corynebacterium glutamicum gltA gene encoding citrate synthase. Microbiology 1994, 140, 1817–1828. [Google Scholar] [CrossRef] [Green Version]
- Simon, R.; Priefer, U.; Pühler, A. A broad host range mobilization system for in vivo genetic engineering: Transposon mutagenesis in Gram negative bacteria. Bio/Technology 1983, 1, 784–791. [Google Scholar] [CrossRef]
- Gibson, D.G.; Young, L.; Chuang, R.-Y.; Venter, J.C.; Hutchison, C.A.; Smith, H.O. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 2009, 6, 343–345. [Google Scholar] [CrossRef]
- Schneider, J.; Niermann, K.; Wendisch, V.F. Production of the amino acids l-glutamate, l-lysine, l-ornithine and l-arginine from arabinose by recombinant Corynebacterium glutamicum. J. Biotechnol. 2011, 154, 191–198. [Google Scholar] [CrossRef]
Strain | Relevant Characteristics | Reference |
---|---|---|
E. coli DH5α | ∆lacU169 (φ80lacZ ∆M15), supE44, hsdR17, recA1, endA1, gyrA96, thi-1, relA1 | [54] |
C. glutamicum GRLys1 (DM1933ΔCGP123) | C. glutamicum ATCC13032 with modifications: Δpck, pycP458S, homV59A, 2 copies of lysCT311I, 2 copies of asd, 2 copies of dapA, 2 copies of dapB, 2 copies of ddh, 2 copies of lysA, 2 copies of lysE, in-frame deletion of prophages CGP1 (cg1507-cg1524), CGP2 (cg1746-cg1752) and CGP3 (cg1890-cg2071). | [55] |
GSLA2 | GRLys1 with in-frame deletions: sugR (cg2115), ldhA (cg3219), snaA (cg1722), cgmA (cg2893) | [15] |
GSLA2ΔgabTDP | GSLA2 with in-frame deletions: gabT, gabD and gabP (cg0566-cg0568) | [10] |
GSLA2G | GSLA2 with in-frame deletion: gdh (cg2280) | [15] |
AVA1 | GSLA2(pVWEx1-ldcC)(pEC-XT99A) | [10] |
AVA1_patA | GSLA2(pVWEx1-ldcC)(pEKEx3-patDA) | [10] |
AVA1_puoPa | GSLA2(pVWEx1-ldcC)(pEC-XT99A-puoPa-patD) | This study |
AVA1_puoRq | GSLA2(pVWEx1-ldcC)(pEC-XT99A-puoRq-patD) | This study |
AVA2 | GSLA2ΔgabTDP(pVWEx1-ldcC)(pEC-XT99A) | [15] |
AVA2_patA | GSLA2ΔgabTDP(pVWEx1-ldcC)(pEKEx3-patDA) | [15] |
AVA2_puoPa | GSLA2ΔgabTDP(pVWEx1-ldcC)(pEC-XT99A-puoPa-patD) | This study |
AVA2_puoRq | GSLA2ΔgabTDP(pVWEx1-ldcC)(pEC-XT99A-puoRq-patD) | This study |
GLUT_patA | GSLA2G(pVWEx1-ldcC)(pEKEx3-patDA)(pEC-XT99A-gabTDPstu) | [15] |
GLUT_puoRq | GSLA2G(pVWEx1-ldcC)(pEKEx3-puoRq-patD)(pEC-XT99A-gabTDPstu) | This study |
Plasmid | Relevant Characteristics | Reference |
---|---|---|
pBV2xp | AmpR, KanR, B. methanolicus/E. coli shuttle vector, pHCMC04 derivative, Pxyl from B. megaterium | [56] |
pBV2xp-puoRq-patD | pBV2xp-expressing puo from R. qingshengii and patD from E. coli MG1655 | This study |
pBV2xp-puoPa-patD | pBV2xp-expressing puo from P. aurescens and patD from E. coli MG1655 | This study |
pEC-XT99A | TetR, C. glutamicum/E. coli shuttle vector (Ptrc, lacIq, pGA1 oriVCg) | [57] |
pEC-XT99A-gabTDPstu | pEC-XT99A-expressing gabT and gabD from Pseudomonas stutzerii ATCC17588 | [15] |
pEC-XT99A-puoPa-patD | pEC-XT99A-expressing puo from P. aurescens and patD from E. coli MG1655 | This study |
pEC-XT99A-puoRq-patD | pEC-XT99A-expressing puo from R. qingshengii and patD from E. coli MG1655 | This study |
pEKEx3 | SpecR, C. glutamicum/E. coli shuttle vector (Ptac lacIq pBL1, oriVEc) | [58] |
pEKEx3-patDA | pEKEx3-expressing patD and patA from E. coli MG1655 | [15] |
pEKEx3-puoRq-patD | pEKEx3-expressing puo from R. qingshengii and patD from E. coli MG1655 | This study |
pVWEx1-ldcC | pVWEx1-expressing ldcC from E. coli MG1655 | [38] |
Primer | Sequence (5′–3′) | Description |
---|---|---|
AVA25 | ttcacttaagggggaaatggcaaatgcagaatcttgatcgcgacgttgtgatcgtcgg | Putrescine oxidase gene from P. aurescens 579_fw |
AVA30 | tcttactacctcctatttatgtaattgtttactcaggcgacaggtacagaagccaacttgtt | Putrescine oxidase gene from P. aurescens 579_rv |
AVA27 | ttcacttaagggggaaatggcaaatgcctactctccagagagacgttgcaatcgt | Putrescine oxidase gene from R. qingshengii djl-6-2_fw |
AVA31 | tcttactacctcctatttatgtaattgtttactcaggccttgctgcgagcgatgatgt | Putrescine oxidase gene from R. qingshengii djl-6-2_rv |
AVA32 | gtaaacaattacataaataggaggtagtaagaatgcaacataagttactgattaacggagaactggttag | γ-aminobutyraldehyde dehydrogenase gene from E. coli MG1655_fw |
AVA33 | acgacggccagtgaattcgagctttaatgtttaaccatgacgtggcggacga | γ-aminobutyraldehyde dehydrogenase gene from E. coli MG1655_rv |
AVA43 | agctggacaccatctccttc | Sequencing of pBV2xp-puoPa-patD |
AVA44 | gcgcttacgcttccagctac | Sequencing of pBV2xp-puoPa-patD |
AVA45 | ggcaggcgtgattaacatac | Sequencing of pBV2xp-puoPa-patD and pBV2xp-puoRq-patD |
AVA48 | cgcgatctcgacacagtctc | Sequencing of pBV2xp-puoRq-patD |
AVA49 | caccgctacggcgcggattc | Sequencing of pBV2xp-puoRq-patD |
PXPF | tgtttatccaccgaactaag | Colony PCR primer for pBV2xp_fw |
BVXR | ccgcacagatgcgtaaggag | Colony PCR primer for pBV2xp_rv |
patD_F | ccctgtcgggaaattagaagaaaaggaggttttttatgcaacataagttactgattaacggagaactgg | Construction of pEC-XT99A/pEKEx3-puoRq-patD_fw |
patD_R | cctgcaggtcgactctagagttaatgtttaaccatgacgtggcgg | Construction of pEC-XT99A/pEKEx3-puoRq-patD_rv |
puoRq_F | attcgagctcggtacccgggccatattcacaaccctaattataaaggaggtcttttatgcctactctccagagagacg | Construction of pEC-XT99A-puoRq-patD_fw |
puoRq_R | cttctaatttcccgacagggtcaggccttgctgcgagc | Construction of pEC-XT99A-puoRq-patD_rv |
puoPa_F | attcgagctcggtacccgggcggcccggtaacggccaacagtagaaaggaggtattttatgcagaatcttgatcgcgacg | Construction of pEC-XT99A-puoPa-patD_fw |
puoPa_R | cttctaatttcccgacagggtcaggcgacaggtacagaagcc | Construction of pEC-XT99A-puoPa-patD_rv |
puoRq_F2 | cctgcaggtcgactctagagccatattcacaaccctaattataaaggaggtcttttatgcctactctccagagagacg | Construction of pEKEx3-puoRq-patD_fw |
patD_R2 | attcgagctcggtacccgggttaatgtttaaccatgacgtggcgg | Construction of pEKEx3-puoRq-patD_rv |
pEC_F | gcgccgacatcataacgg | Colony PCR primer for pEC-XT99A_fw |
pEC_R | ggcgtttcacttctgagttcgg | Colony PCR primer for pEC-XT99A_rv |
pEK_F | cgcttccactttttcccgcgt | Colony PCR primer for pEKEx3_fw |
pEK_R | gcatttatcagggttattgtc | Colony PCR primer for pEKEx3_rv |
seq_patD | atcgcaccgtggaattatccgc | Sequencing of pEC-XT99A/pEKEx3-puoRq-patD |
seq1_Rq | gcgatctcgacacagtctcc | Sequencing of pEC-XT99A/pEKEx3-puoRq-patD |
seq2_Rq | caacaccaaccacgaggacg | Sequencing of pEC-XT99A/pEKEx3-puoRq-patD |
seq1_Pa | tggacaccatctccttccacc | Sequencing of pEC-XT99A-puoPa-patD |
seq2_Pa | acaccaaccacggagattcc | Sequencing of pEC-XT99A-puoPa-patD |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Haupka, C.; Delépine, B.; Irla, M.; Heux, S.; Wendisch, V.F. Flux Enforcement for Fermentative Production of 5-Aminovalerate and Glutarate by Corynebacterium glutamicum. Catalysts 2020, 10, 1065. https://doi.org/10.3390/catal10091065
Haupka C, Delépine B, Irla M, Heux S, Wendisch VF. Flux Enforcement for Fermentative Production of 5-Aminovalerate and Glutarate by Corynebacterium glutamicum. Catalysts. 2020; 10(9):1065. https://doi.org/10.3390/catal10091065
Chicago/Turabian StyleHaupka, Carsten, Baudoin Delépine, Marta Irla, Stephanie Heux, and Volker F. Wendisch. 2020. "Flux Enforcement for Fermentative Production of 5-Aminovalerate and Glutarate by Corynebacterium glutamicum" Catalysts 10, no. 9: 1065. https://doi.org/10.3390/catal10091065