Honey Targets Ribosome Biogenesis Components to Suppress the Growth of Human Pancreatic Cancer Cells
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture
2.3. MTT Assay
2.4. Colony Formation Assay
2.5. Wound-Healing Assay
2.6. Gene Expression Analysis
2.6.1. RNA Isolation
2.6.2. cDNA Synthesis
2.6.3. Quantitative Real-Time PCR (qRT-PCR) Analysis
2.7. Western Blotting
2.8. Apoptosis Assay
2.9. Cell Cycle Analysis
2.10. Confocal Microscopy
2.11. Statistical Analysis
3. Results
3.1. Honey Inhibits the Growth of Pancreatic Cancer Cells
3.2. Honey Targets Ribosome Biogenesis to Achieve Potential Antiproliferative Effect against Pancreatic Cancer
3.3. Honey Treatment Leads to the Suppression of Major Nucleolar Regulatory Proteins in Pancreatic Cancer Cells
3.4. Honey Induces Apoptosis in Pancreatic Cancer Cells
3.5. Honey Treatment Leads to Cell Cycle Arrest in MIA PaCa-2 and AsPC-1 Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, O.; Li, L.; Sheng, Y.; Ke, K.; Wu, J.; Mou, Y.; Liu, M.; Jin, W. Biological characteristics of pancreatic ductal adenocarcinoma: Initiation to malignancy, intracellular to extracellular. Cancer Lett. 2023, 574, 216391. [Google Scholar] [CrossRef] [Scilit]
- Shah, A.; Jahan, R.; Kisling, S.G.; Atri, P.; Natarajan, G.; Nallasamy, P.; Cox, J.L.; Macha, M.A.; Sheikh, I.A.; Ponnusamy, M.P.; et al. Secretory Trefoil Factor 1 (TFF1) promotes gemcitabine resistance through chemokine receptor CXCR4 in Pancreatic Ductal Adenocarcinoma. Cancer Lett. 2024, 598, 217097. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siegel, R.L.; Miller, K.D.; Wagle, N.S.; Jemal, A. Cancer statistics, 2023. CA Cancer J. Clin. 2023, 73, 17–48. [Google Scholar] [CrossRef] [Scilit]
- Rahib, L.; Wehner, M.R.; Matrisian, L.M.; Nead, K.T. Estimated Projection of US Cancer Incidence and Death to 2040. JAMA Netw. Open 2021, 4, e214708. [Google Scholar] [CrossRef] [Scilit]
- Abdelrahim, M.; Esmail, A.; Kasi, A.; Esnaola, N.F.; Xiu, J.; Baca, Y.; Weinberg, B.A. Comparative molecular profiling of pancreatic ductal adenocarcinoma of the head versus body and tail. npj Precis. Oncol. 2024, 8, 85. [Google Scholar] [CrossRef] [Scilit]
- Hosein, A.N.; Dougan, S.K.; Aguirre, A.J.; Maitra, A. Translational advances in pancreatic ductal adenocarcinoma therapy. Nat. Cancer 2022, 3, 272–286. [Google Scholar] [CrossRef] [Scilit]
- Conroy, T.; Desseigne, F.; Ychou, M.; Bouché, O.; Guimbaud, R.; Bécouarn, Y.; Adenis, A.; Raoul, J.-L.; Gourgou-Bourgade, S.; Fouchardière, C.d.l.; et al. FOLFIRINOX versus Gemcitabine for Metastatic Pancreatic Cancer. N. Engl. J. Med. 2011, 364, 1817–1825. [Google Scholar] [CrossRef] [Scilit]
- Elhamamsy, A.R.; Metge, B.J.; Alsheikh, H.A.; Shevde, L.A.; Samant, R.S. Ribosome biogenesis: A central player in cancer metastasis and therapeutic resistance. Cancer Res. 2022, 82, 2344–2353. [Google Scholar] [CrossRef] [Scilit]
- Wei, T.; Najmi, S.M.; Liu, H.; Peltonen, K.; Kucerova, A.; Schneider, D.A.; Laiho, M. Small-Molecule Targeting of RNA Polymerase I Activates a Conserved Transcription Elongation Checkpoint. Cell Rep. 2018, 23, 404–414. [Google Scholar] [CrossRef] [Scilit]
- Pitts, S.; Liu, H.; Ibrahim, A.; Garg, A.; Felgueira, C.M.; Begum, A.; Fan, W.; Teh, S.; Low, J.-Y.; Ford, B.; et al. Identification of an E3 ligase that targets the catalytic subunit of RNA Polymerase I upon transcription stress. J. Biol. Chem. 2022, 298, 102690. [Google Scholar] [CrossRef] [Scilit]
- Hamdane, N.; Herdman, C.; Mars, J.-C.; Stefanovsky, V.; Tremblay, M.G.; Moss, T. Depletion of the cisplatin targeted HMGB-box factor UBF selectively induces p53-independent apoptotic death in transformed cells. Oncotarget 2015, 6, 27519. [Google Scholar] [CrossRef] [Scilit]
- Theophanous, A.; Christodoulou, A.; Mattheou, C.; Sibai, D.S.; Moss, T.; Santama, N. Transcription factor UBF depletion in mouse cells results in downregulation of both downstream and upstream elements of the rRNA transcription network. J. Biol. Chem. 2023, 299, 105203. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Zhang, J.; Liu, W.; Ge, R.; Gao, T.; Tian, Q.; Mu, X.; Zhao, L.; Li, X. UBTF facilitates melanoma progression via modulating MEK1/2-ERK1/2 signalling pathways by promoting GIT1 transcription. Cancer Cell Int. 2021, 21, 543. [Google Scholar] [CrossRef] [Scilit]
- Kang, J.; Brajanovski, N.; Chan, K.T.; Xuan, J.; Pearson, R.B.; Sanij, E. Ribosomal proteins and human diseases: Molecular mechanisms and targeted therapy. Signal Transduct. Target. Ther. 2021, 6, 323. [Google Scholar] [CrossRef] [Scilit]
- El Khoury, W.; Nasr, Z. Deregulation of ribosomal proteins in human cancers. Biosci. Rep. 2021, 41, BSR20211577. [Google Scholar] [CrossRef] [Scilit]
- Espinoza, J.A.; Kanellis, D.C.; Saproo, S.; Leal, K.; Martinez, J.F.; Bartek, J.; Lindström, M.S. Chromatin damage generated by DNA intercalators leads to degradation of RNA Polymerase II. Nucleic Acids Res. 2024, 52, 4151–4166. [Google Scholar] [CrossRef] [Scilit]
- Xu, H.; Di Antonio, M.; McKinney, S.; Mathew, V.; Ho, B.; O’Neil, N.J.; Santos, N.D.; Silvester, J.; Wei, V.; Garcia, J.; et al. CX-5461 is a DNA G-quadruplex stabilizer with selective lethality in BRCA1/2 deficient tumours. Nat. Commun. 2017, 8, 14432. [Google Scholar] [CrossRef] [Scilit]
- Min, H.-Y.; Jang, H.-J.; Park, K.H.; Hyun, S.Y.; Park, S.J.; Kim, J.H.; Son, J.; Kang, S.S.; Lee, H.-Y. The natural compound gracillin exerts potent antitumor activity by targeting mitochondrial complex II. Cell Death Dis. 2019, 10, 810. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, P.; Alvi, S.S.; Iqbal, J.; Khan, M.S. Identification and evaluation of natural organosulfur compounds as potential dual inhibitors of α-amylase and α-glucosidase activity: An in-silico and in-vitro approach. Med. Chem. Res. 2021, 30, 2184–2202. [Google Scholar] [CrossRef] [Scilit]
- Alvi, S.S.; Ansari, I.A.; Khan, I.; Iqbal, J.; Khan, M.S. Potential role of lycopene in targeting proprotein convertase subtilisin/kexin type-9 to combat hypercholesterolemia. Free Radic. Biol. Med. 2017, 108, 394–403. [Google Scholar] [CrossRef] [Scilit]
- Alvi, S.S.; Ansari, I.A.; Ahmad, M.K.; Iqbal, J.; Khan, M.S. Lycopene amends LPS induced oxidative stress and hypertriglyceridemia via modulating PCSK-9 expression and Apo-CIII mediated lipoprotein lipase activity. Biomed. Pharmacother. 2017, 96, 1082–1093. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, P.; Alvi, S.S.; Iqbal, J.; Khan, M.S. Target-Based Virtual and Biochemical Screening Against HMG-CoA Reductase Reveals Allium sativum-Derived Organosulfur Compound N-Acetyl Cysteine as a Cardioprotective Agent. Rev. Bras. Farm. 2022, 32, 962–973. [Google Scholar] [CrossRef] [Scilit]
- Cristino, L.; Bisogno, T.; Di Marzo, V. Cannabinoids and the expanded endocannabinoid system in neurological disorders. Nat. Rev. Neurol. 2020, 16, 9–29. [Google Scholar] [CrossRef] [Scilit]
- Nabi, R.; Alvi, S.S.; Shah, M.S.; Ahmad, S.; Faisal, M.; Alatar, A.A.; Khan, M.S. A biochemical & biophysical study on in-vitro anti-glycating potential of iridin against d-Ribose modified BSA. Arch. Biochem. Biophys. 2020, 686, 108373. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, P.; Alvi, S.S.; Hasan, I.; Khan, M.S. Targeting SARS-CoV-2 main protease (Mpro) and human ACE-2: A virtual screening of carotenoids and polyphenols from tomato (Solanum lycopersicum L.) to combat Covid-19. Intell. Pharm. 2024, 2, 51–68. [Google Scholar] [CrossRef] [Scilit]
- Jahan, F.; Alvi, S.S.; Islam, M.H. Berberis aristata and its secondary metabolites: Insights into nutraceutical and therapeutical applications. Pharmacol. Res.—Mod. Chin. Med. 2022, 5, 100184. [Google Scholar] [CrossRef] [Scilit]
- Aumeeruddy, M.Z.; Aumeeruddy-Elalfi, Z.; Neetoo, H.; Zengin, G.; Blom van Staden, A.; Fibrich, B.; Lambrechts, I.A.; Rademan, S.; Szuman, K.M.; Lall, N.; et al. Pharmacological activities, chemical profile, and physicochemical properties of raw and commercial honey. Biocatal. Agric. Biotechnol. 2019, 18, 101005. [Google Scholar] [CrossRef] [Scilit]
- Waheed, M.; Hussain, M.B.; Javed, A.; Mushtaq, Z.; Hassan, S.; Shariati, M.A.; Khan, M.U.; Majeed, M.; Nigam, M.; Mishra, A.P.; et al. Honey and cancer: A mechanistic review. Clin. Nutr. 2019, 38, 2499–2503. [Google Scholar] [CrossRef] [Scilit]
- Idrus, R.B.H.; Sainik, N.Q.A.V.; Nordin, A.; Saim, A.B.; Sulaiman, N. Cardioprotective Effects of Honey and Its Constituent: An Evidence-Based Review of Laboratory Studies and Clinical Trials. Int. J. Environ. Res. Public Health 2020, 17, 3613. [Google Scholar] [CrossRef] [Scilit]
- Shakoori, Z.; Salaseh, E.; Mehrabian, A.R.; Tehrani, D.M.; Dardashti, N.F.; Salmanpour, F. The amount of antioxidants in honey has a strong relationship with the plants selected by honey bees. Sci. Rep. 2024, 14, 351. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, S.; Sulaiman, S.A.; Baig, A.A.; Ibrahim, M.; Liaqat, S.; Fatima, S.; Jabeen, S.; Shamim, N.; Othman, N.H. Honey as a Potential Natural Antioxidant Medicine: An Insight into Its Molecular Mechanisms of Action. Oxidative Med. Cell. Longev. 2018, 2018, 8367846. [Google Scholar] [CrossRef] [Scilit]
- El-Kased, R.F.; Amer, R.I.; Attia, D.; Elmazar, M.M. Honey-based hydrogel: In vitro and comparative In vivo evaluation for burn wound healing. Sci. Rep. 2017, 7, 9692. [Google Scholar] [CrossRef] [Scilit]
- El-Hakam, F.E.-Z.A.; Laban, G.A.; El-Din, S.B.; El-Hamid, H.A.; Farouk, M.H. Apitherapy combination improvement of blood pressure, cardiovascular protection, and antioxidant and anti-inflammatory responses in dexamethasone model hypertensive rats. Sci. Rep. 2022, 12, 20765. [Google Scholar] [CrossRef] [Scilit]
- Ranneh, Y.; Akim, A.M.; Hamid, H.A.; Khazaai, H.; Fadel, A.; Zakaria, Z.A.; Albujja, M.; Bakar, M.F.A. Honey and its nutritional and anti-inflammatory value. BMC Complement. Med. Ther. 2021, 21, 30. [Google Scholar] [CrossRef] [Scilit]
- Navaei-Alipour, N.; Mastali, M.; Ferns, G.A.; Saberi-Karimian, M.; Ghayour-Mobarhan, M. The effects of honey on pro- and anti-inflammatory cytokines: A narrative review. Phytother. Res. 2021, 35, 3690–3701. [Google Scholar] [CrossRef] [Scilit]
- Bobiş, O.; Dezmirean, D.S.; Moise, A.R. Honey and Diabetes: The Importance of Natural Simple Sugars in Diet for Preventing and Treating Different Type of Diabetes. Oxidative Med. Cell. Longev. 2018, 2018, 4757893. [Google Scholar] [CrossRef] [Scilit]
- Sharma, R.; Martins, N.; Chaudhary, A.; Garg, N.; Sharma, V.; Kuca, K.; Nepovimova, E.; Tuli, H.S.; Bishayee, A.; Chaudhary, A.; et al. Adjunct use of honey in diabetes mellitus: A consensus or conundrum? Trends Food Sci. Technol. 2020, 106, 254–274. [Google Scholar] [CrossRef] [Scilit]
- Hossen, M.S.; Ali, M.Y.; Jahurul, M.H.A.; Abdel-Daim, M.M.; Gan, S.H.; Khalil, M.I. Beneficial roles of honey polyphenols against some human degenerative diseases: A review. Pharmacol. Rep. 2017, 69, 1194–1205. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.-J.; Jin, B.-R.; Lee, C.-D.; Kim, D.; Lee, A.Y.; Lee, S.; An, H.-J. Anti-Inflammatory Effect of Chestnut Honey and Cabbage Mixtures Alleviates Gastric Mucosal Damage. Nutrients 2024, 16, 389. [Google Scholar] [CrossRef] [Scilit]
- Márquez-Garbán, D.C.; Yanes, C.D.; Llarena, G.; Elashoff, D.; Hamilton, N.; Hardy, M.; Wadehra, M.; McCloskey, S.A.; Pietras, R.J. Manuka Honey Inhibits Human Breast Cancer Progression in Preclinical Models. Nutrients 2024, 16, 2369. [Google Scholar] [CrossRef] [Scilit]
- Al Refaey, H.R.; Newairy, A.-S.A.; Wahby, M.M.; Albanese, C.; Elkewedi, M.; Choudhry, M.U.; Sultan, A.S. Manuka honey enhanced sensitivity of HepG2, hepatocellular carcinoma cells, for Doxorubicin and induced apoptosis through inhibition of Wnt/β-catenin and ERK1/2. Biol. Res. 2021, 54, 16. [Google Scholar] [CrossRef] [Scilit]
- Moskwa, J.; Borawska, M.H.; Markiewicz-Zukowska, R.; Puscion-Jakubik, A.; Naliwajko, S.K.; Socha, K.; Soroczynska, J. Polish Natural Bee Honeys Are Anti-Proliferative and Anti-Metastatic Agents in Human Glioblastoma multiforme U87MG Cell Line. PLoS ONE 2014, 9, e90533. [Google Scholar] [CrossRef] [Scilit]
- Deer, E.L.; González-Hernández, J.; Coursen, J.D.; Shea, J.E.; Ngatia, J.; Scaife, C.L.; Firpo, M.A.; Mulvihill, S.J. Phenotype and Genotype of Pancreatic Cancer Cell Lines. Pancreas 2010, 39, 425–435. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Liu, Z.; Li, M.; Li, Y.; Alvi, S.S.; Ansari, I.A.; Khan, M.S. Ginkgolide B Mediated Alleviation of Inflammatory Cascades and Altered Lipid Metabolism in HUVECs via Targeting PCSK-9 Expression and Functionality. BioMed Res. Int. 2019, 2019, 7284767. [Google Scholar] [CrossRef] [Scilit]
- Nabi, R.; Alvi, S.S.; Shah, A.; Chaturvedi, C.P.; Iqbal, D.; Ahmad, S.; Khan, M.S. Modulatory role of HMG-CoA reductase inhibitors and ezetimibe on LDL-AGEs-induced ROS generation and RAGE-associated signalling in HEK-293 Cells. Life Sci. 2019, 235, 116823. [Google Scholar] [CrossRef] [Scilit]
- Asif, M.; Alvi, S.S.; Azaz, T.; Khan, A.R.; Tiwari, B.; Hafeez, B.B.; Nasibullah, M. Novel Functionalized Spiro [Indoline-3,5′-pyrroline]-2,2′dione Derivatives: Synthesis, Characterization, Drug-Likeness, ADME, and Anticancer Potential. Int. J. Mol. Sci. 2023, 24, 7336. [Google Scholar] [CrossRef] [Scilit]
- Franken, N.A.P.; Rodermond, H.M.; Stap, J.; Haveman, J.; van Bree, C. Clonogenic assay of cells in vitro. Nat. Protoc. 2006, 1, 2315–2319. [Google Scholar] [CrossRef] [Scilit]
- Teymoorian, S.K.; Nouri, H.; Moghimi, H. In-vivo and in-vitro wound healing and tissue repair effect of Trametes versicolor polysaccharide extract. Sci. Rep. 2024, 14, 3796. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, S.; Nabi, R.; Alvi, S.S.; Khan, M.; Khan, S.; Khan, M.Y.; Hussain, I.; Shahanawaz, S.D.; Khan, M.S. Carvacrol protects against carbonyl osmolyte-induced structural modifications and aggregation to serum albumin: Insights from physicochemical and molecular interaction studies. Int. J. Biol. Macromol. 2022, 213, 663–674. [Google Scholar] [CrossRef] [Scilit]
- Abel, S.D.A.; Baird, S.K. Honey is cytotoxic towards prostate cancer cells but interacts with the MTT reagent: Considerations for the choice of cell viability assay. Food Chem. 2018, 241, 70–78. [Google Scholar] [CrossRef] [Scilit]
- Poortinga, G.; Hannan, K.M.; Snelling, H.; Walkley, C.R.; Jenkins, A.; Sharkey, K.; Wall, M.; Brandenburger, Y.; Palatsides, M.; Pearson, R.B.; et al. MAD1 and c-MYC regulate UBF and rDNA transcription during granulocyte differentiation. EMBO J. 2004, 23, 3325–3335. [Google Scholar] [CrossRef] [Scilit]
- Romano, S.; Fonseca, N.; Simões, S.; Gonçalves, J.; Moreira, J.N. Nucleolin-based targeting strategies for cancer therapy: From targeted drug delivery to cytotoxic ligands. Drug Discov. Today 2019, 24, 1985–2001. [Google Scholar] [CrossRef] [Scilit]
- Grisendi, S.; Mecucci, C.; Falini, B.; Pandolfi, P.P. Nucleophosmin and cancer. Nat. Rev. Cancer 2006, 6, 493–505. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Yang, G.; Li, Q.; Xie, F. Increased fibrillarin expression is associated with tumor progression and an unfavorable prognosis in hepatocellular carcinoma. Oncol. Lett. 2021, 21, 92. [Google Scholar] [CrossRef] [Scilit]
- Peltonen, K.; Colis, L.; Liu, H.; Trivedi, R.; Moubarek, M.S.; Moore, H.M.; Bai, B.; Rudek, M.A.; Bieberich, C.J.; Laiho, M. A Targeting Modality for Destruction of RNA Polymerase I that Possesses Anticancer Activity. Cancer Cell 2014, 25, 77–90. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, Y.; Obinata, H.; Konishi, A.; Yamagiwa, N.; Tsuneoka, M. Production of ROS by Gallic Acid Activates KDM2A to Reduce rRNA Transcription. Cells 2020, 9, 2266. [Google Scholar] [CrossRef] [Scilit]
- Ponzo, M.; Debesset, A.; Cossutta, M.; Chalabi-Dchar, M.; Houppe, C.; Pilon, C.; Nicolas-Boluda, A.; Meunier, S.; Raineri, F.; Thiolat, A.; et al. Nucleolin Therapeutic Targeting Decreases Pancreatic Cancer Immunosuppression. Cancers 2022, 14, 4265. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Gao, C.; Xu, X.; Li, M.; Zhao, X.; Wang, Y.; Wang, Y.; Zhang, S.; Yan, Z.; Liu, X.; et al. FBL promotes cancer cell resistance to DNA damage and BRCA1 transcription via YBX1. EMBO Rep. 2023, 24, e56230. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.; Shi, M.; Chen, H.; Gu, J.; Zhang, J.; Shen, B.; Deng, X.; Xie, J.; Zhan, X.; Peng, C. NPM1 activates metabolic changes by inhibiting FBP1 while promoting the tumorigenicity of pancreatic cancer cells. Oncotarget 2015, 6, 21443. [Google Scholar] [CrossRef] [Scilit]
- Hassin, O.; Oren, M. Drugging p53 in cancer: One protein, many targets. Nat. Rev. Drug Discov. 2023, 22, 127–144. [Google Scholar] [CrossRef] [Scilit]
- Mello, S.S.; Flowers, B.M.; Mazur, P.K.; Lee, J.J.; Müller, F.; Denny, S.K.; Ferreira, S.; Hanson, K.; Kim, S.K.; Greenleaf, W.J.; et al. Multifaceted role for p53 in pancreatic cancer suppression. Proc. Natl. Acad. Sci. USA 2023, 120, e2211937120. [Google Scholar] [CrossRef] [Scilit]
- Fiorini, C.; Cordani, M.; Padroni, C.; Blandino, G.; Di Agostino, S.; Donadelli, M. Mutant p53 stimulates chemoresistance of pancreatic adenocarcinoma cells to gemcitabine. Biochim. Biophys. Acta (BBA)—Mol. Cell Res. 2015, 1853, 89–100. [Google Scholar] [CrossRef] [Scilit]
- Yamazaki, T.; Galluzzi, L. BAX and BAK dynamics control mitochondrial DNA release during apoptosis. Cell Death Differ. 2022, 29, 1296–1298. [Google Scholar] [CrossRef] [Scilit]
- Mashimo, M.; Onishi, M.; Uno, A.; Tanimichi, A.; Nobeyama, A.; Mori, M.; Yamada, S.; Negi, S.; Bu, X.; Kato, J.; et al. The 89-kDa PARP1 cleavage fragment serves as a cytoplasmic PAR carrier to induce AIF-mediated apoptosis. J. Biol. Chem. 2021, 296, 100046. [Google Scholar] [CrossRef] [Scilit]
- Boice, A.; Bouchier-Hayes, L. Targeting apoptotic caspases in cancer. Biochim. Biophys. Acta (BBA)—Mol. Cell Res. 2020, 1867, 118688. [Google Scholar] [CrossRef] [Scilit]
- Riedl, S.J.; Shi, Y. Molecular mechanisms of caspase regulation during apoptosis. Nat. Rev. Mol. Cell Biol. 2004, 5, 897–907. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Zhou, M.; Hu, Q.; Bai, X.-C.; Huang, W.; Scheres, S.H.W.; Shi, Y. Mechanistic insights into caspase-9 activation by the structure of the apoptosome holoenzyme. Proc. Natl. Acad. Sci. USA 2017, 114, 1542–1547. [Google Scholar] [CrossRef] [Scilit]
- Shalini, S.; Dorstyn, L.; Dawar, S.; Kumar, S. Old, new and emerging functions of caspases. Cell Death Differ. 2015, 22, 526–539. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Zheng, Y.; Yang, F.; Zhu, L.; Zhu, X.-Q.; Wang, Z.-F.; Wu, X.-L.; Zhou, C.-H.; Yan, J.-Y.; Hu, B.-Y.; et al. The molecular biology of pancreatic adenocarcinoma: Translational challenges and clinical perspectives. Signal Transduct. Target. Ther. 2021, 6, 249. [Google Scholar] [CrossRef] [Scilit]
- Christenson, E.S.; Jaffee, E.; Azad, N.S. Current and emerging therapies for patients with advanced pancreatic ductal adenocarcinoma: A bright future. Lancet Oncol. 2020, 21, e135–e145. [Google Scholar] [CrossRef] [Scilit]
- Connor, A.A.; Denroche, R.E.; Jang, G.H.; Lemire, M.; Zhang, A.; Chan-Seng-Yue, M.; Wilson, G.; Grant, R.C.; Merico, D.; Lungu, I.; et al. Integration of Genomic and Transcriptional Features in Pancreatic Cancer Reveals Increased Cell Cycle Progression in Metastases. Cancer Cell 2019, 35, 267–282.e267. [Google Scholar] [CrossRef] [Scilit]







| S. No. | Gene | Primer Sequence | |
|---|---|---|---|
| Forward (5′-3′) | Reverse (5′-3′) | ||
| 1. | UBTF | CAAAACCACCGAATCACACA | TGTCAATGTACGGAACTTCCT C |
| 2. | RPA194 | GAA GTTGCCAGAGGAAGT G | CTGGGTACTTGTCCATCATTA G |
| 3. | β-actin | ACAGCCTGGATAGCAAGG | CACCAACTGGGACGACAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bangash, A.A.; Alvi, S.S.; Bangash, M.A.; Ahsan, H.; Khan, S.; Shareef, R.; Villanueva, G.; Bansal, D.; Ahmad, M.; Kim, D.J.; et al. Honey Targets Ribosome Biogenesis Components to Suppress the Growth of Human Pancreatic Cancer Cells. Cancers 2024, 16, 3431. https://doi.org/10.3390/cancers16193431
Bangash AA, Alvi SS, Bangash MA, Ahsan H, Khan S, Shareef R, Villanueva G, Bansal D, Ahmad M, Kim DJ, et al. Honey Targets Ribosome Biogenesis Components to Suppress the Growth of Human Pancreatic Cancer Cells. Cancers. 2024; 16(19):3431. https://doi.org/10.3390/cancers16193431
Chicago/Turabian StyleBangash, Aun Ali, Sahir Sultan Alvi, Muhammad Ali Bangash, Haider Ahsan, Shiza Khan, Rida Shareef, Georgina Villanueva, Divyam Bansal, Mudassier Ahmad, Dae Joon Kim, and et al. 2024. "Honey Targets Ribosome Biogenesis Components to Suppress the Growth of Human Pancreatic Cancer Cells" Cancers 16, no. 19: 3431. https://doi.org/10.3390/cancers16193431
APA StyleBangash, A. A., Alvi, S. S., Bangash, M. A., Ahsan, H., Khan, S., Shareef, R., Villanueva, G., Bansal, D., Ahmad, M., Kim, D. J., Chauhan, S. C., & Hafeez, B. B. (2024). Honey Targets Ribosome Biogenesis Components to Suppress the Growth of Human Pancreatic Cancer Cells. Cancers, 16(19), 3431. https://doi.org/10.3390/cancers16193431

