Variances in the Expression Profile of Circadian Clock-Related Genes in Astrocytic Brain Tumors
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics
2.2. Participants
2.3. Isolation of Total Ribonucleic Acid (RNA)
2.4. Microarray Expression Pattern of Circadian Clock-Related Genes
2.5. Comprehensive Microarray Profiling of Circadian Clock-Related miRNAs and Their Potential Impact on Gene Expression
2.6. Quantitative Reverse-Transcription Polymerase Chain Reaction (qRT-PCR) Analysis
2.7. Methylation Analysis of Genes Using PCR
2.8. Enzyme-Linked Immunosorbent Assay (ELISA) Reaction
2.9. Statistical Analyses
3. Results
3.1. Microarray and qRT-PCR Profile of Circadian Clock-Related Genes in G3/G4 Samples of Astrocytic Tumors in Comparison to G2 Samples
3.2. Prediction of Circadian Clock Gene Expression Regulation by miRNAs
3.3. Methylation Profile of Selected Genes Related to the Circadian Clock in Astrocytic Tumor Samples
3.4. Concentration of Selected Proteins Related to the Circadian Clock in the G2, G3, and G4 Astrocytic Tumor Samples
3.5. Relationship Network for the Selected Circadian Clock-Related Proteins
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cano-Valdez, A.M.; Sevilla-Lizcano, D.B. Pathological Classification of Brain Tumors. In Principles of Neuro-Oncology; Monroy-Sosa, A., Chakravarthi, S.S., De La Garza-Salazar, J.G., Meneses Garcia, A., Kassam, A.B., Eds.; Springer International Publishing: Cham, Switzerland, 2021; pp. 75–105. ISBN 978-3-030-54878-0. [Google Scholar]
- Pienkowski, T.; Kowalczyk, T.; Kretowski, A.; Ciborowski, M. A Review of Gliomas-Related Proteins. Characteristics of Potential Biomarkers. Am. J. Cancer Res. 2021, 11, 3425. [Google Scholar] [PubMed]
- Machnik, G.; Bułdak, Ł.; Zapletal-Pudełko, K.; Grabarek, B.O.; Staszkiewicz, R.; Sobański, D.; Okopień, B. The Impact of Wound-Healing Assay, Phorbol Myristate Acetate (PMA) Stimulation and siRNA-Mediated FURIN Gene Silencing on Endogenous Retroviral ERVW-1 Expression Level in U87-MG Astrocytoma Cells. Adv. Med. Sci. 2024, 69, 113–124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Z.; Hambardzumyan, D. Immune Microenvironment in Glioblastoma Subtypes. Front. Immunol. 2018, 9, 1004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanif, F.; Muzaffar, K.; Perveen, K.; Malhi, S.M.; Simjee, S.U. Glioblastoma Multiforme: A Review of Its Epidemiology and Pathogenesis through Clinical Presentation and Treatment. Asian Pac. J. Cancer Prev. 2017, 18, 3–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ostrom, Q.T.; Cioffi, G.; Gittleman, H.; Patil, N.; Waite, K.; Kruchko, C.; Barnholtz-Sloan, J.S. CBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2012–2016. Neuro Oncol. 2019, 21, v1–v100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reifenberger, G.; Wirsching, H.-G.; Knobbe-Thomsen, C.B.; Weller, M. Advances in the Molecular Genetics of Gliomas—Implications for Classification and Therapy. Nat. Rev. Clin. Oncol. 2017, 14, 434–452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bale, T.A.; Rosenblum, M.K. The 2021 WHO Classification of Tumors of the Central Nervous System: An Update on Pediatric Low-grade Gliomas and Glioneuronal Tumors. Brain Pathol. 2022, 32, e13060. [Google Scholar] [CrossRef] [Scilit]
- Horbinski, C.; Berger, T.; Packer, R.J.; Wen, P.Y. Clinical Implications of the 2021 Edition of the WHO Classification of Central Nervous System Tumours. Nat. Rev. Neurol. 2022, 18, 515–529. [Google Scholar] [CrossRef] [Scilit]
- Louis, D.N.; Perry, A.; Wesseling, P.; Brat, D.J.; Cree, I.A.; Figarella-Branger, D.; Hawkins, C.; Ng, H.K.; Pfister, S.M.; Reifenberger, G.; et al. The 2021 WHO Classification of Tumors of the Central Nervous System: A Summary. Neuro Oncol. 2021, 23, 1231–1251. [Google Scholar] [CrossRef] [Scilit]
- Sokolenko, A.P.; Imyanitov, E.N. Molecular Diagnostics in Clinical Oncology. Front. Mol. Biosci. 2018, 5, 76. [Google Scholar] [CrossRef] [Scilit]
- Ceccarelli, M.; Barthel, F.P.; Malta, T.M.; Sabedot, T.S.; Salama, S.R.; Murray, B.A.; Morozova, O.; Newton, Y.; Radenbaugh, A.; Pagnotta, S.M.; et al. Molecular Profiling Reveals Biologically Discrete Subsets and Pathways of Progression in Diffuse Glioma. Cell 2016, 164, 550–563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Radke, J.; Koch, A.; Pritsch, F.; Schumann, E.; Misch, M.; Hempt, C.; Lenz, K.; Löbel, F.; Paschereit, F.; Heppner, F.L.; et al. Predictive MGMT Status in a Homogeneous Cohort of IDH Wildtype Glioblastoma Patients. Acta Neuropathol. Commun. 2019, 7, 89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Labreche, K.; Kinnersley, B.; Berzero, G.; Di Stefano, A.L.; Rahimian, A.; Detrait, I.; Marie, Y.; Grenier-Boley, B.; Hoang-Xuan, K.; Delattre, J.-Y.; et al. Diffuse Gliomas Classified by 1p/19q Co-Deletion, TERT Promoter and IDH Mutation Status Are Associated with Specific Genetic Risk Loci. Acta Neuropathol. 2018, 135, 743–755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, J.W.; Lee, K.; Kim, E.E.; Kim, S.-I.; Park, S.-H. Brain Tumor Classification by Methylation Profile. J. Korean Med. Sci. 2023, 38, e356. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suruga, Y.; Satomi, K.; Otani, Y.; Fujii, K.; Ishida, J.; Uneda, A.; Tsuboi, N.; Makino, K.; Hirano, S.; Kemmotsu, N.; et al. The Utility of DNA Methylation Analysis in Elderly Patients with Pilocytic Astrocytoma Morphology. J. Neurooncol. 2022, 160, 179–189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farshadi, E.; van Der Horst, G.T.; Chaves, I. Molecular Links between the Circadian Clock and the Cell Cycle. J. Mol. Biol. 2020, 432, 3515–3524. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hergenhan, S.; Holtkamp, S.; Scheiermann, C. Molecular Interactions between Components of the Circadian Clock and the Immune System. J. Mol. Biol. 2020, 432, 3700–3713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, Y. Roles of Circadian Clocks in Cancer Pathogenesis and Treatment. Exp. Mol. Med. 2021, 53, 1529–1538. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Z.; Liu, P.; Li, C.; Luo, Y.; Chen, I.; Liang, W.; Chen, X.; Feng, Y.; Xia, H.; Wang, F. Deregulated Expression of the Clock Genes in Gliomas. Technol. Cancer Res. Treat. 2013, 12, 91–97. [Google Scholar] [CrossRef] [Scilit]
- Arafa, K.; Emara, M. Insights about Circadian Clock and Molecular Pathogenesis in Gliomas. Front. Oncol. 2020, 10, 199. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Su, G.; Dai, Z.; Meng, M.; Zhang, H.; Fan, F.; Liu, Z.; Zhang, L.; Weygant, N.; He, F.; et al. Circadian Clock Genes Promote Glioma Progression by Affecting Tumour Immune Infiltration and Tumour Cell Proliferation. Cell Prolif. 2021, 54, e12988. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, H.; Cook, K.; Gee, H.E.; Hau, E. Hypoxia, Metabolism, and the Circadian Clock: New Links to Overcome Radiation Resistance in High-Grade Gliomas. J. Exp. Clin. Cancer Res. 2020, 39, 129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Crespo, I.; Tao, H.; Nieto, A.B.; Rebelo, O.; Domingues, P.; Vital, A.L.; del Patino, C.M.; Barbosa, M.; Lopes, M.C.; Oliveira, C.R. Amplified and Homozygously Deleted Genes in Glioblastoma: Impact on Gene Expression Levels. PLoS ONE 2012, 7, e46088. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kanehisa, M.; Furumichi, M.; Sato, Y.; Kawashima, M.; Ishiguro-Watanabe, M. KEGG for Taxonomy-Based Analysis of Pathways and Genomes. Nucleic Acids Res. 2023, 51, D587–D592. [Google Scholar] [CrossRef] [Scilit]
- Agarwal, V.; Bell, G.W.; Nam, J.-W.; Bartel, D.P. Predicting Effective microRNA Target Sites in Mammalian mRNAs. eLife 2015, 4, e05005. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Wang, X. miRDB: An Online Database for Prediction of Functional microRNA Targets. Nucleic Acids Res. 2020, 48, D127–D131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, W.; Wang, X. Prediction of Functional microRNA Targets by Integrative Modeling of microRNA Binding and Target Expression Data. Genome Biol. 2019, 20, 18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szklarczyk, D.; Kirsch, R.; Koutrouli, M.; Nastou, K.; Mehryary, F.; Hachilif, R.; Gable, A.L.; Fang, T.; Doncheva, N.T.; Pyysalo, S.; et al. The STRING Database in 2023: Protein-Protein Association Networks and Functional Enrichment Analyses for Any Sequenced Genome of Interest. Nucleic Acids Res. 2023, 51, D638–D646. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Louis, D.; Ohgaki, H.; Wiestler, O.; Cavenee, W.; Burger, P.; Jouvet, A.; Scheithauer, B.; Kleihues, P. The 2007 WHO Classification of Tumours of the Central Nervous System. Acta Neuropathol. 2007, 114, 97–109. [Google Scholar] [CrossRef] [Scilit]
- Verdugo, E.; Puerto, I.; Medina, M.Á. An Update on the Molecular Biology of Glioblastoma, with Clinical Implications and Progress in Its Treatment. Cancer Commun. 2022, 42, 1083–1111. [Google Scholar] [CrossRef] [Scilit]
- Marko, N.; Toms, S.; Barnett, G.; Weil, R. Genomic Expression Patterns Distinguish Long-Term from Short-Term Glioblastoma Survivors: A Preliminary Feasibility Study. Genomics 2008, 91, 395–406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, A.; Lin, X.; Tan, X.; Yin, B.; Han, W.; Zhao, J.; Yuan, J.; Qiang, B.; Peng, X. Circadian Gene Clock Contributes to Cell Proliferation and Migration of Glioma and Is Directly Regulated by Tumor-Suppressive miR-124. FEBS Lett. 2013, 587, 2455–2460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buhr, E.D.; Takahashi, J.S. Molecular Components of the Mammalian Circadian Clock. Handb. Exp. Pharmacol. 2013, 24, 3–27. [Google Scholar] [CrossRef] [Scilit]
- Shafi, A.A.; Knudsen, K.E. Cancer and the Circadian Clock. Cancer Res. 2019, 79, 3806–3814. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Puram, R.V.; Kowalczyk, M.S.; de Boer, C.G.; Schneider, R.K.; Miller, P.G.; McConkey, M.; Tothova, Z.; Tejero, H.; Heckl, D.; Järås, M.; et al. Core Circadian Clock Genes Regulate Leukemia Stem Cells in AML. Cell 2016, 165, 303–316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, Z.; Zhang, G.; Qu, M.; Gimple, R.C.; Wu, Q.; Qiu, Z.; Prager, B.C.; Wang, X.; Kim, L.J.Y.; Morton, A.R.; et al. Targeting Glioblastoma Stem Cells through Disruption of the Circadian Clock. Cancer Discov. 2019, 9, 1556–1573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pang, L.; Dunterman, M.; Xuan, W.; Gonzalez, A.; Lin, Y.; Hsu, W.-H.; Khan, F.; Hagan, R.S.; Muller, W.A.; Heimberger, A.B.; et al. Circadian Regulator CLOCK Promotes Tumor Angiogenesis in Glioblastoma. Cell Rep. 2023, 42, 112127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miljkovic-Licina, M.; Hammel, P.; Garrido-Urbani, S.; Lee, B.P.-L.; Meguenani, M.; Chaabane, C.; Bochaton-Piallat, M.-L.; Imhof, B.A. Targeting Olfactomedin-like 3 Inhibits Tumor Growth by Impairing Angiogenesis and Pericyte Coverage. Mol. Cancer Ther. 2012, 11, 2588–2599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, A.Y.; Zheng, H.; Ouyang, G. Periostin, a Multifunctional Matricellular Protein in Inflammatory and Tumor Microenvironments. Matrix Biol. 2014, 37, 150–156. [Google Scholar] [CrossRef] [Scilit]
- Eble, J.A.; Niland, S. The Extracellular Matrix in Tumor Progression and Metastasis. Clin. Exp. Metastasis 2019, 36, 171–198. [Google Scholar] [CrossRef] [Scilit]
- Cooper, J.M.; Ou, Y.-H.; McMillan, E.A.; Vaden, R.M.; Zaman, A.; Bodemann, B.O.; Makkar, G.; Posner, B.A.; White, M.A. TBK1 Provides Context-Selective Support of the Activated AKT/mTOR Pathway in Lung Cancer. Cancer Res. 2017, 77, 5077–5094. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hagan, R.; Torres-Castillo, J.; Doerschuk, C. Myeloid TBK1 Signaling Contributes to the Immune Response to Influenza. Am. J. Respir. Cell Mol. Biol. 2019, 60, 335–345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Czabanka, M.; Korherr, C.; Brinkmann, U.; Vajkoczy, P. Influence of TBK-1 on Tumor Angiogenesis and Microvascular Inflammation. Front. Biosci. 2008, 13, 7243–7249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schulz, M.; Salamero-Boix, A.; Niesel, K.; Alekseeva, T.; Sevenich, L. Microenvironmental Regulation of Tumor Progression and Therapeutic Response in Brain Metastasis. Front. Immunol. 2019, 10, 1713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shivshankar, P.; Fekry, B.; Eckel-Mahan, K.; Wetsel, R.A. Circadian Clock and Complement Immune System-Complementary Control of Physiology and Pathology? Front. Cell Infect. Microbiol. 2020, 10, 418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xuan, W.; Hsu, W.-H.; Khan, F.; Dunterman, M.; Pang, L.; Wainwright, D.A.; Ahmed, A.U.; Heimberger, A.B.; Lesniak, M.S.; Chen, P. Circadian Regulator CLOCK Drives Immunosuppression in Glioblastoma. Cancer Immunol. Res. 2022, 10, 770–784. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neidert, N.; von Ehr, A.; Zöller, T.; Spittau, B. Microglia-Specific Expression of Olfml3 Is Directly Regulated by Transforming Growth Factor Β1-Induced Smad2 Signaling. Front. Immunol. 2018, 9, 1728. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kurowska, N.; Strzalka-Mrozik, B.; Madej, M.; Pająk, K.; Kruszniewska-Rajs, C.; Kaspera, W.; Gola, J.M. Differences in the Expression Patterns of TGFβ Isoforms and Associated Genes in Astrocytic Brain Tumors. Cancers 2022, 14, 1876. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bavishi, A.A.; Grammer, L.C.; Pongracic, J.; Rychlik, K.; Kumar, R.; Zee, P.; Greenberger, P.A.; Fishbein, A.B. Diurnal Variations in Subcutaneous Allergen Immunotherapy Reactions. Ann. Allergy Asthma Immunol. 2017, 118, 103–107. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Yuan, G.; Xie, H.; Wei, T.; Zhu, D.; Cui, J.; Liu, X.; Shen, R.; Zhu, Y.; Yang, X. Circadian Clock Associates with Tumor Microenvironment in Thoracic Cancers. Aging 2019, 11, 11814–11828. [Google Scholar] [CrossRef] [Scilit]
- Zhou, H.; Sun, C.; Li, C.; Hua, S.; Li, F.; Li, R.; Cai, D.; Zou, Y.; Cai, Y.; Jiang, X. The MicroRNA-106a/20b Strongly Enhances the Antitumour Immune Responses of Dendritic Cells Pulsed with Glioma Stem Cells by Targeting STAT3. J. Immunol. Res. 2022, 2022, 9721028. [Google Scholar] [CrossRef] [Scilit]
- Díaz, R.; Silva, J.; García, J.M.; Lorenzo, Y.; García, V.; Peña, C.; Rodríguez, R.; Muñoz, C.; García, F.; Bonilla, F.; et al. Deregulated Expression of miR-106a Predicts Survival in Human Colon Cancer Patients. Genes Chromosomes Cancer 2008, 47, 794–802. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, G.; Zhang, R.; Chen, X.; Mu, Y.; Ai, J.; Shi, C.; Liu, Y.; Shi, C.; Sun, L.; Rainov, N.G.; et al. MiR-106a Inhibits Glioma Cell Growth by Targeting E2F1 Independent of P53 Status. J. Mol. Med. 2011, 89, 1037–1050. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhi, F.; Chen, X.; Wang, S.; Xia, X.; Shi, Y.; Guan, W.; Shao, N.; Qu, H.; Yang, C.; Zhang, Y.; et al. The use of hsa-miR-21, hsa-miR-181b and hsa-miR-106a as prognostic indicators of astrocytoma. Eur. J. Cancer 2010, 46, 1640–1649. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, S.; Yang, G.; Mu, Y.; Han, D.; Shi, C.; Chen, X.; Deng, Y.; Zhang, D.; Wang, L.; Liu, Y.; et al. MiR-106a Is an Independent Prognostic Marker in Patients with Glioblastoma. Neuro Oncol. 2013, 15, 707–717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Litak, J.; Grochowski, C.; Litak, J.; Osuchowska, I.; Gosik, K.; Radzikowska, E.; Kamieniak, P.; Rolinski, J. TLR-4 Signaling vs. Immune Checkpoints, Mirnas Molecules, Cancer Stem Cells, and Wingless-Signaling Interplay in Glioblastoma Multiforme—Future Perspectives. Int. J. Mol. Sci. 2020, 21, 3114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, Q.; Zhang, Q.; Gu, M.; Zhang, K.; Xia, T.; Zhang, S.; Chen, W.; Yin, H.; Yao, H.; Fan, Y.; et al. MIR106A-5p Upregulation Suppresses Autophagy and Accelerates Malignant Phenotype in Nasopharyngeal Carcinoma. Autophagy 2021, 17, 1667–1683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, S.; Yu, S.; Li, J.; Yin, Y.; Liu, Y.; Zhang, Q.; Guan, H.; Li, Y.; Xiao, H. MiR-20b Displays Tumor-Suppressor Functions in Papillary Thyroid Carcinoma by Regulating the MAPK/ERK Signaling Pathway. Thyroid 2016, 26, 1733–1743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, W.; Shi, G.; Zhang, Q.; Wu, Q.; Li, B.; Zhang, Z. MicroRNA-20b Promotes Cell Growth of Breast Cancer Cells Partly via Targeting Phosphatase and Tensin Homologue (PTEN). Cell Biosci. 2014, 4, 62. [Google Scholar] [CrossRef] [Scilit]
- Huang, T.; Alvarez, A.A.; Pangeni, R.P.; Horbinski, C.M.; Lu, S.; Kim, S.-H.; James, C.D.; Raizer, J.J.; Kessler, A.J.; Brenann, C.W.; et al. A Regulatory Circuit of miR-125b/miR-20b and Wnt Signalling Controls Glioblastoma Phenotypes through FZD6-Modulated Pathways. Nat. Commun. 2016, 7, 12885. [Google Scholar] [CrossRef] [Scilit]
- Vara-Ciruelos, D.; Dandapani, M.; Hardie, D.G. AMP-Activated Protein Kinase: Friend or Foe in Cancer? Annu. Rev. Cancer Biol. 2020, 4, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Hardie, D.G.; Alessi, D.R. LKB1 and AMPK and the Cancer-Metabolism Link—Ten Years after. BMC Biol. 2013, 11, 36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, J.; Wang, Y.; Wang, X.; Ai, Z.; Li, T.; Pu, X.; Yang, X.; Yao, Y.; He, J.; Cheng, S.Y.; et al. AMPK Attenuates SHH Subgroup Medulloblastoma Growth and Metastasis by Inhibiting NF-κB Activation. Cell Biosci. 2023, 13, 15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Zhou, X.; Cheng, L.; Wang, X.; Zhang, Q.; Zhang, Y.; Sun, S. PRKAA1 Promotes Proliferation and Inhibits Apoptosis of Gastric Cancer Cells through Activating JNK1 and Akt Pathways. Oncol. Res. 2020, 28, 213–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Obba, S.; Hizir, Z.; Boyer, L.; Selimoglu-Buet, D.; Pfeifer, A.; Michel, G.; Hamouda, M.-A.; Gonçalvès, D.; Cerezo, M.; Marchetti, S.; et al. The PRKAA1/AMPKα1 Pathway Triggers Autophagy during CSF1-Induced Human Monocyte Differentiation and Is a Potential Target in CMML. Autophagy 2015, 11, 1114–1129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fox, M.M.; Phoenix, K.N.; Kopsiaftis, S.G.; Claffey, K.P. AMP-Activated Protein Kinase α 2 Isoform Suppression in Primary Breast Cancer Alters AMPK Growth Control and Apoptotic Signaling. Genes Cancer 2013, 4, 3–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ouyang, Y.; Gu, Y.; Zhang, X.; Huang, Y.; Wei, X.; Tang, F.; Zhang, S. AMPKα2 Promotes Tumor Immune Escape by Inducing CD8+ T-Cell Exhaustion and CD4+ Treg Cell Formation in Liver Hepatocellular Carcinoma. BMC Cancer 2024, 24, 276. [Google Scholar] [CrossRef] [Scilit]
- Massa, C.; Wang, Y.; Marr, N.; Seliger, B. Interferons and Resistance Mechanisms in Tumors and Pathogen-Driven Diseases-Focus on the Major Histocompatibility Complex (MHC) Antigen Processing Pathway. Int. J. Mol. Sci. 2023, 24, 6736. [Google Scholar] [CrossRef] [Scilit]
- Varghese, R.T.; Liang, Y.; Guan, T.; Franck, C.T.; Kelly, D.F.; Sheng, Z. Survival Kinase Genes Present Prognostic Significance in Glioblastoma. Oncotarget 2016, 7, 20140–20151. [Google Scholar] [CrossRef] [Scilit]
- Neurath, K.M.; Keough, M.P.; Mikkelsen, T.; Claffey, K.P. AMP-Dependent Protein Kinase Alpha 2 Isoform Promotes Hypoxia-Induced VEGF Expression in Human Glioblastoma. Glia 2006, 53, 733–743. [Google Scholar] [CrossRef] [Scilit]
- Pan, L.; Wang, H.; Jiang, C.; Li, W.; Chen, Y.; Ying, G. Multiple MicroRNAs Synergistically Promote Tolerance to Epidermal Growth Factor Receptor-Targeted Drugs in Smoked Lung Cancer Therapies. J. Cancer Res. Ther. 2019, 15, 876–881. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, W.; Jiang, K.; Wang, J.; Mei, T.; Zhao, M.; Huang, D. Upregulation of GNPNAT1 Predicts Poor Prognosis and Correlates with Immune Infiltration in Lung Adenocarcinoma. Front. Mol. Biosci. 2021, 8, 605754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Godlewski, J.; Lenart, J.; Salinska, E. MicroRNA in Brain Pathology: Neurodegeneration the Other Side of the Brain Cancer. Noncoding RNA 2019, 5, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, F.; Qu, Y.; Zhu, J.; Zhang, L.; Huang, L.; Liu, H.; Li, S.; Mu, D. miR-30d-5p Plays an Important Role in Autophagy and Apoptosis in Developing Rat Brains After Hypoxic-Ischemic Injury. J. Neuropathol. Exp. Neurol. 2017, 76, 709–719. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Campa, D.; Claus, R.; Dostal, L.; Stein, A.; Chang-Claude, J.; Meidtner, K.; Boeing, H.; Olsen, A.; Tjønneland, A.; Overvad, K.; et al. Variation in Genes Coding for AMP-Activated Protein Kinase (AMPK) and Breast Cancer Risk in the European Prospective Investigation on Cancer (EPIC). Breast Cancer Res. Treat. 2011, 127, 761–767. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beena, T.B.; Jesil, M.A.; Harikumar, K.B.; Safeeda, E. Integrative Analysis of the AMPK Subunits in Colorectal Adeno Carcinoma. Asian Pac. J. Cancer Prev. 2023, 24, 1159–1171. [Google Scholar] [CrossRef] [Scilit]
- Wagner, P.M.; Prucca, C.G.; Caputto, B.L.; Guido, M.E. Adjusting the Molecular Clock: The Importance of Circadian Rhythms in the Development of Glioblastomas and Its Intervention as a Therapeutic Strategy. Int. J. Mol. Sci. 2021, 22, 8289. [Google Scholar] [CrossRef] [Scilit]
- Petkovic, M.; Yalçin, M.; Heese, O.; Relógio, A. Differential Expression of the Circadian Clock Network Correlates with Tumour Progression in Gliomas. BMC Med. Genom. 2023, 16, 154. [Google Scholar] [CrossRef] [Scilit]
- Xia, H.; Niu, Z.; Ma, H.; Cao, S.; Hao, S.; Liu, Z.; Wang, F. Deregulated Expression of the Per1 and Per2 in Human Gliomas. Can. J. Neurol. Sci. 2010, 37, 365–370. [Google Scholar] [CrossRef] [Scilit]
- Dai, D.; Huang, W.; Lu, Q.; Chen, H.; Liu, J.; Hong, B. miR-24 Regulates Angiogenesis in Gliomas. Mol. Med. Rep. 2018, 18, 358–368. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.; Liu, M.; Peng, X.; Zhou, P.; Zhou, J.; Xu, K.; Xu, H.; Jiang, S. miR-24-3p and miR-27a-3p Promote Cell Proliferation in Glioma Cells via Cooperative Regulation of MXI1. Int. J. Oncol. 2013, 42, 757–766. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Gender | Age (Years) | WHO Grade of Malignancy | Number of Samples |
|---|---|---|---|
| Female (n = 32) | 55.9 ± 3.4 | G2 | 9 |
| 57.9 ± 2.8 | G3 | 5 | |
| 56.9 ± 2.2 | G4 | 18 | |
| Male (n = 28) | 58.8 ± 2.3 | G2 | 7 |
| 58.9 ± 1.7 | G3 | 4 | |
| 56.4 ± 2.1 | G4 | 17 |
| mRNA | qRT-PCR Amplification Primers (5′-3′) |
|---|---|
| CLOCK | Forward: AAAGTTAAGATTTTGGGTTAGATAAT |
| Reverse: ACCATCTTCTCATAAACTAATAAATACTAC | |
| PRKAA1 | Forward: AGATTTAGTTTTTGGAGAAAGATGG |
| Reverse: TTTATACCCAATCAATTCATATTTACC | |
| PRKAA2 | Forward: TTTGAAGATTTTTTTTATGATGTTAAC |
| Reverse: ACTCACTAACTTAATTCATTATTCTCCG | |
| PRKAB1 | Forward: GAGTTTTTTGTTTAGGGTTTTTTTT |
| Reverse: CCAAAAATTCCTCCTTCTCTAATAC | |
| PRKAB2 | Forward: TTATATTAGTGGTTTTTGGAGGAGG |
| Reverse: CCCAAAAAACTTAAAATCAAAAAAAC | |
| PER1 | Forward: ATTTTGGAGGAGTTGGAGTATATTA |
| Reverse: AAAAAACCAAAAACTCAAAAAAAC | |
| PER2 | Forward: GTGTGTTTTTGGTTTTGTTTTAGGT |
| Reverse: AAACCACTACTCATATCCACATCTTC | |
| PER3 | Forward: GGTTGTAGGAAAGGGAAGTATAAG |
| Reverse: AAAAAACCTAACTAAACACCATAAC | |
| β-actin | Forward: TCACCCACACTGTGCCCATCTACGA |
| Reverse: CAGCGGAACCGCTCATTGCCAATGG |
| mRNA | NCBI Reference Sequence | qRT-PCR Amplification Primers (5′-3′) | |
|---|---|---|---|
| CLOCK | M | NM_001267843.2 | Forward: TTAAGATTTTGGGTTAGATAATCGT Reverse: AAATAAAATACTCGTATCCGTCGAA |
| U | Forward: TTAAGATTTTGGGTTAGATAATTGT Reverse: AAATAAAATACTCATATCCATCAAA | ||
| PRKAA1 | M | NM_006251.6 | Forward: GGTTGTTGAAATATTAAGGGTACGT Reverse: ACTTATCACAAAATTCTTCCTTCGTA |
| U | Forward: GGTTGTTGAAATATTAAGGGTATGT Reverse: ACTTATCACAAAATTCTTCCTTCATA | ||
| PRKAA2 | M | NM_006252.4 | Forward: TTTGTTTGTTGTGGATTATTGTTATAG Reverse: TCCAAATATCAACTTCAAAACCTAC |
| U | Forward: AGATGTTTATTGGATGTATTGAATA Reverse: CAAATAAAATTATAAACTCATTTTCAC | ||
| PRKAB1 | M | NM_006253.5 | Forward: GGTATGGTGGTTATAAGACGTTTC Reverse: TCTCTAATACCTTAATTTCCTCGAA |
| U | Forward: GTATGGTGGTTATAAGATGTTTTGG Reverse: TCTCTAATACCTTAATTTCCTCAAA | ||
| PRKAB2 | M | NM_005399.5 | Forward: GTTTTGAAGGTAGGAGTGGAATTC Reverse: AAAACCTAAAATTCTCCAATACGAT |
| U | Forward: TTTGAAGGTAGGAGTGGAATTTG Reverse: AAAACCTAAAATTCTCCAATACAAT | ||
| PER1 | M | NM_002616.3 | Forward: TGTCGTATTAGAGGAGGTTTTGATC Reverse: CAAAAAATATCCGAAAAACTTCGTA |
| U | Forward: GTTGTATTAGAGGAGGTTTTGATTG Reverse: CAAAAAATATCCAAAAAACTTCATA | ||
| PER2 | M | NM_022817.3 | Forward: TTGAGTATATTGTGAAGAATGTCGA Reverse: TAACTTTTCCGAACACTAACACG |
| U | Forward: TTGAGTATATTGTGAAGAATGTTGA Reverse: AACTTTTCCAAACACTAACACAAC | ||
| PER3 | M | NM_001289862.2 | Forward: GGTTGTAGGAAAGGGAAGTATAAGC Reverse: GACAAATAAAAAAATCGAACTCGAA |
| U | Forward: TTGTAGGAAAGGGAAGTATAAGTGG Reverse: AACAAATAAAAAAATCAAACTCAAA |
| Protein | G2 | G3 | G4 |
|---|---|---|---|
| CLOCK [ng/mL] | 3.12 ± 0.19 A,B | 5.67 ± 0.65 | 9.87 ± 0.19 C |
| PRKAA1 [ng/mL] | 1.98 ± 0.27 A,B | 3.45 ± 0.18 | 6.67 ± 0.67 C |
| PRKAA2 [ng/mL] | 2.10 ± 0.19 B | 2.21 ± 0.65 | 4.45 ± 0.51 |
| PRKAB1 [ng/mL] | 9.81 ± 0.18 | 3.44 ± 0.34 A,B | 1.45 ± 0.12 C |
| PRKAB2 [ng/mL] | 412.01 ± 23.98 A,B | 654.11 ± 56.98 | 236.98 ± 43.81 C |
| PER1 [ng/mL] | 4.51 ± 0.18 A | 3.22 ± 0.19 | 2.91 ± 0.75 C |
| PER2 [ng/mL] | 4.76 ± 0.54 A,B | 4.56 ± 0.34 | 2.19 ± 0.23 C |
| PER3 [ng/mL] | 7.18 ± 0.98 A,B | 5.01 ± 0.18 | 2.88 ± 0.44 C |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Staszkiewicz, R.; Sobański, D.; Pulka, W.; Gładysz, D.; Gadzieliński, M.; Strojny, D.; Grabarek, B.O. Variances in the Expression Profile of Circadian Clock-Related Genes in Astrocytic Brain Tumors. Cancers 2024, 16, 2335. https://doi.org/10.3390/cancers16132335
Staszkiewicz R, Sobański D, Pulka W, Gładysz D, Gadzieliński M, Strojny D, Grabarek BO. Variances in the Expression Profile of Circadian Clock-Related Genes in Astrocytic Brain Tumors. Cancers. 2024; 16(13):2335. https://doi.org/10.3390/cancers16132335
Chicago/Turabian StyleStaszkiewicz, Rafał, Dawid Sobański, Wojciech Pulka, Dorian Gładysz, Marcin Gadzieliński, Damian Strojny, and Beniamin Oskar Grabarek. 2024. "Variances in the Expression Profile of Circadian Clock-Related Genes in Astrocytic Brain Tumors" Cancers 16, no. 13: 2335. https://doi.org/10.3390/cancers16132335
APA StyleStaszkiewicz, R., Sobański, D., Pulka, W., Gładysz, D., Gadzieliński, M., Strojny, D., & Grabarek, B. O. (2024). Variances in the Expression Profile of Circadian Clock-Related Genes in Astrocytic Brain Tumors. Cancers, 16(13), 2335. https://doi.org/10.3390/cancers16132335

