HELLS Is Negatively Regulated by Wild-Type P53 in Liver Cancer by a Mechanism Involving P21 and FOXM1
Abstract
:Simple Summary
Abstract
1. Introduction
2. Material and Methods
2.1. Cell Culture and Drug Treatment
2.2. Transfection of siRNA and Plasmid Constructs
2.3. Gel Electrophoresis and Immunoblotting
2.4. Total RNA Isolation, cDNA Synthesis and Quantitative Real-Time PCR
2.5. Murine HCC Samples
2.6. RNA Isolation and Affymetrix mRNA Microarray
2.7. MTT-Assay
2.8. Prediction of a Non-Canonical FOXM1-Binding Site in HELLS
2.9. FOXM1 Chromatin Immunoprecipitation
2.10. Statistical Analyses and Software
3. Results
3.1. HELLS Is a Repression Target of P53
3.2. Repression of HELLS by P53 Involves P21 Induction
3.3. P53/P21 Dependent HELLS Repression Requires Downregulation of FOXM1
3.4. HELLS and FOXM1 mRNA Correlates in Human HCC Cohorts
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fitzmaurice, C.; Akinyemiju, T.F.; Al Lami, F.H.; Alam, T.; Alizadeh-Navaei, R.; Allen, C.; Alsharif, U.; Alvis-Guzman, N.; Amini, E.; Anderson, B.O.; et al. Global, Regional, and National Cancer Incidence, Mortality, Years of Life Lost, Years Lived with Disability, and Disability-Adjusted Life-Years for 29 Cancer Groups, 1990 to 2016: A Systematic Analysis for the Global Burden of Disease Study. JAMA Oncol. 2018, 4, 1553–1568. [Google Scholar] [CrossRef]
- European Association for the Study of the Liver. EASL Clinical Practice Guidelines: Management of hepatocellular carcinoma. J. Hepatol. 2018, 69, 182–236. [Google Scholar] [CrossRef] [Green Version]
- Bruix, J.; Reig, M.; Sherman, M. Evidence-Based Diagnosis, Staging, and Treatment of Patients with Hepatocellular Carcinoma. Gastroenterology 2016, 150, 835–853. [Google Scholar] [CrossRef] [Green Version]
- Kastenhuber, E.R.; Lowe, S.W. Putting p53 in Context. Cell 2017, 170, 1062–1078. [Google Scholar] [CrossRef] [Green Version]
- Vousden, K.H.; Prives, C. Blinded by the Light: The Growing Complexity of p53. Cell 2009, 137, 413–431. [Google Scholar] [CrossRef] [Green Version]
- Hollstein, M.; Rice, K.; Greenblatt, M.S.; Soussi, T.; Fuchs, R.; Sørlie, T.; Hovig, E.; Smith-Sørensen, B.; Montesano, R.; Harris, C.C. Database of p53 gene somatic mutations in human tumors and cell lines. Nucleic Acids Res. 1994, 22, 3551–3555. [Google Scholar]
- Lees, A.; Sessler, T.; McDade, S. Dying to Survive—The p53 Paradox. Cancers 2021, 13, 3257. [Google Scholar] [CrossRef]
- Berkers, C.R.; Maddocks, O.D.; Cheung, E.C.; Mor, I.; Vousden, K.H. Metabolic regulation by p53 family members. Cell Metab. 2013, 18, 617–633. [Google Scholar] [CrossRef] [Green Version]
- Kumari, R.; Jat, P. Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype. Front. Cell Dev. Biol. 2021, 9, 645593. [Google Scholar] [CrossRef]
- Shamloo, B.; Usluer, S. p21 in Cancer Research. Cancers 2019, 11, 1178. [Google Scholar] [CrossRef] [Green Version]
- Engeland, K. Cell cycle arrest through indirect transcriptional repression by p53: I have a DREAM. Cell Death Differ. 2018, 25, 114–132. [Google Scholar] [CrossRef] [Green Version]
- Sullivan, K.D.; Galbraith, M.D.; Andrysik, Z.; Espinosa, J.M. Mechanisms of transcriptional regulation by p53. Cell Death Differ. 2018, 25, 133–143. [Google Scholar] [CrossRef] [Green Version]
- Fischer, M.; Quaas, M.; Nickel, A.; Engeland, K. Indirect p53-dependent transcriptional repression of Survivin, CDC25C, and PLK1 genes requires the cyclin-dependent kinase inhibitor p21/CDKN1A and CDE/CHR promoter sites binding the DREAM complex. Oncotarget 2015, 6, 41402–41417. [Google Scholar] [CrossRef] [Green Version]
- Beckerman, R.; Prives, C. Transcriptional regulation by p53. Cold Spring Harb. Perspect. Biol. 2010, 2, a000935. [Google Scholar] [CrossRef] [Green Version]
- Pfister, N.T.; Fomin, V.; Regunath, K.; Zhou, J.Y.; Zhou, W.; Silwal-Pandit, L.; Freed-Pastor, W.A.; Laptenko, O.; Neo, S.P.; Bargonetti, J.; et al. Mutant p53 cooperates with the SWI/SNF chromatin remodeling complex to regulate VEGFR2 in breast cancer cells. Genes Dev. 2015, 29, 1298–1315. [Google Scholar] [CrossRef] [Green Version]
- Neigeborn, L.; Carlson, M. Genes affecting the regulation of SUC2 gene expression by glucose repression in Saccharomyces cerevisiae. Genetics 1984, 108, 845–858. [Google Scholar] [CrossRef]
- Stern, M.; Jensen, R.; Herskowitz, I. Five SWI genes are required for expression of the HO gene in yeast. J. Mol. Biol. 1984, 178, 853–868. [Google Scholar] [CrossRef]
- Flaus, A.; Martin, D.M.; Barton, G.J.; Owen-Hughes, T. Identification of multiple distinct Snf2 subfamilies with conserved structural motifs. Nucleic Acids Res. 2006, 34, 2887–2905. [Google Scholar] [CrossRef] [Green Version]
- Law, C.T.; Wei, L.; Tsang, F.H.; Chan, C.Y.; Xu, I.M.; Lai, R.K.; Ho, D.W.; Lee, J.M.; Wong, C.C.; Ng, I.O.; et al. HELLS Regulates Chromatin Remodeling and Epigenetic Silencing of Multiple Tumor Suppressor Genes in Human Hepatocellular Carcinoma. Hepatology 2019, 69, 2013–2030. [Google Scholar] [CrossRef]
- Koo, C.Y.; Muir, K.W.; Lam, E.W. FOXM1: From cancer initiation to progression and treatment. Biochim. Biophys. Acta 2012, 1819, 28–37. [Google Scholar] [CrossRef]
- Kalinichenko, V.V.; Major, M.L.; Wang, X.; Petrovic, V.; Kuechle, J.; Yoder, H.M.; Dennewitz, M.B.; Shin, B.; Datta, A.; Raychaudhuri, P.; et al. Foxm1b transcription factor is essential for development of hepatocellular carcinomas and is negatively regulated by the p19ARF tumor suppressor. Genes Dev. 2004, 18, 830–850. [Google Scholar] [CrossRef] [Green Version]
- Park, H.J.; Gusarova, G.; Wang, Z.; Carr, J.R.; Li, J.; Kim, K.H.; Qiu, J.; Park, Y.D.; Williamson, P.R.; Hay, N.; et al. Deregulation of FoxM1b leads to tumour metastasis. EMBO Mol. Med. 2011, 3, 21–34. [Google Scholar] [CrossRef]
- Gusarova, G.A.; Wang, I.C.; Major, M.L.; Kalinichenko, V.V.; Ackerson, T.; Petrovic, V.; Costa, R.H. A cell-penetrating ARF peptide inhibitor of FoxM1 in mouse hepatocellular carcinoma treatment. J. Clin. Investig. 2007, 117, 99–111. [Google Scholar] [CrossRef] [Green Version]
- Calvisi, D.F.; Pinna, F.; Ladu, S.; Pellegrino, R.; Simile, M.M.; Frau, M.; De Miglio, M.R.; Tomasi, M.L.; Sanna, V.; Muroni, M.R.; et al. Forkhead box M1B is a determinant of rat susceptibility to hepatocarcinogenesis and sustains ERK activity in human HCC. Gut 2009, 58, 679–687. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.; Müller, G.A.; Quaas, M.; Fischer, M.; Han, N.; Stutchbury, B.; Sharrocks, A.D.; Engeland, K. The forkhead transcription factor FOXM1 controls cell cycle-dependent gene expression through an atypical chromatin binding mechanism. Mol. Cell. Biol. 2013, 33, 227–236. [Google Scholar] [CrossRef] [Green Version]
- Dauch, D.; Rudalska, R.; Cossa, G.; Nault, J.C.; Kang, T.W.; Wuestefeld, T.; Hohmeyer, A.; Imbeaud, S.; Yevsa, T.; Hoenicke, L.; et al. A MYC—aurora kinase A protein complex represents an actionable drug target in p53-altered liver cancer. Nat. Med. 2016, 22, 744–753. [Google Scholar] [CrossRef]
- Holzer, K.; Ori, A.; Cooke, A.; Dauch, D.; Drucker, E.; Riemenschneider, P.; Andres-Pons, A.; DiGuilio, A.L.; Mackmull, M.T.; Baßler, J.; et al. Nucleoporin Nup155 is part of the p53 network in liver cancer. Nat. Commun. 2019, 10, 2147. [Google Scholar] [CrossRef]
- Weiler, S.M.; Pinna, F.; Wolf, T.; Lutz, T.; Geldiyev, A.; Sticht, C.; Knaub, M.; Thomann, S.; Bissinger, M.; Wan, S.; et al. Induction of Chromosome Instability by Activation of Yes Associated Protein and Forkhead box M1 in Liver Cancer. Gastroenterology 2017, 152, 2037–2051.e22. [Google Scholar] [CrossRef]
- Tang, Z.; Kang, B.; Li, C.; Chen, T.; Zhang, Z. GEPIA2: An enhanced web server for large-scale expression profiling and interactive analysis. Nucleic Acids Res. 2019, 47, W556–W560. [Google Scholar] [CrossRef] [Green Version]
- Roessler, S.; Jia, H.L.; Budhu, A.; Forgues, M.; Ye, Q.H.; Lee, J.S.; Thorgeirsson, S.S.; Sun, Z.; Tang, Z.Y.; Qin, L.X.; et al. A unique metastasis gene signature enables prediction of tumor relapse in early-stage hepatocellular carcinoma patients. Cancer Res. 2010, 70, 10202–10212. [Google Scholar] [CrossRef] [Green Version]
- Fischer, M. Census and evaluation of p53 target genes. Oncogene 2017, 36, 3943–3956. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Von Eyss, B.; Maaskola, J.; Memczak, S.; Möllmann, K.; Schuetz, A.; Loddenkemper, C.; Tanh, M.D.; Otto, A.; Muegge, K.; Heinemann, U.; et al. The SNF2-like helicase HELLS mediates E2F3-dependent transcription and cellular transformation. EMBO J. 2012, 31, 972–985. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Robinson, M.H.; Maximov, V.; Lallani, S.; Farooq, H.; Taylor, M.D.; Read, R.D.; Kenney, A.M. Upregulation of the chromatin remodeler HELLS is mediated by YAP1 in Sonic Hedgehog Medulloblastoma. Sci. Rep. 2019, 9, 13611. [Google Scholar] [CrossRef]
- Aksoy, O.; Chicas, A.; Zeng, T.; Zhao, Z.; McCurrach, M.; Wang, X.; Lowe, S.W. The atypical E2F family member E2F7 couples the p53 and RB pathways during cellular senescence. Genes Dev. 2012, 26, 1546–1557. [Google Scholar] [CrossRef] [Green Version]
- Carvajal, L.A.; Hamard, P.J.; Tonnessen, C.; Manfredi, J.J. E2F7, a novel target, is up-regulated by p53 and mediates DNA damage-dependent transcriptional repression. Genes Dev. 2012, 26, 1533–1545. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barsotti, A.M.; Prives, C. Pro-proliferative FoxM1 is a target of p53-mediated repression. Oncogene 2009, 28, 4295–4305. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chand, V.; Pandey, A.; Kopanja, D.; Guzman, G.; Raychaudhuri, P. Opposing Roles of the Forkhead Box Factors FoxM1 and FoxA2 in Liver Cancer. Mol. Cancer Res. 2019, 17, 1063–1074. [Google Scholar] [CrossRef] [Green Version]
- Kurahashi, T.; Yoshida, Y.; Ogura, S.; Egawa, M.; Furuta, K.; Hikita, H.; Kodama, T.; Sakamori, R.; Kiso, S.; Kamada, Y.; et al. Forkhead Box M1 Transcription Factor Drives Liver Inflammation Linking to Hepatocarcinogenesis in Mice. Cell. Mol. Gastroenterol. Hepatol. 2020, 9, 425–446. [Google Scholar] [CrossRef] [Green Version]
- Tian, C.; Wu, H.; Li, C.; Tian, X.; Sun, Y.; Liu, E.; Liao, X.; Song, W. Downregulation of FoxM1 by miR-214 inhibits proliferation and migration in hepatocellular carcinoma. Gene Therapy 2018, 25, 312–319. [Google Scholar] [CrossRef] [Green Version]
- Yan, D.; Yan, X.; Dai, X.; Chen, L.; Sun, L.; Li, T.; He, F.; Lian, J.; Cai, W. Activation of AKT/AP1/FoxM1 signaling confers sorafenib resistance to liver cancer cells. Oncol. Rep. 2019, 42, 785–796. [Google Scholar] [CrossRef] [PubMed]
- Takata, A.; Otsuka, M.; Kishikawa, T.; Yamagami, M.; Ishibashi, R.; Sekiba, K.; Suzuki, T.; Ohno, M.; Yamashita, Y.; Abe, T.; et al. RASAL1 is a potent regulator of hepatic stellate cell activity and liver fibrosis. Oncotarget 2017, 8, 64840–64852. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Calvisi, D.F.; Ladu, S.; Conner, E.A.; Seo, D.; Hsieh, J.T.; Factor, V.M.; Thorgeirsson, S.S. Inactivation of Ras GTPase-activating proteins promotes unrestrained activity of wild-type Ras in human liver cancer. J. Hepatol. 2011, 54, 311–319. [Google Scholar] [CrossRef] [Green Version]
- Jiang, Y.; Mao, C.; Yang, R.; Yan, B.; Shi, Y.; Liu, X.; Lai, W.; Liu, Y.; Wang, X.; Xiao, D.; et al. EGLN1/c-Myc Induced Lymphoid-Specific Helicase Inhibits Ferroptosis through Lipid Metabolic Gene Expression Changes. Theranostics 2017, 7, 3293–3305. [Google Scholar] [CrossRef] [PubMed]
- Johnson, R.F.; Perkins, N.D. Nuclear factor-κB, p53, and mitochondria: Regulation of cellular metabolism and the Warburg effect. Trends Biochem. Sci. 2012, 37, 317–324. [Google Scholar] [CrossRef]
- Mauro, C.; Leow, S.C.; Anso, E.; Rocha, S.; Thotakura, A.K.; Tornatore, L.; Moretti, M.; De Smaele, E.; Beg, A.A.; Tergaonkar, V.; et al. NF-κB controls energy homeostasis and metabolic adaptation by upregulating mitochondrial respiration. Nat. Cell Biol. 2011, 13, 1272–1279. [Google Scholar] [CrossRef]
- Holzer, K.; Drucker, E.; Roessler, S.; Dauch, D.; Heinzmann, F.; Waldburger, N.; Eiteneuer, E.M.; Herpel, E.; Breuhahn, K.; Zender, L.; et al. Proteomic Analysis Reveals GMP Synthetase as p53 Repression Target in Liver Cancer. Am. J. Pathol. 2017, 187, 228–235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.; Shi, Y.; Liu, N.; Wang, Z.; Yang, R.; Yan, B.; Liu, X.; Lai, W.; Liu, Y.; Xiao, D.; et al. DNA methylation modifier LSH inhibits p53 ubiquitination and transactivates p53 to promote lipid metabolism. Epigenet. Chromatin. 2019, 12, 59. [Google Scholar] [CrossRef] [PubMed]
- Johnson, R.A.; Ince, T.A.; Scotto, K.W. Transcriptional repression by p53 through direct binding to a novel DNA element. J. Biol. Chem. 2001, 276, 27716–27720. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, B.; Xiao, Z.; Ren, E.C. Redefining the p53 response element. Proc. Natl. Acad. Sci. USA 2009, 106, 14373–14378. [Google Scholar] [CrossRef] [Green Version]
- Chang, T.C.; Wentzel, E.A.; Kent, O.A.; Ramachandran, K.; Mullendore, M.; Lee, K.H.; Feldmann, G.; Yamakuchi, M.; Ferlito, M.; Lowenstein, C.J.; et al. Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol. Cell 2007, 26, 745–752. [Google Scholar] [CrossRef] [Green Version]
- Quaas, M.; Müller, G.A.; Engeland, K. p53 can repress transcription of cell cycle genes through a p21(WAF1/CIP1)-dependent switch from MMB to DREAM protein complex binding at CHR promoter elements. Cell Cycle 2012, 11, 4661–4672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tazawa, H.; Tsuchiya, N.; Izumiya, M.; Nakagama, H. Tumor-suppressive miR-34a induces senescence-like growth arrest through modulation of the E2F pathway in human colon cancer cells. Proc. Natl. Acad. Sci. USA 2007, 104, 15472–15477. [Google Scholar] [CrossRef] [Green Version]
- Böhlig, L.; Rother, K. One function—multiple mechanisms: The manifold activities of p53 as a transcriptional repressor. J. Biomed. Biotechnol. 2011, 2011, 464916. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Drucker, E.; Holzer, K.; Pusch, S.; Winkler, J.; Calvisi, D.F.; Eiteneuer, E.; Herpel, E.; Goeppert, B.; Roessler, S.; Ori, A.; et al. Karyopherin alpha2-dependent import of E2F1 and TFDP1 maintains protumorigenic stathmin expression in liver cancer. Cell Commun. Signal. 2019, 17, 159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Winkler, J.; Ori, A.; Holzer, K.; Sticht, C.; Dauch, D.; Eiteneuer, E.M.; Pinna, F.; Geffers, R.; Ehemann, V.; Andres-Pons, A.; et al. Prosurvival function of the cellular apoptosis susceptibility/importin-alpha1 transport cycle is repressed by p53 in liver cancer. Hepatology 2014, 60, 884–895. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.W.; Forrester, K.; Yeh, H.; Feitelson, M.A.; Gu, J.R.; Harris, C.C. Hepatitis B virus X protein inhibits p53 sequence-specific DNA binding, transcriptional activity, and association with transcription factor ERCC3. Proc. Natl. Acad. Sci. USA 1994, 91, 2230–2234. [Google Scholar] [CrossRef] [PubMed] [Green Version]
siRNA | Sequence |
---|---|
TP53/P53#1 | UGUUCCGAGAGCUGAAUGA |
TP53/P53#2 | AAGGAAAUUUGCGUGUGGAGU |
CDKN1A/P21#1 | CAGUUUGUGUGUCUUAAUUAU |
CDKN1A/P21#2 | CUGGCAUUAGAAUUAUUUAAA |
FOXM1#1 | AUAUUCACAGCAUCAUCAC |
FOXM1#2 | GGACCACUUUCCCUACUUU |
HELLS#1 | ATGCGATGGTACCAAGTAGAA |
HELLS#2 | AAACGGTTAGGCAGAATACTA |
Primer | Sequence |
---|---|
CDKN1A_F | GGCGGCAGACCAGCATGACAGATT |
CDKN1A_R | GCAGGGGGCGGCCAGGGTAT |
L32_F | TTCCTGGTCCACAAC |
L32_R | TGTGAGCGATCTCG |
HELLS_F | CAGCCATTGTGAACCGTACAA |
HELLS_R | TCTAGTTCGTCGTTTTGGTCG |
FOXM1_F | TGCCCAGATGTGCGCTATTA |
FOXM1_R | TCAATGCCAGTCTCCCTGGTA |
RAD54L_F | TCCTATGAGACCTTCCGCCT |
RAD54L_R | AGTTCTTGAGCCTGTGTCCC |
HLTF_F | GCTCCTCTTGTCATCCCACTCA |
HLTF_R | CGTCTTTGCTTAGTCCATCTGCCTT |
CHD1L_F | GGCATTCCAGACCCTCCAAA |
CHD1L_R | GCTCCAAAAAGTGTCGCTCC |
SMARCA5_F | AACTTACTATCCGTTGGCGATT |
SMARCA5_R | GGTTGCTTTGGAGCTTTCTG |
CHD1_F | CCTGGGACTCCACCTACAGA |
CHD1_R | TGGATTCCAGAAACGGAGGC |
CREB3L3_F | GGGCCAGTGATCCAAGTACC |
CREB3L3_R | AGATTGCATCGTGGGGACAG |
IGFBP3_F | TTCAGAGACTCGAGCACAGC |
IGFBP3_R | ACAGCCGCCTAAGTCACAAA |
XAF1_F | AGCAGGTTGGGTGTACGATG |
XAF1_R | CCTGGCACTCATTGGCCTTA |
HELLS_3′UTR_F | TCTTGGATACAGGCTGATGTGT |
HELLS_3′UTR_R | ACCTAAAGCCCATGAACTGC |
HELLS_CHR_F | CTCCAGTGCATCTCGGGTG |
HELLS_CHR_R | GTTCAACCATTGCTGGAGCCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schuller, S.; Sieker, J.; Riemenschneider, P.; Köhler, B.; Drucker, E.; Weiler, S.M.E.; Dauch, D.; Sticht, C.; Goeppert, B.; Roessler, S.; et al. HELLS Is Negatively Regulated by Wild-Type P53 in Liver Cancer by a Mechanism Involving P21 and FOXM1. Cancers 2022, 14, 459. https://doi.org/10.3390/cancers14020459
Schuller S, Sieker J, Riemenschneider P, Köhler B, Drucker E, Weiler SME, Dauch D, Sticht C, Goeppert B, Roessler S, et al. HELLS Is Negatively Regulated by Wild-Type P53 in Liver Cancer by a Mechanism Involving P21 and FOXM1. Cancers. 2022; 14(2):459. https://doi.org/10.3390/cancers14020459
Chicago/Turabian StyleSchuller, Stefanie, Jan Sieker, Philip Riemenschneider, Bianca Köhler, Elisabeth Drucker, Sofia M. E. Weiler, Daniel Dauch, Carsten Sticht, Benjamin Goeppert, Stephanie Roessler, and et al. 2022. "HELLS Is Negatively Regulated by Wild-Type P53 in Liver Cancer by a Mechanism Involving P21 and FOXM1" Cancers 14, no. 2: 459. https://doi.org/10.3390/cancers14020459
APA StyleSchuller, S., Sieker, J., Riemenschneider, P., Köhler, B., Drucker, E., Weiler, S. M. E., Dauch, D., Sticht, C., Goeppert, B., Roessler, S., Ribback, S., Breuhahn, K., Fend, F., Dombrowski, F., Singer, K., & Singer, S. (2022). HELLS Is Negatively Regulated by Wild-Type P53 in Liver Cancer by a Mechanism Involving P21 and FOXM1. Cancers, 14(2), 459. https://doi.org/10.3390/cancers14020459