Absolute Quantification of Nucleotide Variants in Cell-Free DNA via Quantitative NGS: Clinical Application in Non-Small Cell Lung Cancer Patients
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Quantification Standards
2.1.1. QS Design
2.1.2. QS Quantification
2.1.3. Spiking of Plasma Samples and Cell-Free DNA Extraction
2.2. Absolute Quantification of Nucleotide Variants by qNGS
2.3. Absolute Quantification of Nucleotide Variants by dPCR
2.4. Preparation of Artificial Samples
3. Results
3.1. Evaluation of qNGS on Artificial Samples
3.2. qNGS Evaluation on Patient Samples
3.3. Clinical Application
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Alexander, E.M.; Miller, H.A.; Egger, M.E.; Smith, M.L.; Yaddanapudi, K.; Linder, M.W. The Correlation between Plasma Circulating Tumor DNA and Radiographic Tumor Burden. J. Mol. Diagn. JMD 2024, 26, 952–961. [Google Scholar] [CrossRef] [PubMed]
- Taus, A.; Camacho, L.; Rocha, P.; Hardy-Werbin, M.; Pijuan, L.; Piquer, G.; Lopez, E.; Dalmases, A.; Longaron, R.; Clave, S.; et al. Dynamics of EGFR Mutation Load in Plasma for Prediction of Treatment Response and Disease Progression in Patients With EGFR-Mutant Lung Adenocarcinoma. Clin. Lung Cancer 2018, 19, 387–394 e382. [Google Scholar] [CrossRef] [PubMed]
- Urbini, M.; Marisi, G.; Azzali, I.; Bartolini, G.; Chiadini, E.; Capelli, L.; Tedaldi, G.; Angeli, D.; Canale, M.; Molinari, C.; et al. Dynamic Monitoring of Circulating Tumor DNA in Patients With Metastatic Colorectal Cancer. JCO Precis. Oncol. 2023, 7, e2200694. [Google Scholar] [CrossRef] [PubMed]
- Herbreteau, G.; Vallee, A.; Knol, A.C.; Theoleyre, S.; Quereux, G.; Varey, E.; Khammari, A.; Dreno, B.; Denis, M.G. Circulating Tumor DNA Early Kinetics Predict Response of Metastatic Melanoma to Anti-PD1 Immunotherapy: Validation Study. Cancers 2021, 13, 1826. [Google Scholar] [CrossRef]
- Zhang, Y.; Yao, Y.; Xu, Y.; Li, L.; Gong, Y.; Zhang, K.; Zhang, M.; Guan, Y.; Chang, L.; Xia, X.; et al. Pan-cancer circulating tumor DNA detection in over 10,000 Chinese patients. Nat. Commun. 2021, 12, 11. [Google Scholar] [CrossRef]
- Li, L.; Wang, Y.; Shi, W.; Zhu, M.; Liu, Z.; Luo, N.; Zeng, Y.; He, Y. Serial ultra-deep sequencing of circulating tumor DNA reveals the clonal evolution in non-small cell lung cancer patients treated with anti-PD1 immunotherapy. Cancer Med. 2019, 8, 7669–7678. [Google Scholar] [CrossRef]
- Hua, G.; Zhang, X.; Zhang, M.; Wang, Q.; Chen, X.; Yu, R.; Bao, H.; Liu, J.; Wu, X.; Shao, Y.; et al. Real-world circulating tumor DNA analysis depicts resistance mechanism and clonal evolution in ALK inhibitor-treated lung adenocarcinoma patients. ESMO Open 2022, 7, 100337. [Google Scholar] [CrossRef]
- Vittori, L.N.; Tarozzi, A.; Latessa, P.M. Circulating Cell-Free DNA in Physical Activities. Methods Mol. Biol. 2019, 1909, 183–197. [Google Scholar]
- Shin, C.; Kim, J.K.; Kim, J.H.; Jung, K.H.; Cho, K.J.; Lee, C.K.; Lee, S.G. Increased cell-free DNA concentrations in patients with obstructive sleep apnea. Psychiatry Clin. Neurosci. 2008, 62, 721–727. [Google Scholar] [CrossRef]
- Dwivedi, D.J.; Toltl, L.J.; Swystun, L.L.; Pogue, J.; Liaw, K.L.; Weitz, J.I.; Cook, D.J.; Fox-Robichaud, A.E.; Liaw, P.C.; Canadian Critical Care Translational Biology, G. Prognostic utility and characterization of cell-free DNA in patients with severe sepsis. Crit. Care 2012, 16, R151. [Google Scholar] [CrossRef]
- Lo, Y.M.; Rainer, T.H.; Chan, L.Y.; Hjelm, N.M.; Cocks, R.A. Plasma DNA as a prognostic marker in trauma patients. Clin. Chem. 2000, 46, 319–323. [Google Scholar] [CrossRef] [PubMed]
- Galeazzi, M.; Morozzi, G.; Piccini, M.; Chen, J.; Bellisai, F.; Fineschi, S.; Marcolongo, R. Dosage and characterization of circulating DNA: Present usage and possible applications in systemic autoimmune disorders. Autoimmun. Rev. 2003, 2, 50–55. [Google Scholar] [CrossRef] [PubMed]
- Galant, N.; Nicos, M.; Kuznar-Kaminska, B.; Krawczyk, P. Variant Allele Frequency Analysis of Circulating Tumor DNA as a Promising Tool in Assessing the Effectiveness of Treatment in Non-Small Cell Lung Carcinoma Patients. Cancers 2024, 16, 782. [Google Scholar] [CrossRef] [PubMed]
- Islam, S.; Zeisel, A.; Joost, S.; La Manno, G.; Zajac, P.; Kasper, M.; Lonnerberg, P.; Linnarsson, S. Quantitative single-cell RNA-seq with unique molecular identifiers. Nat. Methods 2014, 11, 163–166. [Google Scholar] [CrossRef] [PubMed]
- Jiang, P.; Chan, C.W.; Chan, K.C.; Cheng, S.H.; Wong, J.; Wong, V.W.; Wong, G.L.; Chan, S.L.; Mok, T.S.; Chan, H.L.; et al. Lengthening and shortening of plasma DNA in hepatocellular carcinoma patients. Proc. Natl. Acad. Sci. USA 2015, 112, E1317–E1325. [Google Scholar] [CrossRef]
- Ernst, S.M.; van Marion, R.; Atmodimedjo, P.N.; de Jonge, E.; Mathijssen, R.H.J.; Paats, M.S.; de Bruijn, P.; Koolen, S.L.; von der Thusen, J.H.; Aerts, J.; et al. Clinical Utility of Circulating Tumor DNA in Patients With Advanced KRAS(G12C)-Mutated NSCLC Treated With Sotorasib. J. Thorac. Oncol. Off. Publ. Int. Assoc. Study Lung Cancer 2024, 19, 995–1006. [Google Scholar]
- Soo, R.A.; Martini, J.F.; van der Wekken, A.J.; Teraoka, S.; Ferrara, R.; Shaw, A.T.; Shepard, D.; Calella, A.M.; Polli, A.; Toffalorio, F.; et al. Early Circulating Tumor DNA Dynamics and Efficacy of Lorlatinib in Patients With Treatment-Naive, Advanced, ALK-Positive NSCLC. J. Thorac. Oncol. Off. Publ. Int. Assoc. Study Lung Cancer 2023, 18, 1568–1580. [Google Scholar] [CrossRef]
- Vega, D.M.; Nishimura, K.K.; Zariffa, N.; Thompson, J.C.; Hoering, A.; Cilento, V.; Rosenthal, A.; Anagnostou, V.; Baden, J.; Beaver, J.A.; et al. Changes in Circulating Tumor DNA Reflect Clinical Benefit Across Multiple Studies of Patients With Non-Small-Cell Lung Cancer Treated With Immune Checkpoint Inhibitors. JCO Precis. Oncol. 2022, 6, e2100372. [Google Scholar] [CrossRef]
- Jun, S.; Shukla, N.A.; Durm, G.; Hui, A.B.; Cao, S.; Ganti, A.K.; Jabbour, S.K.; Kunder, C.; Alizadeh, A.A.; Hanna, N.H.; et al. Analysis of Circulating Tumor DNA Predicts Outcomes of Short-Course Consolidation Immunotherapy in Unresectable Stage III NSCLC. J. Thorac. Oncol. Off. Publ. Int. Assoc. Study Lung Cancer 2024, 19, 1427–1437. [Google Scholar] [CrossRef]
- Pan, Y.; Zhang, J.T.; Gao, X.; Chen, Z.Y.; Yan, B.; Tan, P.X.; Yang, X.R.; Gao, W.; Gong, Y.; Tian, Z.; et al. Dynamic circulating tumor DNA during chemoradiotherapy predicts clinical outcomes for locally advanced non-small cell lung cancer patients. Cancer Cell 2023, 41, 1763–1773 e1764. [Google Scholar] [CrossRef]
- Gulley, M.L.; Elmore, S.; Gupta, G.P.; Kumar, S.; Egleston, M.; Hoskins, I.J.; Garnett, A. Use of Spiked Normalizers to More Precisely Quantify Tumor Markers and Viral Genomes by Massive Parallel Sequencing of Plasma DNA. J. Mol. Diagn. JMD 2020, 22, 437–446. [Google Scholar] [CrossRef] [PubMed]
- Zook, J.M.; Samarov, D.; McDaniel, J.; Sen, S.K.; Salit, M. Synthetic spike-in standards improve run-specific systematic error analysis for DNA and RNA sequencing. PLoS ONE 2012, 7, e41356. [Google Scholar] [CrossRef] [PubMed]
- Hoerres, D.; Dai, Q.; Elmore, S.; Sheth, S.; Gupta, G.P.; Kumar, S.; Gulley, M.L. Calibration of cell-free DNA measurements by next-generation sequencing. Am. J. Clin. Pathol. 2023, 160, 314–321. [Google Scholar] [CrossRef] [PubMed]
- Larson, N.B.; Oberg, A.L.; Adjei, A.A.; Wang, L. A Clinician’s Guide to Bioinformatics for Next-Generation Sequencing. J. Thorac. Oncol. Off. Publ. Int. Assoc. Study Lung Cancer 2023, 18, 143–157. [Google Scholar] [CrossRef]
- Tebar-Martinez, R.; Martin-Arana, J.; Gimeno-Valiente, F.; Tarazona, N.; Rentero-Garrido, P.; Cervantes, A. Strategies for improving detection of circulating tumor DNA using next generation sequencing. Cancer Treat. Rev. 2023, 119, 102595. [Google Scholar] [CrossRef]
- Li, W.; Huang, X.; Patel, R.; Schleifman, E.; Fu, S.; Shames, D.S.; Zhang, J. Analytical evaluation of circulating tumor DNA sequencing assays. Sci. Rep. 2024, 14, 4973. [Google Scholar] [CrossRef]
- Abbosh, C.; Frankell, A.M.; Harrison, T.; Kisistok, J.; Garnett, A.; Johnson, L.; Veeriah, S.; Moreau, M.; Chesh, A.; Chaunzwa, T.L.; et al. Tracking early lung cancer metastatic dissemination in TRACERx using ctDNA. Nature 2023, 616, 553–562. [Google Scholar] [CrossRef]






| NGS Primer | Sequence |
|---|---|
| QS1 | GCCTAAATGCTCCACTTAAAAGCTAAAGATGACA |
| QS2 | AAAAATGGGCGGAGGAGAGTAGTCTGAATT |
| QS3 | CCAGTGTTGTGGGATATTAATGTGCATTACATAG |
| Variant | Concentration (Copies/mL) | Coefficient of Variation |
|---|---|---|
| NRAS p.Q61K (p.Gln61Lys; c.181C > A) | 1540.8 | 10.1% |
| CTNNB1 p.S33Y (p.Ser33Tyr; c.98C > A) | 4006.1 | 10.4% |
| CTNNB1 p.S45del (p.Ser45del; c.133_135del) | 1232.7 | 12.0% |
| PIK3CA p.E545K (p.Glu545Lys; c.1633G > A) | 1109.4 | 14.5% |
| PIK3CA p.H1047R (p.His1047Arg; c.3140A > G) | 2157.2 | 11.2% |
| KIT p.D816V (p.Asp816Val; c.2447A > T) | 1232.7 | 13.4% |
| EGFR p.G719S (p.Gly719Ser; c.2155G > A) | 3020.0 | 8.9% |
| EGFR p.E746_A750del (p.Glu746_Ala750del; c.2235_2249del) | 246.5 | 25.1% |
| EGFR p.T790M (p.Thr790Met; c.2369C > T) | 123.3 | 31.9% |
| EGFR p.L858R (p.Leu858Arg; c.2573T > G) | 369.4 | 23.8% |
| BRAF p.V600E (p.Val600Glu; c.1799T > A) | 1295.7 | 10.2% |
| KRAS p.G13D (p.Gly13Asp; c.38G > A) | 1849.0 | 11.0% |
| KRAS p.G12D (p.Gly12Asp; c.35G > A) | 739.6 | 17.2% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Herbreteau, G.; Marcq, M.; Sauzay, C.; Carpentier, M.; Pierre-Noël, E.; Pons-Tostivint, E.; Vallée, A.; Théoleyre, S.; Bizieux, A.; Bennouna, J.; et al. Absolute Quantification of Nucleotide Variants in Cell-Free DNA via Quantitative NGS: Clinical Application in Non-Small Cell Lung Cancer Patients. Cancers 2025, 17, 783. https://doi.org/10.3390/cancers17050783
Herbreteau G, Marcq M, Sauzay C, Carpentier M, Pierre-Noël E, Pons-Tostivint E, Vallée A, Théoleyre S, Bizieux A, Bennouna J, et al. Absolute Quantification of Nucleotide Variants in Cell-Free DNA via Quantitative NGS: Clinical Application in Non-Small Cell Lung Cancer Patients. Cancers. 2025; 17(5):783. https://doi.org/10.3390/cancers17050783
Chicago/Turabian StyleHerbreteau, Guillaume, Marie Marcq, Chloé Sauzay, Maxime Carpentier, Elise Pierre-Noël, Elvire Pons-Tostivint, Audrey Vallée, Sandrine Théoleyre, Acya Bizieux, Jaafar Bennouna, and et al. 2025. "Absolute Quantification of Nucleotide Variants in Cell-Free DNA via Quantitative NGS: Clinical Application in Non-Small Cell Lung Cancer Patients" Cancers 17, no. 5: 783. https://doi.org/10.3390/cancers17050783
APA StyleHerbreteau, G., Marcq, M., Sauzay, C., Carpentier, M., Pierre-Noël, E., Pons-Tostivint, E., Vallée, A., Théoleyre, S., Bizieux, A., Bennouna, J., & Denis, M. G. (2025). Absolute Quantification of Nucleotide Variants in Cell-Free DNA via Quantitative NGS: Clinical Application in Non-Small Cell Lung Cancer Patients. Cancers, 17(5), 783. https://doi.org/10.3390/cancers17050783

