A Novel Mouse Model to Identify Antigen-Specific Immune Responses in Pancreatic Cancer Cachexia

Round 1

Reviewer 1 Report

Comments and Suggestions for Authors

The manuscript establishes and characterizes a novel orthotopic pancreatic cancer cachexia model using SIY-expressing KPCL-4 cells in immunocompetent C57BL/6J mice. The authors demonstrate that this model recapitulates key clinical hallmarks of PDAC-associated cachexia, including tumor-adjusted weight loss, adipose tissue depletion, skeletal muscle atrophy, reduced muscle function, and systemic inflammation. A clear sex bias is observed, with male mice developing more severe muscle wasting and functional decline despite comparable tumor burden, whereas females show relative muscle mass preservation but significant fat loss and splenomegaly. Importantly, the model enables interrogation of antigen-specific CD8⁺ T-cell responses and systemic cytokine profiles in the cachectic context, supporting its utility for studying immune.

Major comments:

• The study uses a single pancreatic cancer cell line (KPCL-4) derived from a specific genetic background, which limits generalizability; inclusion of an additional PDAC cachexia model or justification for why KPCL-4 is representative of broader PDAC biology would strengthen the conclusions.
• Although the authors emphasize antigen-specific immune responses, the functional status of SIY-specific CD8⁺ T cells is inferred largely from phenotypic markers without direct assessment of effector function (e.g., cytokine production or cytotoxicity), weakening claims regarding immune competence in the cachectic setting.
• In the introduction part, the authors should emphasize the dire need of diagnosis pancreatic cancer at an early stage and following references should be added: doi: 10.3748/wjg.v31.i26.109500.
• The reliance on terminal tumor-adjusted body weight as a primary cachexia metric may underestimate systemic wasting, and the absence of longitudinal body composition measurements (such as serial muscle or fat mass assessment) limits interpretation of disease trajectory.
• Food intake data are reported at the cage level rather than the individual level, which introduces potential bias and precludes accurate assessment of anorexia as a contributing factor to cachexia in this model.
• Several conclusions regarding sex-specific immune regulation are based on plasma cytokine differences without parallel assessment of cytokine sources or signaling activity within skeletal muscle or other peripheral tissues.
• The flow cytometry analysis focuses on relative proportions of immune subsets, but absolute cell numbers and total immune cellularity within tumors are not reported, which may conceal biologically meaningful changes.
• The manuscript does not clearly describe randomization or blinding procedures for all outcome assessments, particularly for functional measurements such as grip strength, raising concerns about potential experimental bias.
• The translational implications for immunotherapy are discussed extensively, yet no therapeutic intervention is tested in this model, making some of the clinical extrapolations speculative without experimental support.

Author Response

1. The study uses a single pancreatic cancer cell line (KPCL-4) derived from a specific genetic background, which limits generalizability; inclusion of an additional PDAC cachexia model or justification for why KPCL-4 is representative of broader PDAC biology would strengthen the conclusions.

 

We appreciate the reviewer’s comment regarding the generalizability of the results. We acknowledge that the use of a single cell line (KPCL-4) is a limitation of the current study. However, the primary objective of this work was to establish and deeply characterize a novel orthotopic model that enables the simultaneous study of cachexia and antigen-specific immunity (via SIY expression) in an immunocompetent setting. KPCL-4 cells were selected because they are derived from KPC-LSIY (Kras^LSL-G12D/+Tp53^LSL-R172H/+ Pdx1-Cre/R26^LSL-LSIY ) mice which demonstrate similar neoplastic progression and tumor histology as the conventional KPC (Kras^LSL-G12D/+Tp53^LSL-R172H/+ Pdx1-Cre) mice (described in Reference 20). Essentially, expression of the SIY antigen does not impact authentic PDAC progression in the KPC-LSIY mouse model. Since KPC mice are recognized for faithfully recapitulating the genetic and histological features of human PDAC, we believe that KPCL-4 cells are largely representative of broader PDAC biology.  By focusing on this single cell line, we were able to provide a granular analysis of the sex-specific differences and immune landscape that would have been logistically prohibitive across multiple lines. While we have discussed publications investigating sex-specific differences in conventional KPC mouse models in our manuscript (Zhong et. al, 2022), we have further updated the Discussion section by including the following text to explicitly state that future studies will need to validate our findings across additional PDAC lines:

 

“Some important limitations of our work include the utilization of a single cell line (KPCL-4) in this PDAC cachexia model. While utilization of this cell line allowed a granular analysis of sex-specific differences and immune landscape in PDAC associated cachexia, we recognize the need of validating these findings across additional cell lines in future investigations to ensure broad applicability of the model.” (Page 20, Line 640-644)

 

2. Although the authors emphasize antigen-specific immune responses, the functional status of SIY-specific CD8⁺ T cells is inferred largely from phenotypic markers without direct assessment of effector function (e.g., cytokine production or cytotoxicity), weakening claims regarding immune competence in the cachectic setting.

The reviewer raises an important point. Our primary goal was to map the immune landscape of this new cachexia model. The markers we utilized for analysing SIY+ CD8+ T cells (such as PD-1 and Tim-3) are well-established in the literature as reliable surrogates for T-cell exhaustion and activation status in the context of chronic antigen exposure and cancer. However, we do acknowledge that while these phenotypic markers are highly suggestive of functional impairment in T cells, direct functional assays (e.g., cytotoxicity or cytokine production ex vivo) provide the most definitive assessment of T-cell function. We have updated our discussion and rephrased the text to specifically convey that our study was limited to assessment of T cell phenotypes and that further functional validation is required to characterize antigen-specific T cell function in the KPCL-4 cachexia model. The text now reads:

 

 “Importantly, the ability to investigate SIY antigen-specific T cell phenotypes in KPCL-4 tumor-bearing mice opens novel avenues for studying immune impairment in cachexia, shedding light on the cross talk between cachexia and anti-tumor immunity. Although further studies directly validating effector T cell function (e.g., cytotoxicity or cytokine production ex vivo) in the KPCL-4 model are necessary to specifically characterize antigen specific immune function in cachexia, the scope of identifying and tracking SIY-antigen specific T cells with distinct phenotypic profiles (effector, memory and exhausted) in KPCL-4 tumor-bearing mice expands the clinical relevance of this model, making it a versatile tool for further preclinical studies.” (Page 19, Line 591-599)

 

3. In the introduction part, the authors should emphasize the dire need of diagnosis pancreatic cancer at an early stage and following references should be added: doi: 10.3748/wjg.v31.i26.109500.

We thank the reviewer for bringing this interesting paper to our attention. While we agree that the suggested reference provides valuable insights on a novel, non-invasive biomarker for detecting metastatic pancreatic cancer, we have chosen to keep the introduction focussed on the systemic effects of cachexia. We believe that current references align with the theme of the paper and sufficiently establish the need for novel preclinical models of pancreatic cancer cachexia. However, we do recognize that lack of early detection of PDAC is important for conveying the clinical urgency of the disease and have revised our introduction:

“Currently, the lack of effective early detection of PDAC results in disease progression to advanced stages where the aggressive and immunosuppressive pancreatic tumor microenvironment (TME), in combination with cachexia, significantly enhances the morbidity of the disease.” (Page 3, Line 87-90).

Additionally, we briefly discuss the potential of circulating inflammatory markers to serve as biomarkers for detecting early-stage cachexia in patients:

 “Consequently, profiling the tumor secretome in the plasma offers a non-invasive approach to understand the inflammatory landscape and identify potential biomarkers for early detection of cachexia in patients, aiding in early-stage disease management.” (Page 20, Line 611-614)

 

4.  The reliance on terminal tumor-adjusted body weight as a primary cachexia metric may underestimate systemic wasting, and the absence of longitudinal body composition measurements (such as serial muscle or fat mass assessment) limits interpretation of disease trajectory.

We appreciate the reviewer’s concern regarding the monitoring of wasting. While we agree that longitudinal body composition (e.g., MRI or DEXA) provides trajectory data, these procedures often require repeated anesthesia and handling, which can induce significant stress and confounding weight loss in already cachectic, tumor-bearing mice. To minimize experimental artifacts and prioritize animal welfare, we relied on longitudinal total body weight and precise terminal tissue dissection. We believe the terminal weights of individual tissues (skeletal muscle and adipose depots), which showed significant depletion, as well as microscopic examination of immunolabelled muscle tissue to look at myotube atrophy serve as a robust confirmation of the systemic wasting phenotype. We have rephrased our discussion on sex bias in skeletal muscle wasting, acknowledging this limitation and advocating for non-invasive longitudinal monitoring in future iterations of the model. The revised text reads:

“Indeed, the absence of longitudinal body composition measurements of MTB and FTB mice in our study limits our ability to definitively map sex-based differences in disease trajectory in the KPCL-4 tumor model, necessitating non-invasive longitudinal assessments of muscle and fat mass in future investigations to confirm whether the KPCL-4 tumor model reflects a true sex bias in cachexia presentation or merely a temporal delay in disease progression in females” (Page 19, Line 562-567)

 

5. Food intake data are reported at the cage level rather than the individual level, which introduces potential bias and precludes accurate assessment of anorexia as a contributing factor to cachexia in this model.

We thank the reviewer for raising this important point. We chose to house mice in groups to avoid the confounding effects of social isolation stress, which is known to alter metabolism, immune responses, and tumor progression, along with contributing to weight loss in murine models. While this necessitates reporting food intake as an average per cage, we believe this approach provides a more physiologically relevant baseline for the model than single-housing animals for granular food intake data. We have acknowledged the limitation regarding individual anorexia assessment in the Discussion (Page 20, Lines 651-654) and have added a sentence in the Methods section to clarify this rational:

“Mice were group-housed to avoid confounding effects of social isolation stress, which is known to alter metabolism, immune responses, tumor progression and body weight in murine models.” (Page 4, Line 160-162)

 

6. Several conclusions regarding sex-specific immune regulation are based on plasma cytokine differences without parallel assessment of cytokine sources or signaling activity within skeletal muscle or other peripheral tissues.

We agree with the reviewer that plasma cytokine levels represent a systemic snapshot and do not directly prove downstream signaling activity within specific tissues. Our intention was to highlight the correlation between the systemic inflammatory environment and the observed phenotypic differences between sexes. We have revised the manuscript to emphasize that these cytokine profiles are associative and in need of further investigation. Specifically, we have softened our conclusions about TNF-α mediated skeletal muscle wasting by rephrasing the text as:

“Notably, TNF-α was specifically upregulated in MTB mice (Figure 6D), representing a systemic profile that is often associated with a cachectic phenotype in murine models of cachexia” (Page 20, Line 615-617)  

 “While IL-15 has been reported to antagonize TNF-α mediated muscle loss suggesting the involvement of TNF-α in driving cachexia in this model, it is important to note that these cytokine profiles are associative, and further mechanistic studies are required to validate these hypotheses” (Page 20, Line 621-625).

 We have also added the following sentence to further emphasize the need for studying downstream signaling pathways in skeletal muscles and other peripheral tissues to causally link the systemic cytokine profile to the sex-bias in skeletal muscle wasting observed in males:

“However, further investigation of predominant immune cell phenotypes and downstream signaling pathways in skeletal muscles and other peripheral tissues is critical to establish a direct causal link between these circulating inflammatory markers and the observed differences in the cachectic phenotype of MTB and FTB mice. Such a mechanistic understanding of the model will aid in further characterization of the KPCL-4 tumor model as a valuable translational tool for evaluating cytokine and adoptive T-cell based immunotherapies in the context of pancreatic cancer cachexia” (Page 20, Line 632-638)

 

7. The flow cytometry analysis focuses on relative proportions of immune subsets, but absolute cell numbers and total immune cellularity within tumors are not reported, which may conceal biologically meaningful changes.

We acknowledge the reviewer’s point. While we appreciate the reviewer’s perspective on the importance of absolute cell counts, we focussed on relative proportions of immune cells (as a percentage of CD45+ cells) to investigate compositional shifts in tumor-infiltrating immune subsets between male and female tumor-bearing mice. Recent publications highlight that relative proportions of immune populations are more predictive of the functional state of the TME than absolute cellularity because the latter can be often skewed by non-immune “noise” and varying degrees of necrosis (Thorsson et al, 2020). In our study, since tumor-infiltrating immune cells were isolated from small tumor fragments of varying sizes obtained from distinct regions of the tumor (described in the Methods section on Page 6, Section 2.7), we normalized absolute cell counts to the number of infiltrating CD45+ cells and the precise weight of tumor tissue used for immune cell isolation to account for stochastic variations in fragment size, immune cell density and presence of necrotic areas. This was done to further ensure that any observed differences in immune cell compositions are due to biological factors rather than sampling artifacts.

 

8. The manuscript does not clearly describe randomization or blinding procedures for all outcome assessments, particularly for functional measurements such as grip strength, raising concerns about potential experimental bias.

We apologize for the lack of clarity regarding our experimental design. We have revised the manuscript to include an additional section in our Methods to explicitly state our randomization procedures (performed at the time of cage allocation) and blinding protocols (specifically, that researchers performing functional assessments such as grip strength, necropsy as well as immunofluorescence-based atrophy assessment were blinded to the experimental groups) to address concerns regarding potential bias.

The new section is entitled “Randomization and blinding procedures” and reads as follows:

 

“Mice were randomized at the time of cage allocation using a stratified randomization approach. Specifically, male and female mice were stratified by body weight and then randomly allocated to tumor-free (TF) or KPCL-4 tumor-bearing (TB) groups, with up to 5 animals of the same experimental group per cage. Mice in each experimental group as well as cages were assigned unique identification numbers at the beginning of the study and concealed from primary investigators to facilitate de-identification. Consequently, investigators performing longitudinal body weight measurements, functional assessments (grip strength, food consumption), necropsy and immunofluorescence-based muscle atrophy evaluation were blinded to the experimental groups throughout the duration of the study. Group allocations were revealed after data collection to ensure unbiased assessments.” (Section 2.3, Page 5, Line 181-193)

9. The translational implications for immunotherapy are discussed extensively, yet no therapeutic intervention is tested in this model, making some of the clinical extrapolations speculative without experimental support.

We agree with the reviewer that our discussion of therapeutic implications was perhaps too extensive given that no intervention was tested in this specific study. We have significantly revised the Discussion to rephrase these extrapolations and emphasize that the primary contribution of this work is establishing a robust, immunocompetent model that enables the future testing of these immunotherapeutic strategies, rather than providing proof of their efficacy. In particular, we have rephrased our discussion on translational implication in the following segments, and the revised text reads as:

 

“While the primary objective of this study was the development and characterization of a novel, immunocompetent pancreatic cancer cachexia model, it sets the stage for future investigations aimed at optimizing immunotherapies in the presence of cachexia.” (Page 20, Line 599-602)

“Such a mechanistic understanding of the model will aid in further characterization of the KPCL-4 tumor model as a valuable translational tool for evaluating cytokine and adoptive T-cell based immunotherapies in the context of pancreatic cancer cachexia.” (Page 20, Line 535-638)

“Finally, this study yields a robust, immunocompetent murine model of pancreatic cancer cachexia that can be employed for future investigations to test hypotheses regarding sex-specific differences in immunotherapy response and the potential of cachexia to serve as a prognostic factor for predicting immunotherapy outcomes in PDAC.” (Page 21, Line 667-680)

Reviewer 2 Report

Comments and Suggestions for Authors

This manuscript from Das et al. describes and characterizes a mouse model of pancreatic cancer induced cachexia and differences identified between male and female mice. This paper is well done and presents data clearly. There are minor clarifications needed:

1. Supplemental Figure 2 is inverted and needs to be fixed for publication.
2. Identification of T cells notes CD19-CD3+. Are these NK1.1 negative? This needs to be clarified in the text and legend. 

Author Response

1. Supplemental Figure 2 is inverted and needs to be fixed for publication.

We thank the reviewer for identifying this error and apologise for our oversight. The orientation of Supplementary Figure 2 has been corrected in the revised manuscript (Page 13).

2. Identification of T cells notes CD19-CD3+. Are these NK1.1 negative? This needs to be clarified in the text and legend.

We thank the reviewer for this technical clarification. In our current gating strategy, T cells were identified as CD19^- CD3⁺, and further sub-gated into CD4⁺ and CD8⁺ populations. Our gating scheme did not use a NK1.1^- gate to identify T cells. Given that NKT cells (CD3+ NK1.1⁺) represent a very small fraction of the tumor infiltrating CD3⁺ cells, we believe our gating strategy (without a NK1.1^- gate) describes the broader T cell landscape without significantly altering CD4⁺ and CD8⁺ T cell phenotypic distributions. Moreover, further sub-gating for CD4⁺ and CD8⁺ T cell populations ensures that our analysis is focussed on conventional T cell subsets. We have clarified our gating strategy in the figure legend to explicitly state that the CD19^- CD3⁺ T cells were not NK1.1^- and the revised text is as follows:

 “Total T cells were identified as CD19^-CD3⁺ cells. Within this population, NKT cells (CD19^-CD3⁺NK1.1⁺) were defined by the expression of NK1.1. CD4 T cells (CD19^-CD3⁺CD4⁺) and CD8 T cells (CD19^-CD3⁺CD8⁺) were identified by their respective co-expression of CD3 with either CD4 or CD8 without NK1.1 exclusion.” (Page 13, Line 440-444)

 

Reviewer 3 Report

Comments and Suggestions for Authors

The authors describe a novel mouse model, KPCL-4, to study pancreatic cancer–associated cachexia. In this manuscript, the KPCL-4 orthotopic PDAC model in C57BL/6 mice is shown to exhibit prominent hallmarks of cachexia. The authors also attempt to characterize immune and inflammatory responses associated with cachexia induction.

While the model is potentially interesting, the manuscript would be significantly strengthened by including KPC cells as a control model. This comparison would better establish the novelty and specificity of the KPCL-4 model in inducing cachexia.

The Materials and Methods section requires substantial language editing for clarity, precision, and completeness. Several experimental descriptions are unclear or incomplete and must be revised.

Some minor corrections listed below:

1. Remove Reference 21, its not necessary in the Introduction section.
2. The tail vein injection does not represent an orthotopic injection. Please correct this. Additionally, the rationale for using Matrigel in tail vein injections should be clarified or reconsidered.
3. The sentence “Slides were washed thrice with PBS, followed by a wash every 15 minutes for 1 hour at room temperature” is unclear and should be rephrased it.
4. Please clarify whether RNA was isolated from lysates or tissues.
5. The GAPDH primer sequence is missing in the M&M section and should be added.
6. The description of tumor-infiltrating lymphocyte (TIL) isolation is incomplete. Please elaborate on full methodological details.
7. In the Plasma Cytokine Analysis section, elaborate on the procedure used for plasma isolation, including centrifugation conditions.
8. Please add: An image of H&E and female gastrocnemius muscle laminin-2–stained.
9. Supplementary Figure 2 appears to be presented in the opposite direction and should be corrected.
10. The authors analyze immune profiles in tumor tissue only. Please justify why immune profiling was not performed in the spleen and muscle, or include these analyses.
11. Include tumor-free mouse flow cytometry data as a control in Figure 4.

Author Response

1. Remove Reference 21, its not necessary in the Introduction section.

We thank the reviewer for this suggestion. Reference 21 (Crittenden et. al, 2018) was initially included because it was the first publication to describe KPCL cells (previously called PK5L). However, since this reference paper does not specifically refer to KPCL-4 cells, we agree that this reference is not strictly necessary for our publication. We have removed the reference as requested.

 

2. The tail vein injection does not represent an orthotopic injection. Please correct this. Additionally, the rationale for using Matrigel in tail vein injections should be clarified or reconsidered.

We thank the reviewer for this comment and apologize for any lack of clarity in our description of the surgical procedure. We would like to clarify that cells were injected into the distal end (or splenic end) of the pancreas, often referred to as the “tail of pancreas” rather than tail vein injection. Thus, Matrigel was used because it solidifies at physiological temperatures, preventing leakage of the injected cells into the peritoneal cavity and ensuring localized tumor formation in the pancreas. We agree that a tail vein injection is a systemic delivery route and would not constitute an orthotopic model. We have carefully revised the manuscript and replaced the phrase “tail of pancreas” with “distal end of pancreas” (Page 4, Line 165 and Page 5, Line 202) to emphasize the orthotopic nature of injection.

 

3. The sentence “Slides were washed thrice with PBS, followed by a wash every 15 minutes for 1 hour at room temperature” is unclear and should be rephrased it.

We thank the reviewer for this suggestion and have revised the text to describe the procedure with greater clarity:

“Slides were rinsed thrice with PBS, followed by four additional 15 minute PBS washes at room temperature to ensure removal of unbound antibodies.” (Page 5, Line 218-219)

4. Please clarify whether RNA was isolated from lysates or tissues.

We appreciate the reviewer’s comment and concur with the need for greater transparency in our RNA extraction protocol.  To clarify, RNA was isolated from snap-frozen skeletal muscle tissue. Specifically, the tissue samples were thawed and homogenized in 1mL TRIzol^TM Reagent (Thermo Fisher) for RNA isolation according to TRIzol^TM manufacturer's instructions. We have updated the Methods section to explicitly state the following:

“After euthanasia, quadriceps tissue was snap-frozen in liquid nitrogen and stored at -80°C until analysis of Trim63 and Fbxo32 expression. For RNA extraction, 25-30 mg tissue was lysed and homogenized in 1mL TRIzol^TM Reagent (Thermo Fisher) and further processed according to TRIzol^TM manufacturer's instructions.” (Page 6, Line 232-235)

 

5. The GAPDH primer sequence is missing in the M&M section and should be added.

We thank the reviewer for highlighting this omission. We have included the primer sequences for GAPDH in the Methods section in the following sentence:

 “GAPDH was used as an internal control gene (Forward primer: GGGTTCCTATAAATACGGACTGC, Reverse primer: TACGGCCAAATCCGTTCACA).” (Page 6, Line 240-242)

 

6. The description of tumor-infiltrating lymphocyte (TIL) isolation is incomplete. Please elaborate on full methodological details.

We appreciate the suggestion to elaborate on the TIL isolation protocol and agree that a more detailed description of the procedure is important for reproducibility. We have expanded the Methods section (Section 2.7) to include details regarding specific amounts of reagents used and centrifugation conditions. We have also expanded on the Red Blood Cell Lysis protocol and subsequent processing steps. The text now reads:

“The digested tissue was passed through a 70µm cell strainer, rinsed with 1X PBS and centrifuged at 500 x g for 5 minutes. The supernatant was discarded and the cell pellet was resuspended in residual volume for red blood cell lysis. Red blood cells were lysed using 10mL 1X red blood cell lysis buffer (8.26g Ammonium Chloride, 1g Potassium Bicarbonate and 0.037g EDTA in 1L diH₂0) for two minutes at room temperature, which was then neutralized with 40mL PBS and centrifuged at 500 x g for 5 minutes. The supernatant was discarded and cells were resuspended in freezing media (90% FBS+ 10% DMSO) for storage at -80°C until analysis.” (Page 6, Line 250-257).

 

7. In the Plasma Cytokine Analysis section, elaborate on the procedure used for plasma isolation, including centrifugation conditions.

We appreciate the reviewer’s eye to detail and agree with the need for elaboration on our plasma isolation protocol. We have updated the Materials and Methods section (Section 2.8) to provide a comprehensive description of the plasma isolation protocol. In particular, we have added details regarding the method of whole blood extraction from mice (cardiac puncture), use of heparinized tubes and the precise centrifugation conditions. The updated text is as follows:

 “Whole blood was collected via cardiac puncture into heparinized tubes (BD Microtainer, PST Tubes, Becton, Dickinson and Company, Franklin Lakes, NJ, USA) at endpoint and maintained at room temperature. The samples were then centrifuged at 10000 x g for 2 minutes to remove cells and platelets. The supernatant (plasma) was transferred to fresh tubes and stored at -80°C until analysis.” (Page 7, Line 275-279)

 

8. Please add: An image of H&E and female gastrocnemius muscle laminin-2–stained.

We thank the reviewer for this suggestion. We agree that representative H&E images are essential for quality control and will strengthen our conclusions about skeletal muscle atrophy. We have revised Figure 3 to include representative H&E images of gastrocnemius muscle sections of male and female tumor-free as well as tumor-bearing mice (Figure 3A, Page 11). We have also updated our methods and revised the text to include our observations from the H&E stained images:

“Frozen muscles were cryo-sectioned to a thickness of 8 µm and collected on Superfrost Plus slides (Thermo Fisher Scientific). Sections were stained with hematoxylin and eosin by standard methods to assess overall histology.” (Page 5, Line 211-213)

“H&E staining revealed a shift in muscle morphology, with MTB and FTB mice demonstrating atrophic features such as shrunken, angular fibers and increased interstitial spaces as opposed to MTF and FTF mice with densely packed polygonal fibers (Figure 3A).” (Page 10, Line 364-367)

With regards to the Laminin-2-stained sections of female gastrocnemius muscle sections, we agree that including representative images from the female cohort is important for comprehensive representation of our data. Thus, we have updated Figure 3 to include representative images of Laminin-2-stained gastrocnemius muscle sections from tumor-free and tumor-bearing female mice (Figure 3B, Page 11).

9. Supplementary Figure 2 appears to be presented in the opposite direction and should be corrected.

We apologize for this oversight. The orientation of Supplementary Figure 2 has been corrected in the revised manuscript (Page 13).

10. The authors analyze immune profiles in tumor tissue only. Please justify why immune profiling was not performed in the spleen and muscle, or include these analyses.

We thank the Reviewer for this suggestion. We agree that systemic immune profiles can provide valuable context to local anti-tumor immune responses in the TME. We have now included the splenic immune landscape of male and female tumor-bearing mice in Supplemental Figure 3 (Page 15) and have revised the text in the results section to describe our findings from spleen immune profiling. The text reads as:

“Contrastingly the systemic immune landscape in the spleen revealed interesting sex-based differences, particularly with the T cell compartment. While the global distribution of the broad classes of immune cells including NK cells, NKT cells, M1 and M2 macrophages, cDc, g-MDSC and m-MDSC, B cells, CD4+ and CD8+ T cell were comparable between sexes (Supplemental Figure 3A), FTB mice exhibited a significant increase in the relative abundance of CD8+ central memory T cells compared to MTB mice (Supplemental Figure 3B). Analysis of the SIY-antigen-specific CD8+ T cell populations in the spleen showed that while the total number of SIY+ CD8+ T cell was similar in MTB and FTB mice, FTB mice demonstrated higher numbers of SIY+ CD8+ effector memory and stem-like effector cells relative to MTB mice without significant differences in the central memory, stem-like or exhausted phenotypes (Supplemental Figure 3C-H). These findings indicate a divergence between local and systemic immunity in tumor-bearing, highlighting the importance of characterizing systemic cytokines and inflammatory mediators, which may act as critical drivers of sexual dimorphism in cachexia presentation in the KPCL-4 tumor model.” (Page 12, Line 421-435)

We have also discussed these findings in the context of differentially upregulated T-cell associated cytokines in females in the discussion section:

“In combination with the observed increase in CD8+ central memory, SIY+ CD8+ effector memory and SIY+ CD8+ stem-like effector T cells in the spleen of FTB mice, these results suggest the potential involvement of T-cell associated responses in balancing cachexia-associated inflammatory pathways in FTB mice”. (Page 20, Line 628-631)

As for immune profiling in the muscle, we focussed our analysis on the tumor microenvironment as it represents the primary site of interest for SIY antigen-specific immune responses. While a comprehensive muscle immune profiling was beyond the scope of this initial study, we recognize its implications for understanding tumor-induced cachexia. We have added a comment in the discussion section, acknowledging the importance of investigating muscle-infiltrating immune cells in future studies with the model:

“However, further investigation of predominant immune cell phenotypes and downstream signaling pathways in skeletal muscles and other peripheral tissues is critical to establish a direct causal link between these circulating inflammatory markers and the observed differences in the cachectic phenotype of MTB and FTB mice.” (Page 20, Line 632-635)

 

11. Include tumor-free mouse flow cytometry data as a control in Figure 4.

We thank the reviewer for this comment. While we agree that tumor-free controls generally provide a baseline for steady-state immunity, the primary focus of Figure 4 is to compare the intra-tumoral immune landscape between male and female tumor-bearing mice. Since "Tumor-Infiltrating Lymphocytes" (TILs) are absent in tumor-free mice, a direct comparison with tumor-free mice was not suitable for these analyses.

Round 2

Reviewer 1 Report

Comments and Suggestions for Authors

The authors have meticulously addressed all the points and revisions raised during the peer-review process. Based on the comprehensive revisions made, the manuscript has undergone significant structural refinement and enhancements. The study presents a novel and well-designed investigation, supported by solid methodology and meaningful discussion of its contributions to the field. The current version is clear, coherent, and robust. I find it suitable for publication in its present form.

Author Response

We thank the reviewer for their critiques and for improving the quality of our manuscript.

Reviewer 3 Report

Comments and Suggestions for Authors

Minnor comments:

1. The manuscript would be significantly strengthened by including KPC cells as a control model. 

2. In the Materials and Methods section, “Orthotopic surgery” is listed as a subheading; however, a separate section titled “Orthotopic surgery in mice” is also included. Please clarify this redundancy.

Author Response

1. The manuscript would be significantly strengthened by including KPC cells as a control model.

We appreciate the reviewer’s comment regarding the generalizability of the results. We acknowledge that the use of a single cell line (KPCL-4) is a limitation of the current study. However, the primary objective of this work was to establish and deeply characterize a novel orthotopic model that enables the simultaneous study of cachexia and antigen-specific immunity (via SIY expression) in an immunocompetent setting. KPCL-4 cells were selected because they are derived from KPC-LSIY (Kras^LSL-G12D/+Tp53^LSL-R172H/+ Pdx1-Cre/R26^LSL-LSIY ) mice which demonstrate similar neoplastic progression and tumor histology as the conventional KPC (Kras^LSL-G12D/+Tp53^LSL-R172H/+ Pdx1-Cre) mice (described in Reference 20). Essentially, expression of the SIY antigen does not impact authentic PDAC progression in the KPC-LSIY mouse model. Since KPC mice are recognized for faithfully recapitulating the genetic and histological features of human PDAC, we believe that KPCL-4 cells are largely representative of broader PDAC biology.  By focusing on this single cell line, we were able to provide a granular analysis of the sex-specific differences and immune landscape that would have been logistically prohibitive across multiple lines. While we have discussed publications investigating sex-specific differences in conventional KPC mouse models in our manuscript (Zhong et. al, 2022), we have further updated the Discussion section by including the following text to explicitly state that future studies will need to validate our findings across additional PDAC lines:

“Some important limitations of our work include the utilization of a single cell line (KPCL-4) in this PDAC cachexia model. While utilization of this cell line allowed a granular analysis of sex-specific differences and immune landscape in PDAC associated cachexia, we recognize the need of validating these findings across additional cell lines in future investigations to ensure broad applicability of the model.” (Page 18, Line 596-600)

2. In the Materials and Methods section, “Orthotopic surgery” is listed as a subheading; however, a separate section titled “Orthotopic surgery in mice” is also included. Please clarify this redundancy.

Our revised manuscript now only has the one heading, "Orthotopic surgery" in the Materials and Methods section. We have also edited the "Mice" section to fix the redundancy.