A New Approach of Detecting ALK Fusion Oncogenes by RNA Sequencing Exon Coverage Analysis
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Biosamples and RNA Sequencing
2.2. Exon Coverage Calculation
2.3. Experimental Validation of ALK Fusion Transcripts by Targeted NGS
2.4. Experimental Validation of ALK Fusion Transcripts by Sanger Sequencing
2.5. Bioinformatics Approach to Detecting ALK Fusion Transcripts
2.6. Statistical Analysis
3. Results
3.1. ALK Coverage Assymetry Screening
3.2. ALK Fusion Validation with Targeted NGS
3.3. Minimum Required RNAseq Coverage Depth for ALK Asymmetry Analysis
3.4. ALK Coverage Asymmetry in Targeted NGS Data
3.5. ALK Coverage Asymmetry in RNAseq Data and Response to Targeted Therapy
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Glenfield, C.; Innan, H. Gene Duplication and Gene Fusion Are Important Drivers of Tumourigenesis during Cancer Evolution. Genes 2021, 12, 1376. [Google Scholar] [CrossRef] [PubMed]
- Mohammad, T.; Zolotovskaia, M.A.; Suntsova, M.V.; Buzdin, A.A. Cancer Fusion Transcripts with Human Non-Coding RNAs. Front. Oncol. 2024, 14, 1415801. [Google Scholar] [CrossRef]
- Kong, Y.; Jiang, C.; Wei, G.; Sun, K.; Wang, R.; Qiu, T. Small Molecule Iinhibitors as Therapeutic Agents Targeting Oncogenic Fusion Proteins: Current Status and Clinical. Molecules 2023, 28, 4672. [Google Scholar] [CrossRef] [PubMed]
- Crescenzo, R.; Inghirami, G. Anaplastic Lymphoma Kinase Inhibitors. Curr. Opin. Pharmacol. 2015, 23, 39. [Google Scholar] [CrossRef]
- Eide, I.J.Z.; Nilssen, Y.; Stensland, E.M.; Brustugun, O.T. Real-World Data on EGFR and ALK Testing and TKI Usage in Norway—A Nation-Wide Population Study. Cancers 2023, 15, 1505. [Google Scholar] [CrossRef]
- Taniue, K.; Akimitsu, N. Fusion Genes and RNAs in Cancer Development. Non-Coding RNA 2021, 7, 10. [Google Scholar] [CrossRef]
- Sorokin, M.; Rabushko, E.; Rozenberg, J.M.; Mohammad, T.; Seryakov, A.; Sekacheva, M.; Buzdin, A. Clinically Relevant Fusion Oncogenes: Detection and Practical Implications. Ther. Adv. Med. Oncol. 2022, 14, 175883592211441. [Google Scholar] [CrossRef] [PubMed]
- Iwahara, T.; Fujimoto, J.; Wen, D.; Cupples, R.; Bucay, N.; Arakawa, T.; Mori, S.; Ratzkin, B.; Yamamoto, T. Molecular Characterization of ALK, a Receptor Tyrosine Kinase Expressed Specifically in the Nervous System. Oncogene 1997, 14, 439–449. [Google Scholar] [CrossRef]
- Morris, S.W.; Naeve, C.; Mathew, P.; James, P.L.; Kirstein, M.N.; Cui, X.; Witte, D.P. ALK the Chromosome 2 Gene Locus Altered by the t(2;5) in Non-Hodgkin’s Lymphoma, Encodes a Novel Neural Receptor Tyrosine Kinase That Is Highly Related to Leukocyte Tyrosine Kinase (LTK). Oncogene 1997, 14, 2175–2188. [Google Scholar] [CrossRef]
- Uhlén, M.; Fagerberg, L.; Hallström, B.M.; Lindskog, C.; Oksvold, P.; Mardinoglu, A.; Sivertsson, Å.; Kampf, C.; Sjöstedt, E.; Asplund, A.; et al. Tissue-Based Map of the Human Proteome. Science 2015, 347, 1260419. [Google Scholar] [CrossRef]
- Shiota, M.; Fujimoto, J.; Semba, T.; Satoh, H.; Yamamoto, T.; Mori, S. Hyperphosphorylation of a Novel 80 KDa Protein-Tyrosine Kinase Similar to Ltk in a Human Ki-1 Lymphoma Cell Line, AMS3. Oncogene 1994, 9, 1567–1574. [Google Scholar] [PubMed]
- Morris, S.W.; Kirstein, M.N.; Valentine, M.B.; Dittmer, K.G.; Shapiro, D.N.; Saltman, D.L.; Look, A.T. Fusion of a Kinase Gene, ALK, to a Nucleolar Protein Gene, NPM, in Non-Hodgkin’s Lymphoma. Science 1994, 263, 1281–1284. [Google Scholar] [CrossRef] [PubMed]
- Ross, J.S.; Ali, S.M.; Fasan, O.; Block, J.; Pal, S.; Elvin, J.A.; Schrock, A.B.; Suh, J.; Nozad, S.; Kim, S.; et al. ALK Fusions in a Wide Variety of Tumor Types Respond to Anti-ALK Targeted Therapy. Oncologist 2017, 22, 1444–1450. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.C.; Chang, I.C.; Wang, C.L.; Chen, T.D.; Chen, Y.T.; Liu, H.P.; Chu, Y.; Chiu, Y.T.; Wu, T.H.; Chou, L.H.; et al. Comparison of IHC, FISH and RT-PCR Methods for Detection of ALK Rearrangements in 312 Non-Small Cell Lung Cancer Patients in Taiwan. PLoS ONE 2013, 8, e70839. [Google Scholar] [CrossRef]
- Medeiros, L.J.; Elenitoba-Johnson, K.S.J. Anaplastic Large Cell Lymphoma. Am. J. Clin. Pathol. 2007, 127, 707–722. [Google Scholar] [CrossRef]
- Haas, B.J.; Dobin, A.; Li, B.; Stransky, N.; Pochet, N.; Regev, A. Accuracy Assessment of Fusion Transcript Detection via Read-Mapping and de Novo Fusion Transcript Assembly-Based Methods. Genome Biol. 2019, 20, 213. [Google Scholar] [CrossRef]
- Cook, J.R.; Dehner, L.P.; Collins, M.H.; Ma, Z.; Morris, S.W.; Coffin, C.M.; Hill, D.A. Anaplastic Lymphoma Kinase (ALK) Expression in the Inflammatory Myofibroblastic Tumor: A Comparative Immunohistochemical Study. Am. J. Surg. Pathol. 2001, 25, 1364–1371. [Google Scholar] [CrossRef]
- Chang, W.C.; Kim, H.K.; Shin, B.K. Clinicopathological Features and Diagnostic Methods of ALK Fusion-Positive Non-Small Cell Lung Cancer in Korea. Oncol. Rep. 2020, 43, 218–228. [Google Scholar] [CrossRef]
- Tuna, M.; Amos, C.I.; Mills, G.B. Molecular Mechanisms and Pathobiology of Oncogenic Fusion Transcripts in Epithelial Tumors. Oncotarget 2019, 10, 2095–2111. [Google Scholar] [CrossRef]
- Sondka, Z.; Dhir, N.B.; Carvalho-Silva, D.; Jupe, S.; Madhumita; McLaren, K.; Starkey, M.; Ward, S.; Wilding, J.; Ahmed, M.; et al. COSMIC: A Curated Database of Somatic Variants and Clinical Data for Cancer. Nucleic Acids Res. 2024, 52, D1210–D1217. [Google Scholar] [CrossRef]
- Kim, P.; Zhou, X. FusionGDB: Fusion Gene Annotation DataBase. Nucleic Acids Res. 2019, 47, D994–D1004. [Google Scholar] [CrossRef] [PubMed]
- Stein, H.; Foss, H.D.; Durkop, H.; Marafioti, T.; Delsol, G.; Pulford, K.; Pileri, S.; Falini, B. CD30+ Anaplastic Large Cell Lymphoma: A Review of Its Histopathologic, Genetic, and Clinical Features. Blood 2000, 96, 3681–3695. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.S.; Nagasaka, M.; Zhu, V.W.; Ou, S.H.I. Going beneath the Tip of the Iceberg. Identifying and Understanding EML4-ALK Variants and TP53 Mutations to Optimize Treatment of ALK Fusion Positive (ALK+) NSCLC. Lung Cancer 2021, 158, 126–136. [Google Scholar] [CrossRef] [PubMed]
- Holla, V.R.; Elamin, Y.Y.; Bailey, A.M.; Johnson, A.M.; Litzenburger, B.C.; Khotskaya, Y.B.; Sanchez, N.S.; Zeng, J.; Shufean, M.A.; Shaw, K.R.; et al. ALK: A Tyrosine Kinase Target for Cancer Therapy. Mol. Case Stud. 2017, 3, a001115. [Google Scholar] [CrossRef] [PubMed]
- Shreenivas, A.; Janku, F.; Gouda, M.A.; Chen, H.Z.; George, B.; Kato, S.; Kurzrock, R. ALK Fusions in the Pan-Cancer Setting: Another Tumor-Agnostic Target? NPJ Precis. Oncol. 2023, 7, 101. [Google Scholar] [CrossRef]
- Chiarle, R.; Voena, C.; Ambrogio, C.; Piva, R.; Inghirami, G. The Anaplastic Lymphoma Kinase in the Pathogenesis of Cancer. Nat. Rev. Cancer 2008, 8, 11–23. [Google Scholar] [CrossRef]
- Pisapia, P.; Pepe, F.; Sgariglia, R.; Nacchio, M.; Russo, G.; Gragnano, G.; Conticelli, F.; Salatiello, M.; Luca, C.D.; Girolami, I.; et al. Methods for Actionable Gene Fusion Detection in Lung Cancer: Now and in the Future. Pharmacogenomics 2021, 22, 833–847. [Google Scholar] [CrossRef]
- Malapelle, U.; Pepe, F.; Pisapia, P.; Altimari, A.; Bellevicine, C.; Brunnström, H.; Bruno, R.; Büttner, R.; Cirnes, L.; De Andrea, C.E.; et al. Reference Standards for Gene Fusion Molecular Assays on Cytological Samples: An International Validation Study. J. Clin. Pathol. 2023, 76, 47–52. [Google Scholar] [CrossRef]
- Ilie, M.I.; Bence, C.; Hofman, V.; Long-Mira, E.; Butori, C.; Bouhlel, L.; Lalvée, S.; Mouroux, J.; Poudenx, M.; Otto, J.; et al. Discrepancies between FISH and Immunohistochemistry for Assessment of the ALK Status Are Associated with ALK ’Borderline’-Positive Rearrangements or a High Copy Number: A Potential Major Issue for Anti-ALK Therapeutic Strategies. Ann. Oncol. 2015, 26, 238–244. [Google Scholar] [CrossRef]
- Lin, C.; Shi, X.; Yang, S.; Zhao, J.; He, Q.; Jin, Y.; Yu, X. Comparison of ALK Detection by FISH, IHC and NGS to Predict Benefit from Crizotinib in Advanced Non-Small-Cell Lung Cancer. Lung Cancer 2019, 131, 62–68. [Google Scholar] [CrossRef]
- Wiesner, T.; Lee, W.; Obenauf, A.C.; Ran, L.; Murali, R.; Zhang, Q.F.; Wong, E.W.P.; Hu, W.; Scott, S.N.; Shah, R.H.; et al. Alternative Transcription Initiation Leads to Expression of a Novel ALK Isoform in Cancer. Nature 2015, 526, 453–457. [Google Scholar] [CrossRef] [PubMed]
- Cabillic, F.; Hofman, P.; Ilie, M.; Peled, N.; Hochmair, M.; Dietel, M.; Von Laffert, M.; Gosney, J.R.; Lopez-Rios, F.; Erb, G.; et al. ALK IHC and FISH Discordant Results in Patients with NSCLC and Treatment Response: For Discussion of the Question—To Treat or Not to Treat? ESMO Open 2018, 3, e000419. [Google Scholar] [CrossRef] [PubMed]
- Mok, T.; Peters, S.; Camidge, D.R.; Noé, J.; Gadgeel, S.; Ou, S.H.I.; Kim, D.W.; Konopa, K.; Pozzi, E.; Liu, T.; et al. Outcomes According to ALK Status Determined by Central Immunohistochemistry or Fluorescence in Situ Hybridization in Patients with ALK-Positive NSCLC Enrolled in the Phase 3 ALEX Study. J. Thorac. Oncol. 2021, 16, 259–268. [Google Scholar] [CrossRef] [PubMed]
- Zeng, L.; Li, Y.; Xu, Q.; Jiang, W.; Lizaso, A.; Mao, X.; Zhang, Y.; Yang, N.; Wang, Z. Comparison of Next-Generation Sequencing and Ventana Immunohistochemistry in Detecting ALK Rearrangements and Predicting the Efficacy of First-Line Crizotinib in Patients with Advanced Non-Small Cell Lung Cancer. Onco. Targets. Ther. 2020, 13, 7101–7109. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Zhang, J.; Wang, Z.; Li, L.; Ma, J.; Zhou, X.; Wang, J.; Liang, Z.; Ying, J. Guidelines for Clinical Practice of ALK Fusion Detection in Non-Small-Cell Lung Cancer: A Proposal from the Chinese RATICAL Study Group. J. Natl. Cancer Cent. 2021, 1, 123–131. [Google Scholar] [CrossRef]
- Kuang, Y.; Xu, P.; Wang, J.; Zheng, Y.; Sun, X.; Li, Z.; Gan, R.J.; Li, H.; Guo, Y.; Yao, F.; et al. Detecting ALK Rearrangement with RT-PCR: A Reliable Approach Compared with next-Generation Sequencing in Patients with NSCLC. Mol. Diagn. Ther. 2021, 25, 487–494. [Google Scholar] [CrossRef]
- Takeuchi, K.; Choi, Y.L.; Soda, M.; Inamura, K.; Togashi, Y.; Hatano, S.; Enomoto, M.; Takada, S.; Yamashita, Y.; Satoh, Y.; et al. Multiplex Reverse Transcription-PCR Screening for EML4-ALK Fusion Transcripts. Clin. Cancer Res. 2008, 14, 6618–6624. [Google Scholar] [CrossRef]
- Hout, D.R.; Schweitzer, B.L.; Lawrence, K.; Morris, S.W.; Tucker, T.; Mazzola, R.; Skelton, R.; McMahon, F.; Handshoe, J.; Lesperance, M.; et al. Performance of a RT-PCR Assay in Comparison to Fish and Immunohistochemistry for the Detection of ALK in Non-Small Cell Lung Cancer. Cancers 2017, 9, 99. [Google Scholar] [CrossRef]
- Rosenbaum, J.N.; Bloom, R.; Forys, J.T.; Hiken, J.; Armstrong, J.R.; Branson, J.; McNulty, S.; Velu, P.D.; Pepin, K.; Abel, H.; et al. Genomic Heterogeneity of ALK Fusion Breakpoints in Non-Small-Cell Lung Cancer. Mod. Pathol. 2018, 31, 791–808. [Google Scholar] [CrossRef]
- Goytain, A.; Ng, T. NanoString NCounter Technology: High-Throughput RNA Validation; Springer: Berlin/Heidelberg, Germany, 2020; pp. 125–139. [Google Scholar]
- Pisapia, P.; Lozano, M.D.; Vigliar, E.; Bellevicine, C.; Pepe, F.; Malapelle, U.; Troncone, G. ALK and ROS1 Testing on Lung Cancer Cytologic Samples: Perspectives. Cancer Cytopathol. 2017, 125, 817–830. [Google Scholar] [CrossRef]
- Song, W.; Platteel, I.; Suurmeijer, A.J.H.; van Kempen, L.C. Diagnostic Yield of NanoString NCounter FusionPlex Profiling in Soft Tissue Tumors. Genes Chromosome Cancer 2020, 59, 318–324. [Google Scholar] [CrossRef] [PubMed]
- Ilié, M.; Goffinet, S.; Rignol, G.; Lespinet-Fabre, V.; Lalvée, S.; Bordone, O.; Zahaf, K.; Bonnetaud, C.; Washetine, K.; Lassalle, S.; et al. Shifting from Immunohistochemistry to Screen for ALK Rearrangements: Real-World Experience in a Large Single-Center Cohort of Patients with Non-Small-Cell Lung Cancer. Cancers 2024, 16, 2219. [Google Scholar] [CrossRef]
- De Luca, C.; Pepe, F.; Iaccarino, A.; Pisapia, P.; Righi, L.; Listì, A.; Greco, L.; Gragnano, G.; Campione, S.; De Dominicis, G.; et al. RNA-Based Assay for next-Generation Sequencing of Clinically Relevant Gene Fusions in Non-Small Cell Lung Cancer. Cancers 2021, 13, 139. [Google Scholar] [CrossRef] [PubMed]
- Luca, C.D.; Pepe, F.; Pisapia, P.; Iaccarino, A.; Righi, L.; Listì, A.; Russo, G.; Campione, S.; Pagni, F.; Nacchio, M.; et al. RNA-Based Next-Generation Sequencing in Non-Small-Cell Lung Cancer in a Routine Setting: An Experience from an Italian Referral Center. Per. Med. 2022, 19, 395–401. [Google Scholar] [CrossRef] [PubMed]
- Mosele, F.; Remon, J.; Mateo, J.; Westphalen, C.B.; Barlesi, F.; Lolkema, M.P.; Normanno, N.; Scarpa, A.; Robson, M.; Meric-Bernstam, F.; et al. Recommendations for the Use of Next-Generation Sequencing (NGS) for Patients with Metastatic Cancers: A Report from the ESMO Precision Medicine Working Group. Ann. Oncol. 2020, 31, 1491–1505. [Google Scholar] [CrossRef]
- Rabushko, E.; Sorokin, M.; Suntsova, M.; Seryakov, A.P.; Kuzmin, D.V.; Poddubskaya, E.; Buzdin, A.A. Experimentally Deduced Criteria for Detection of Clinically Relevant Fusion 3′ Oncogenes from FFPE Bulk RNA Sequencing Data. Biomedicines 2022, 10, 1866. [Google Scholar] [CrossRef]
- Liu, Y.; Wu, S.; Shi, X.; Lu, L.; Zhu, L.; Guo, Y.; Zhang, L.; Zeng, X. linical evaluation of the effectiveness of fusion-induced asymmetric transcription assay-based reverse transcription droplet digital PCR for ALK detection in formalin-fixed paraffin-embedded samples from lung cancer. Thorac. Cancer 2020, 11, 2252–2261. [Google Scholar] [CrossRef]
- Tong, Y.; Zhao, Z.; Liu, B.; Bao, A.; Zheng, H.; Gu, J.; McGrath, M.; Xia, Y.; Tan, B.; Song, C.; et al. 5′/3′ Imbalance Strategy to Detect ALK Fusion Genes in Circulating Tumor RNA from Patients with Non-Small Cell Lung Cancer. J. Exp. Clin. Cancer Res. 2018, 37, 1–8. [Google Scholar] [CrossRef]
- Vaughn, C.P.; Costa, J.L.; Feilotter, H.E.; Petraroli, R.; Bagai, V.; Rachiglio, A.M.; Marino, F.Z.; Tops, B.; Kurth, H.M.; Sakai, K.; et al. Simultaneous Detection of Lung Fusions Using a Multiplex RT-PCR next Generation Sequencing-Based Approach: A Multi-Institutional Research Study. BMC Cancer 2018, 18, 828. [Google Scholar] [CrossRef]
- Goytain, A.; Chang, K.T.E.; Goh, J.Y.; Nielsen, T.O.; Ng, T.L. Diagnosis of Fusion-Associated Sarcomas by Exon Expression Imbalance and Gene Expression. J. Mol. Diagn. 2023, 25, 121–131. [Google Scholar] [CrossRef]
- Suntsova, M.; Gaifullin, N.; Allina, D.; Reshetun, A.; Li, X.; Mendeleeva, L.; Surin, V.; Sergeeva, A.; Spirin, P.; Prassolov, V.; et al. Atlas of RNA Sequencing Profiles for Normal Human Tissues. Sci. Data 2019, 6, 36. [Google Scholar] [CrossRef] [PubMed]
- Virtanen, P.; Gommers, R.; Oliphant, T.E.; Haberland, M.; Reddy, T.; Cournapeau, D.; Burovski, E.; Peterson, P.; Weckesser, W.; Bright, J.; et al. SciPy 1.0: Fundamental Algorithms for Scientific Computing in Python. Nat. Methods 2020, 17, 261–272. [Google Scholar] [CrossRef] [PubMed]
- Morgan, M.; Shiekhattar, R.; Shilatifard, A.; Lauberth, S.M. It’s a DoG-Eat-DoG World—Altered Transcriptional Mechanisms Drive Downstream-of-Gene (DoG) Transcript Production. Mol. Cell 2022, 82, 1981–1991. [Google Scholar] [CrossRef]
- Abe, K.; Maunze, B.; Lopez, P.A.; Xu, J.; Muhammad, N.; Yang, G.Y.; Katz, D.; Liu, Y.; Lauberth, S.M. Downstream-of-Gene (DoG) Transcripts Contribute to an Imbalance in the Cancer Cell Transcriptome. Sci. Adv. 2024, 10, eadh9613. [Google Scholar] [CrossRef]
- Lin, J.J.; Zhu, V.W.; Yoda, S.; Yeap, B.Y.; Schrock, A.B.; Dagogo-Jack, I.; Jessop, N.A.; Jiang, G.Y.; Le, L.P.; Gowen, K.; et al. Impact of EML4-ALK Variant on Resistance Mechanisms and Clinical Outcomes in ALK-Positive Lung Cancer. J. Clin. Oncol. 2018, 36, 1199–1206. [Google Scholar] [CrossRef]
- Xia, W.; Yang, J.; Li, H.; Li, L.; Liu, J. Comparing Genomic Profiles of ALK Fusion-Positive and ALK Fusion-Negative Nonsmall Cell Lung Cancer Patients. Glob. Med. Genet. 2024, 11, 175–186. [Google Scholar] [CrossRef] [PubMed]
- Bridge, J.A.; Halling, K.C.; Moncur, J.T.; Souers, R.J.; Hameed, M.R.; Fernandes, H.; Roy, A.; Surrey, L.; Tafe, L.J.; Vasalos, P.; et al. RNA Sequencing for Solid Tumor Fusion Gene Detection. Arch. Pathol. Lab. Med. 2024, 148, 538–544. [Google Scholar] [CrossRef]
- Sun, L.; McNulty, S.N.; Evenson, M.J.; Zhu, X.; Robinson, J.A.; Mann, P.R.; Duncavage, E.J.; Pfeifer, J.D. Clinical Implications of a Targeted RNA-Sequencing Panel in the Detection of Gene Fusions in Solid Tumors. J. Mol. Diagn. 2021, 23, 1749–1760. [Google Scholar] [CrossRef]
- Hendriks, L.E.; Kerr, K.M.; Menis, J.; Mok, T.S.; Nestle, U.; Passaro, A.; Peters, S.; Planchard, D.; Smit, E.F.; Solomon, B.J.; et al. Oncogene-Addicted Metastatic Non-Small-Cell Lung Cancer: ESMO Clinical Practice Guideline for Diagnosis, Treatment and Follow-Up. Ann. Oncol. 2023, 34, 339–357. [Google Scholar] [CrossRef]
- Deyell, R.J.; Shen, Y.; Titmuss, E.; Dixon, K.; Williamson, L.M.; Pleasance, E.; Nelson, J.M.T.; Abbasi, S.; Krzywinski, M.; Armstrong, L.; et al. Whole Genome and Transcriptome Integrated Analyses Guide Clinical Care of Pediatric Poor Prognosis Cancers. Nat. Commun. 2024, 15, 4165. [Google Scholar] [CrossRef]
- Walter, W.; Shahswar, R.; Stengel, A.; Meggendorfer, M.; Kern, W.; Haferlach, T.; Haferlach, C. Clinical Application of Whole Transcriptome Sequencing for the Classification of Patients with Acute Lymphoblastic Leukemia. BMC Cancer 2021, 21, 886. [Google Scholar] [CrossRef] [PubMed]
- Buzdin, A.; Sorokin, M.; Garazha, A.; Glusker, A.; Aleshin, A.; Poddubskaya, E.; Sekacheva, M.; Kim, E.; Gaifullin, N.; Giese, A.; et al. RNA Sequencing for Research and Diagnostics in Clinical Oncology. Semin. Cancer Biol. 2020, 60, 311–323. [Google Scholar] [CrossRef] [PubMed]
- McPherson, A.; Hormozdiari, F.; Zayed, A.; Giuliany, R.; Ha, G.; Sun, M.G.F.; Griffith, M.; Heravi Moussavi, A.; Senz, J.; Melnyk, N.; et al. DeFuse: An Algorithm for Gene Fusion Discovery in Tumor RNA-Seq Data. PLoS Comput. Biol. 2011, 7, e1001138. [Google Scholar] [CrossRef]
- Nicorici, D.; Satalan, M.; Edgren, H.; Kangaspeska, S.; Murumagi, A.; Kallioniemi, O.; Virtanen, S.; Kilkku, O. FusionCatcher—A Tool for Finding Somatic Fusion Genes in Paired-End RNA-Sequencing Data. bioRxiv 2014, 011650. [Google Scholar] [CrossRef]
- Torres-García, W.; Zheng, S.; Sivachenko, A.; Vegesna, R.; Wang, Q.; Yao, R.; Berger, M.F.; Weinstein, J.N.; Getz, G.; Verhaak, R.G.W. PRADA: Pipeline for RNA Sequencing Data Analysis. Bioinformatics 2014, 30, 2224–2226. [Google Scholar] [CrossRef]
- Li, Y.; Chien, J.; Smith, D.I.; Ma, J. FusionHunter: Identifying Fusion Transcripts in Cancer Using Paired-End RNA-Seq. Bioinformatics 2011, 27, 1708–1710. [Google Scholar] [CrossRef] [PubMed]
- Jia, W.; Qiu, K.; He, M.; Song, P.; Zhou, Q.; Zhou, F.; Yu, Y.; Zhu, D.; Nickerson, M.L.; Wan, S.; et al. SOAPfuse: An Algorithm for Identifying Fusion Transcripts from Paired-End RNA-Seq Data. Genome Biol. 2013, 14, R12. [Google Scholar] [CrossRef]
- Davidson, N.M.; Majewski, I.J.; Oshlack, A. JAFFA: High Sensitivity Transcriptome-Focused Fusion Gene Detection. Genome Med. 2015, 7, 43. [Google Scholar] [CrossRef] [PubMed]
- Haas, B.; Dobin, A.; Stransky, N.; Li, B.; Yang, X.; Tickle, T.; Bankapur, A.; Ganote, C.; Doak, T.; Pochet, N. STAR-Fusion: Fast and Accurate Fusion Transcript Detection from RNA-Seq. bioRxiv 2017. [Google Scholar] [CrossRef]
- Uhrig, S.; Ellermann, J.; Walther, T.; Burkhardt, P.; Fröhlich, M.; Hutter, B.; Toprak, U.H.; Neumann, O.; Stenzinger, A.; Scholl, C.; et al. Accurate and Efficient Detection of Gene Fusions from RNA Sequencing Data. Genome Res. 2021, 31, 448–460. [Google Scholar] [CrossRef]
- Creason, A.; Haan, D.; Dang, K.; Chiotti, K.E.; Inkman, M.; Lamb, A.; Yu, T.; Hu, Y.; Norman, T.C.; Buchanan, A.; et al. A Community Challenge to Evaluate RNA-Seq, Fusion Detection, and Isoform Quantification Methods for Cancer Discovery. Cell Syst. 2021, 12, 827–838. [Google Scholar] [CrossRef] [PubMed]
- Musatov, I.Y.; Sorokin, M.I.; Buzdin, A.A. Bioinformatic Approaches for Detection of Fusion Genes and Trans-Splicing Products. Bioorg. Himia 2024, 50, 231–255. [Google Scholar] [CrossRef]







| Cancer Type 1 | Total Cases Sequenced, n (%) | Gender, Male/Female | Age of Onset | ||
|---|---|---|---|---|---|
| Mean | Median | Range | |||
| NSCLC | 119 (13.1%) | 61.3%/36.1% 2 | 60.01 | 60 | 29–81 |
| CRC | 113 (12.5%) | 46.0%/54.0% | 56.97 | 57 | 32–85 |
| TC | 107 (11.8%) | 20.6%/72.9% 2 | 47.69 | 50 | 11–77 |
| BC | 93 (10.3%) | 0%/100% | 51.54 | 52 | 27–81 |
| CNS | 73 (8.1%) | 58.9%/35.6% 2 | 43.90 | 48 | 3–70 |
| MM | 56 (6.2%) | 55.4%/44.6% | 58.66 | 60 | 29–78 |
| AL | 50 (5.5%) | 54%/46% | 5.79 | 5 | 1–15 |
| SC | 45 (5.0%) | 55.6%/44.4% | 55.80 | 55 | 31–79 |
| OC | 44 (4.9%) | 0%/100% | 48.95 | 47 | 27–80 |
| PC | 35 (3.9%) | 51.4%/45.7% 2 | 59.67 | 62 | 35–77 |
| KC | 32 (3.5%) | 62.5%/37.5% | 55.16 | 55 | 40–69 |
| Other | 139 (15.3%) | 43.2%/55.4% 2 | 52.21 | 54 | 12–84 |
| Target Fusion | Forward Primer, 5′–3′ | Reverse Primer, 5′–3′ |
|---|---|---|
| EML4(13)::ALK(20) | TGGAGATGTTCTTACTGGAGACTC | GCTTGCAGCTCCTGGTG |
| EML4(20)::ALK(20) | CATCACACACCTTGACTGGTC | GCTTGCAGCTCCTGGTG |
| Sample ID | Sex | Age on Onset | Cancer Type | ALK Status (Clinical Data) 1 | RNAseq Data | |
|---|---|---|---|---|---|---|
| ALK Coverage Asymmetry, p-Value 2 | Mean Coverage of ALK ex2-6/ex20-24 3 | |||||
| ALK_1_2 | M | 56 | Lung adenocarcinoma | ALK+ (IHC) | 0.036 | 0.0/0.018 |
| ALK_2 | F | 48 | Lung adenocarcinoma | EML4(6)::ALK(20) (RT-qPCR) | 0.004 | 0.0/0.080 |
| ALK_3 | F | 60 | Lung adenocarcinoma | ALK+ (IHC) | 0.971 | 0.023/0.007 |
| ALK_4 | M | 52 | Lung adenocarcinoma | ALK+ (FISH) | 0.013 | 0.0/0.012 |
| ALK_5 | F | 48 | Lung adenocarcinoma | ALK+ (FISH) | 0.005 | 0.002/0.103 |
| ALK_6_2 | F | 66 | Lung adenocarcinoma | ALK+ (FISH) | 1 | 0.0/0.0 |
| ALK_8 | M | 46 | Lung adenocarcinoma | ALK+ (IHC), EML4(13)::ALK(20) (RT-qPCR) | 0.006 | 0.003/0.138 |
| ALK_9 | F | 51 | Lung adenocarcinoma | ALK+ (FISH) | 0.004 | 0.0/0.170 |
| ALK_10 | M | 45 | Lung adenocarcinoma | ALK+ (RT-qPCR, FISH) | 0.004 | 0.0/0.206 |
| ALK_12 | F | 42 | Lung adenocarcinoma | ALK+ (IHC, FISH) | 0.037 | 0.002/0.023 |
| ALK_14 | M | 64 | Lung adenocarcinoma | ALK+ (IHC, FISH) | 0.949 | 0.004/0 |
| ALK_15 | M | 53 | Lung adenocarcinoma | ALK+/− (controversial IHC results in two labs) | 0.925 | 0.203/0.117 |
| ALK_16 | F | 29 | Lung adenocarcinoma | ALK+ (IHC, FISH) | 0.005 | 0.002/0.158 |
| LuC_62 | F | 62 | Lung adenocarcinoma | ALK− (method unspecified) | 0.004 | 0.0/0.038 |
| LuC_68 | M | 59 | Lung adenocarcinoma | ALK− (IHC; barely visible signal) | 0.004 | 0.0/0.007 |
| LuC_103 | M | 75 | Lung adenocarcinoma | ALK+ (IHC) 4 | 1 | 0.0/0.0 |
| LuC_104 | M | 46 | Squamous cell carcinoma | unknown | 0.004 | 0.0/0.125 |
| NS_20 | M | 58 | Glioblastoma | unknown | 0.845 | 0.059/0.042 |
| OC_25 | F | 58 | Ovarian cancer | unknown | 0.006 | 0.001/0.013 |
| Sample ID | Clinical ALK Status | RNAseq Coverage-Predicted ALK Fusion 1 | ALK Fusion Found in RNAseq (Number of Junction Reads) | TruSight Results (Number of Junction+Spanning Reads) | OncoFu Results (Number of Junction+Spanning Reads) |
|---|---|---|---|---|---|
| ALK_1_2 | positive | yes | no | EML4(6)::ALK(20) (1+0) | no fusion |
| ALK_2 | positive | yes | no | EML4(6)::ALK(20) (1+0) | EML4(6)::ALK(20)? (0+3) |
| ALK_3 | positive | no | no | no fusion | no fusion |
| ALK_4 | positive | yes | no | no fusion | EML4(6)::ALK(20)? (0+3) |
| ALK_5 | positive | yes | no | EML4(13)::ALK(20)? (0+1) | EML4(13)::ALK(20) (51+37) |
| ALK_6_2 | positive | no | no | no fusion | no fusion |
| ALK_8 | positive | yes | EML4(13)::ALK(20) (1) | EML4(13)::ALK(20) (1+4) | EML4(13)::ALK(20) (109+91) |
| ALK_9 | positive | yes | EML4(13)::ALK(20) (2) | EML4(13)::ALK(20)? (0+8) | EML4(13)::ALK(20) (241+255) |
| ALK_10 | positive | yes | EML4(13)::ALK(20) (5) | EML4(13)::ALK(20)? (0+24) | EML4(13)::ALK(20) (185+325) |
| ALK_12 | positive | yes | no | EML4(6)::ALK(20) (2+0) | EML4(6)::ALK(20) (14+17) |
| ALK_14 | positive | no | no | no fusion | no fusion |
| ALK_15 | controversial | no | no | no fusion | no fusion |
| ALK_16 | positive | yes | EML4(20)::ALK(20) (4) | no fusion | EML4(20)::ALK(20) (11+0) |
| LuC_62 | negative | yes | no | EML4(6)::ALK(20) (2+1) | EML4(6)::ALK(20) (12+7) |
| LuC_68 | negative | yes | no | no fusion | no fusion |
| LuC_103 | positive | no | no | no fusion | no fusion |
| LuC_104 | unknown | yes | no | EML4(13)::ALK(20) (3+1) | EML4(13)::ALK(20) (52+26) |
| NS_20 | unknown | no | no | no fusion | no fusion |
| OC_25 | unknown | yes | no | no fusion | no fusion |
| Sample ID | IHC/FISH/PCR ALK Status | Predicted ALK Fusion 1 | Validated ALK Fusion 2 | First Line TKI | First Line PFS, Weeks | Second Line TKI | Second Line PFS, Weeks |
|---|---|---|---|---|---|---|---|
| ALK_1_2 | positive | yes | yes | crizotinib | 100 | alectinib | unknown |
| ALK_2 | positive | yes | yes | ensartinib | 136 | alectinib | 64 |
| ALK_3 | positive | no | no | crizotinib | 8 | brigatinib | 8 |
| ALK_4 | positive | yes | yes | crizotinib | 8 | alectinib | 32 |
| ALK_8 | positive | yes | yes | crizotinib | 64 | alectinib | 32 |
| ALK_9 | positive | yes | yes | unknown | unknown | alectinib | 92 |
| ALK_10 | positive | yes | yes | crizotinib | 56 | alectinib | unknown |
| ALK_12 | positive | yes | yes | crizotinib | 48 | brigatinib | 108 |
| ALK_16 | positive | yes | yes | crizotinib | 40 | crizotinib | 172 |
| LuC_103 | positive | no | no | crizotinib | 16 | alectinib | 12 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zakharova, G.; Suntsova, M.; Rabushko, E.; Mohammad, T.; Drobyshev, A.; Seryakov, A.; Poddubskaya, E.; Moisseev, A.; Smirnova, A.; Sorokin, M.; et al. A New Approach of Detecting ALK Fusion Oncogenes by RNA Sequencing Exon Coverage Analysis. Cancers 2024, 16, 3851. https://doi.org/10.3390/cancers16223851
Zakharova G, Suntsova M, Rabushko E, Mohammad T, Drobyshev A, Seryakov A, Poddubskaya E, Moisseev A, Smirnova A, Sorokin M, et al. A New Approach of Detecting ALK Fusion Oncogenes by RNA Sequencing Exon Coverage Analysis. Cancers. 2024; 16(22):3851. https://doi.org/10.3390/cancers16223851
Chicago/Turabian StyleZakharova, Galina, Maria Suntsova, Elizaveta Rabushko, Tharaa Mohammad, Alexey Drobyshev, Alexander Seryakov, Elena Poddubskaya, Alexey Moisseev, Anastasia Smirnova, Maxim Sorokin, and et al. 2024. "A New Approach of Detecting ALK Fusion Oncogenes by RNA Sequencing Exon Coverage Analysis" Cancers 16, no. 22: 3851. https://doi.org/10.3390/cancers16223851
APA StyleZakharova, G., Suntsova, M., Rabushko, E., Mohammad, T., Drobyshev, A., Seryakov, A., Poddubskaya, E., Moisseev, A., Smirnova, A., Sorokin, M., Tkachev, V., Simonov, A., Guguchkin, E., Karpulevich, E., & Buzdin, A. (2024). A New Approach of Detecting ALK Fusion Oncogenes by RNA Sequencing Exon Coverage Analysis. Cancers, 16(22), 3851. https://doi.org/10.3390/cancers16223851

