Down-Regulation of the Proteoglycan Decorin Fills in the Tumor-Promoting Phenotype of Ionizing Radiation-Induced Senescent Human Breast Stromal Fibroblasts
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Chemicals
2.2. Cells, Cell Culture Conditions, Exposure to γ-Irradiation and Induction of Premature Senescence
2.3. Senescence-Associated β-Galactosidase (SA-β-Gal) Staining
2.4. SenTraGor Immunofluorescence Staining
2.5. Estimation of Cell Proliferation by 5-Bromo-2′-Deoxyuridine (BrdU) Incorporation
2.6. Total Protein Extraction, Preparation of Human Breast Stromal Fibroblast-Derived Extracellular Matrix (ECM) and Western Blot Analysis
2.7. Preparation of Cancer Cell Cultures’ Conditioned Media
2.8. Flow Cytometric Analysis
2.9. RNA Extraction and Reverse Transcription (RT)-Quantitative (q)PCR
2.10. Statistical Analysis
3. Results
3.1. Ionizing Radiation-Induced Prematurely Senescent Human Breast Stromal Fibroblasts Are Characterized by Decreased Decorin Expression
3.2. Decorin Down-Regulation in Senescent Human Breast Stromal Fibroblasts Is a Long-Term Supervention Rather Than an Immediate Response of the Cells to the Genotoxic Effect of Ionizing Radiation
3.3. Decorin mRNA Levels Are Decreased in Human Breast Stromal Fibroblasts as a Response to Exogenously Supplied Growth Factors
3.4. bFGF and VEGF Seem to Be the Main Negative Regulators of Decorin Expression in Human Breast Stromal Fibroblasts
3.5. VEGF Seems to Participate in Decorin Down-Regulation as Part of Its Intracrine Functions in Human Breast Stromal Fibroblasts
3.6. Autophagy Is Implicated in the Regulation of Decorin Expression in Human Breast Stromal Fibroblasts
3.7. Breast Cancer Cells Stimulate the Down-Regulation of Decorin in Young and Senescent Human Breast Stromal Fibroblasts in a Paracrine Manner
3.8. Ionizing Radiation Is Growth-Inhibitory for Breast Cancer Cells, But Does Not Alter Their Restraining Paracrine Effect on Human Breast Stromal Fibroblasts’ Decorin Expression
3.9. Inhibition of bFGF and VEGF Annuls the MDA-MB-231 Conditioned Medium-Induced Decorin Down-Regulation in Young and Senescent Human Breast Stromal Fibroblasts
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yang, V.; Gouveia, M.J.; Santos, J.; Koksch, B.; Amorim, I.; Gärtner, F.; Vale, N. Breast cancer: Insights in disease and influence of drug methotrexate. RSC Med. Chem. 2020, 11, 646–664. [Google Scholar] [PubMed]
- DeSantis, C.E.; Ma, J.; Gaudet, M.M.; Newman, L.A.; Miller, K.D.; Sauer, A.G.; Jemal, A.; Siegel, R.L. Breast cancer statistics, 2019. CA Cancer J. Clin. 2019, 69, 438–451. [Google Scholar] [PubMed]
- Li, S.J.; Chen, D.L.; Zhang, W.B.; Shen, C.; Che, G.W. Prognostic value of stromal decorin expression in patients with breast cancer: A meta-analysis. J. Thorac. Dis. 2015, 7, 1939–1950. [Google Scholar] [PubMed]
- Mavrogonatou, E.; Pratsinis, H.; Kletsas, D. The role of senescence in cancer development. Semin. Cancer Biol. 2020, 62, 182–191. [Google Scholar]
- Mavrogonatou, E.; Pratsinis, H.; Papadopoulou, A.; Karamanos, N.K.; Kletsas, D. Extracellular matrix alterations in senescent cells and their significance in tissue homeostasis. Matrix Biol. 2019, 75–76, 27–42. [Google Scholar]
- Manou, D.; Caon, I.; Bouris, P.; Triantaphyllidou, I.-E.; Giaroni, C.; Passi, A.; Karamanos, N.K.; Vigetti, D.; Theocharis, A.D. The Complex Interplay Between Extracellular Matrix and Cells in Tissues. Methods Mol. Biol. 2019, 1952, 1–20. [Google Scholar]
- Karamanos, N.K.; Theocharis, A.D.; Neill, T.; Iozzo, R.V. Matrix modeling and remodeling: A biological interplay regulating tissue homeostasis and diseases. Matrix Biol. 2019, 75–76, 1–11. [Google Scholar]
- Theocharis, A.D.; Karamanos, N.K. Proteoglycans remodeling in cancer: Underlying molecular mechanisms. Matrix Biol. 2019, 75–76, 220–259. [Google Scholar]
- Caon, I.; Bartolini, B.; Parnigoni, A.; Caravà, E.; Moretto, P.; Viola, M.; Karousou, E.; Vigetti, D.; Passi, A. Revisiting the hallmarks of cancer: The role of hyaluronan. Semin. Cancer Biol. 2020, 62, 9–19. [Google Scholar]
- Kenny, P.A.; Bissell, M.J. Tumor reversion: Correction of malignant behavior by microenvironmental cues. Int. J. Cancer 2003, 107, 688–695. [Google Scholar]
- Beacham, D.A.; Cukierman, E. Stromagenesis: The changing face of fibroblastic microenvironments during tumor progression. Semin. Cancer Biol. 2005, 15, 329–341. [Google Scholar] [PubMed]
- Bissell, M.J.; Radisky, D.C.; Rizki, A.; Weaver, V.M.; Petersen, O.W. The organizing principle: Microenvironmental influences in the normal and malignant breast. Differentiation 2002, 70, 537–546. [Google Scholar] [PubMed]
- Park, C.C.; Bissell, M.J.; Barcellos-Hoff, M.H. The influence of the microenvironment on the malignant phenotype. Mol. Med. Today 2000, 6, 324–329. [Google Scholar] [PubMed]
- Pietras, K.; Östman, A. Hallmarks of cancer: Interactions with the tumor stroma. Exp. Cell Res. 2010, 316, 1324–1331. [Google Scholar] [PubMed]
- Proia, D.A.; Kuperwasser, C. Stroma: Tumor agonist or antagonist. Cell Cycle 2005, 4, 1022–1025. [Google Scholar]
- Di Leonardo, A.; Linke, S.; Clarkin, K.; Wahl, G.M. DNA damage triggers a prolonged p53-dependent G1 arrest and long-term induction of Cip1 in normal human fibroblasts. Genes Dev. 1994, 8, 2540–2551. [Google Scholar]
- McKenna, W.G.; Muschel, R.J. Targeting tumor cells by enhancing radiation sensitivity. Genes Chromosomes Cancer 2003, 38, 330–338. [Google Scholar]
- Papadopoulou, A.; Kletsas, D. Human lung fibroblasts prematurely senescent after exposure to ionizing radiation enhance the growth of malignant lung epithelial cells in vitro and in vivo. Int. J. Oncol. 2011, 39, 989–999. [Google Scholar]
- Liakou, E.; Mavrogonatou, E.; Pratsinis, H.; Rizou, S.; Evangelou, K.; Panagiotou, P.N.; Karamanos, N.K.; Gorgoulis, V.G.; Kletsas, D. Ionizing radiation-mediated premature senescence and paracrine interactions with cancer cells enhance the expression of syndecan 1 in human breast stromal fibroblasts: The role of TGF-β. Aging (Albany NY) 2016, 8, 1650–1669. [Google Scholar]
- Hayflick, L.; Moorhead, P. The serial cultivation of human diploid cell strains. Exp. Cell Res. 1961, 25, 585–621. [Google Scholar]
- Campisi, J.; d’Adda di Fagagna, F. Cellular senescence: When bad things happen to good cells. Nat. Rev. Mol. Cell Biol. 2007, 8, 729–740. [Google Scholar]
- Shay, J.W.; Wright, W.E. Senescence and immortalization: Role of telomeres and telomerase. Carcinogenesis 2005, 26, 867–874. [Google Scholar]
- Toussaint, O.; Medrano, E.; von Zglinicki, T. Cellular and molecular mechanisms of stress-induced premature senescence (SIPS) of human diploid fibroblasts and melanocytes. Exp. Gerontol. 2000, 35, 927–945. [Google Scholar] [PubMed]
- Acosta, J.C.; Banito, A.; Wuestefeld, T.; Georgilis, A.; Janich, P.; Morton, J.P.; Athineos, D.; Kang, T.-W.; Lasitschka, F.; Andrulis, M.; et al. A complex secretory program orchestrated by the inflammasome controls paracrine senescence. Nat. Cell Biol. 2013, 15, 978–990. [Google Scholar] [CrossRef] [Scilit]
- Krtolica, A.; Parrinello, S.; Lockett, S.; Desprez, P.-Y.; Campisi, J. Senescent fibroblasts promote epithelial cell growth and tumorigenesis: A link between cancer and aging. Proc. Natl. Acad. Sci. USA 2001, 98, 12072–12077. [Google Scholar] [PubMed]
- Liu, D.; Hornsby, P.J. Senescent human fibroblasts increase the early growth of xenograft tumors via matrix metalloproteinase secretion. Cancer Res. 2007, 67, 3117–3126. [Google Scholar] [PubMed]
- Karamanos, N.K.; Piperigkou, Z.; Theocharis, A.D.; Watanabe, H.; Franchi, M.; Baud, S.; Brézillon, S.; Götte, M.; Passi, A.; Vigetti, D.; et al. Proteoglycan Chemical Diversity Drives Multifunctional Cell Regulation and Therapeutics. Chem. Rev. 2018, 118, 9152–9232. [Google Scholar] [PubMed]
- Iozzo, R.V.; Sanderson, R.D. Proteoglycans in cancer biology, tumour microenvironment and angiogenesis. J. Cell Mol. Med. 2011, 15, 1013–1031. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Theocharis, A.D.; Skandalis, S.S.; Tzanakakis, G.N.; Karamanos, N.K. Proteoglycans in health and disease: Novel roles for proteoglycans in malignancy and their pharmacological targeting. Febs J. 2010, 277, 3904–3923. [Google Scholar]
- Goldoni, S.; Iozzo, R.V. Tumor microenvironment: Modulation by decorin and related molecules harboring leucine-rich tandem motifs. Int. J. Cancer 2008, 123, 2473–2479. [Google Scholar]
- Neill, T.; Schaefer, L.; Iozzo, R.V. Decorin as a multivalent therapeutic agent against cancer. Adv. Drug Deliv. Rev. 2016, 97, 174–185. [Google Scholar] [PubMed]
- Schaefer, L.; Iozzo, R.V. Biological functions of the small leucine-rich proteoglycans: From genetics to signal transduction. J. Biol. Chem. 2008, 283, 21305–21309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iozzo, R.V.; Schaefer, L. Proteoglycans in health and disease: Novel regulatory signaling mechanisms evoked by the small leucine-rich proteoglycans. Febs J. 2010, 277, 3864–3875. [Google Scholar] [CrossRef] [Scilit]
- Iozzo, R.V.; Schaefer, L. Proteoglycan form and function: A comprehensive nomenclature of proteoglycans. Matrix Biol. 2015, 42, 11–55. [Google Scholar] [PubMed]
- Neill, T.; Schaefer, L.; Iozzo, R.V. Decorin: A guardian from the matrix. Am. J. Pathol. 2012, 181, 380–387. [Google Scholar] [CrossRef] [Scilit]
- Järveläinen, H.; Sainio, A.; Wight, T.N. Pivotal role for decorin in angiogenesis. Matrix Biol. 2015, 43, 15–26. [Google Scholar] [CrossRef] [Scilit]
- Neill, T.; Schaefer, L.; Iozzo, R.V. Instructive roles of extracellular matrix on autophagy. Am. J. Pathol. 2014, 184, 2146–2153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buraschi, S.; Neill, T.; Goyal, A.; Poluzzi, C.; Smythies, J.; Owens, R.T.; Schaefer, L.; Torres, A.; Iozzo, R.V. Decorin causes autophagy in endothelial cells via Peg3. Proc. Natl. Acad. Sci. USA 2013, 110, E2582–E2591. [Google Scholar] [CrossRef] [Scilit]
- Buraschi, S.; Neill, T.; Iozzo, R.V. Decorin is a devouring proteoglycan: Remodeling of intracellular catabolism via autophagy and mitophagy. Matrix Biol. 2019, 75–76, 260–270. [Google Scholar]
- Hu, X.; Villodre, E.S.; Larson, R.; Rahal, O.M.; Wang, X.; Gong, Y.; Song, J.; Krishnamurthy, S.; Ueno, N.T.; Tripathy, D.; et al. Decorin-mediated suppression of tumorigenesis, invasion, and metastasis in inflammatory breast cancer. Commun. Biol. 2021, 4, 72. [Google Scholar] [CrossRef] [Scilit]
- Kouroumalis, A.; Mavrogonatou, E.; Savvidou, O.D.; Papagelopoulos, P.J.; Pratsinis, H.; Kletsas, D. Major traits of the senescent phenotype of nucleus pulposus intervertebral disc cells persist under the specific microenvironmental conditions of the tissue. Mech. Ageing Dev. 2019, 177, 118–127. [Google Scholar] [CrossRef] [Scilit]
- Dimozi, A.; Mavrogonatou, E.; Sklirou, A.; Kletsas, D. Oxidative stress inhibits the proliferation, induces premature senescence and promotes a catabolic phenotype in human nucleus pulposus intervertebral disc cells. Eur. Cell Mater. 2015, 30, 89–102, discussion 103. [Google Scholar] [CrossRef] [Scilit]
- Evangelou, K.; Lougiakis, N.; Rizou, S.V.; Kotsinas, A.; Kletsas, D.; Muñoz-Espín, D.; Kastrinakis, N.G.; Pouli, N.; Marakos, P.; Townsend, P.A.; et al. Robust, universal biomarker assay to detect senescent cells in biological specimens. Aging Cell 2017, 16, 192–197. [Google Scholar] [CrossRef] [Scilit]
- Mavrogonatou, E.; Kletsas, D. High osmolality activates the G1 and G2 cell cycle checkpoints and affects the DNA integrity of nucleus pulposus intervertebral disc cells triggering an enhanced DNA repair response. DNA Repair Amst. 2009, 8, 930–943. [Google Scholar] [CrossRef] [Scilit]
- Taipale, J.; Miyazono, K.; Heldin, C.H.; Keski-Oja, J. Latent transforming growth factor-beta 1 associates to fibroblast extracellular matrix via latent TGF-beta binding protein. J. Cell Biol. 1994, 124, 171–181. [Google Scholar] [CrossRef] [Scilit]
- Bourkoula, A.; Mavrogonatou, E.; Pavli, P.; Petrou, P.S.; Douvas, A.M.; Argitis, P.; Kletsas, D.; Kakabakos, S. Guided cell adhesion, orientation, morphology and differentiation on silicon substrates photolithographically micropatterned with a cell-repellent cross-linked poly(vinyl alcohol) film. Biomed. Mater. 2018, 14, 014101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vamvakas, S.-S.; Mavrogonatou, E.; Kletsas, D. Human nucleus pulposus intervertebral disc cells becoming senescent using different treatments exhibit a similar transcriptional profile of catabolic and inflammatory genes. Eur. Spine J. 2017, 26, 2063–2071. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gubbiotti, M.A.; Neill, T.; Frey, H.; Schaefer, L.; Iozzo, R.V. Decorin is an autophagy-inducible proteoglycan and is required for proper in vivo autophagy. Matrix Biol. 2015, 48, 14–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aukes, K.; Forsman, C.; Brady, N.J.; Astleford, K.; Blixt, N.; Sachdev, D.; Jensen, E.D.; Mansky, K.C.; Schwertfeger, K.L. Breast cancer cell-derived fibroblast growth factors enhance osteoclast activity and contribute to the formation of metastatic lesions. PLoS ONE 2017, 12, e0185736. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhowmick, N.A.; Neilson, E.G.; Moses, H.L. Stromal fibroblasts in cancer initiation and progression. Nature 2004, 432, 332–337. [Google Scholar]
- Elenbaas, B.; Weinberg, R.A. Heterotypic signaling between epithelial tumor cells and fibroblasts in carcinoma formation. Exp. Cell Res. 2001, 264, 169–184. [Google Scholar] [PubMed]
- Kalluri, R.; Zeisberg, M. Fibroblasts in cancer. Nat. Rev. Cancer 2006, 6, 392–401. [Google Scholar]
- Kiaris, G.T.A.A.G.P.H.; Trimis, G.; Papavassiliou, A.G. Regulation of tumor-stromal fibroblast interactions: Implications in anticancer therapy. Curr. Med. Chem. 2008, 15, 3062–3067. [Google Scholar] [PubMed]
- Arendt, L.M.; Rudnick, J.A.; Keller, P.J.; Kuperwasser, C. Stroma in breast development and disease. Semin. Cell Dev. Biol. 2010, 21, 11–18. [Google Scholar] [PubMed]
- Ronnov-Jessen, L.; Petersen, O.W.; Bissell, M.J. Cellular changes involved in conversion of normal to malignant breast: Importance of the stromal reaction. Physiol. Rev. 1996, 76, 69–125. [Google Scholar] [PubMed]
- Bissell, M.J.; Radisky, D. Putting tumours in context. Nat. Rev. Cancer 2001, 1, 46–54. [Google Scholar]
- Clarke, M.; Collins, R.; Darby, S.; Elphinstone, D.C.; Evans, V.; Godwin, J.; Gray, R.; Hicks, C.; James, S.; MacKinnon, E.; et al. Effects of radiotherapy and of differences in the extent of surgery for early breast cancer on local recurrence and 15-year survival: An overview of the randomised trials. Lancet 2005, 366, 2087–2106. [Google Scholar]
- Barcellos-Hoff, M.H.; Ravani, S.A. Irradiated mammary gland stroma promotes the expression of tumorigenic potential by unirradiated epithelial cells. Cancer Res. 2000, 60, 1254–1260. [Google Scholar]
- Halazonetis, T.D.; Gorgoulis, V.G.; Bartek, J. An oncogene-induced DNA damage model for cancer development. Science 2008, 319, 1352–1355. [Google Scholar]
- Pare, R.; Yang, T.; Shin, J.-S.; Lee, C.S. The significance of the senescence pathway in breast cancer progression. J. Clin. Pathol. 2013, 66, 491–495. [Google Scholar]
- Krtolica, A.; Campisi, J. Cancer and aging: A model for the cancer promoting effects of the aging stroma. Int. J. Biochem. Cell Biol. 2002, 34, 1401–1414. [Google Scholar] [PubMed]
- Coppé, J.-P.; Patil, C.K.; Rodier, F.; Sun, Y.; Muñoz, D.P.; Goldstein, J.N.; Nelson, P.S.; Desprez, P.-Y.; Campisi, J. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 2008, 6, 2853–2868. [Google Scholar] [PubMed]
- Coppé, J.-P.; Desprez, P.-Y.; Krtolica, A.; Campisi, J. The senescence-associated secretory phenotype: The dark side of tumor suppression. Annu. Rev. Pathol. 2010, 5, 99–118. [Google Scholar]
- Boström, P.; Sainio, A.; Kakko, T.; Savontaus, M.; Söderström, M.; Järveläinen, H. Localization of decorin gene expression in normal human breast tissue and in benign and malignant tumors of the human breast. Histochem. Cell Biol. 2013, 139, 161–171. [Google Scholar]
- Leygue, E.; Snell, L.; Dotzlaw, H.; Hole, K.; Hiller-Hitchcock, T.; Roughley, P.J.; Watson, P.H.; Murphy, L.C. Expression of lumican in human breast carcinoma. Cancer Res. 1998, 58, 1348–1352. [Google Scholar] [PubMed]
- Leygue, E.; Snell, L.; Dotzlaw, H.; Troup, S.; Hiller-Hitchcock, T.; Murphy, L.C.; Roughley, P.J.; Watson, P.H. Lumican and decorin are differentially expressed in human breast carcinoma. J. Pathol. 2000, 192, 313–320. [Google Scholar]
- Boström, P.; Sainio, A.; Eigėlienė, N.; Jokilammi, A.; Elenius, K.; Koskivuo, I.; Järveläinen, H. Human Metaplastic Breast Carcinoma and Decorin. Cancer Microenviron. 2017, 10, 39–48. [Google Scholar]
- Alowami, S.; Troup, S.; Al-Haddad, S.; Kirkpatrick, I.; Watson, P.H. Mammographic density is related to stroma and stromal proteoglycan expression. Breast Cancer Res. 2003, 5, R129–R135. [Google Scholar]
- Iozzo, R.V.; Chakrani, F.; Perrotti, D.; McQuillan, D.J.; Skorski, T.; Calabretta, B.; Eichstetter, I. Cooperative action of germ-line mutations in decorin and p53 accelerates lymphoma tumorigenesis. Proc. Natl. Acad. Sci. USA 1999, 96, 3092–3097. [Google Scholar]
- Järvinen, T.A.H.; Prince, S. Decorin: A Growth Factor Antagonist for Tumor Growth Inhibition. Biomed. Res. Int. 2015, 2015, 654765. [Google Scholar]
- Baghy, K.; Horváth, Z.; Regős, E.; Kiss, K.; Schaff, Z.; Iozzo, R.V.; Kovalszky, I. Decorin interferes with platelet-derived growth factor receptor signaling in experimental hepatocarcinogenesis. Febs J. 2013, 280, 2150–2164. [Google Scholar]
- Feugaing, D.D.S.; Götte, M.; Viola, M. More than matrix: The multifaceted role of decorin in cancer. Eur. J. Cell Biol. 2013, 92, 1–11. [Google Scholar]
- Neill, T.; Painter, H.; Buraschi, S.; Owens, R.T.; Lisanti, M.; Schaefer, L.; Iozzo, R.V. Decorin antagonizes the angiogenic network: Concurrent inhibition of Met, hypoxia inducible factor 1α, vascular endothelial growth factor A, and induction of thrombospondin-1 and TIMP3. J. Biol. Chem. 2012, 287, 5492–5506. [Google Scholar]
- Seidler, D.G.; Goldoni, S.; Agnew, C.; Cardi, C.; Thakur, M.L.; Owens, R.T.; McQuillan, D.J.; Iozzo, R.V. Decorin protein core inhibits in vivo cancer growth and metabolism by hindering epidermal growth factor receptor function and triggering apoptosis via caspase-3 activation. J. Biol. Chem. 2006, 281, 26408–26418. [Google Scholar] [PubMed]
- Neill, T.; Torres, A.; Buraschi, S.; Owens, R.T.; Hoek, J.B.; Baffa, R.; Iozzo, R.V. Decorin induces mitophagy in breast carcinoma cells via peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) and mitostatin. J. Biol. Chem. 2014, 289, 4952–4968. [Google Scholar] [PubMed]
- Reed, C.C.; Waterhouse, A.; Kirby, S.; Kay, P.; Owens, R.T.; McQuillan, D.J.; Iozzo, R.V. Decorin prevents metastatic spreading of breast cancer. Oncogene 2005, 24, 1104–1110. [Google Scholar]
- Troup, S.; Njue, C.; Kliewer, E.V.; Parisien, M.; Roskelley, C.; Chakravarti, S.; Roughley, P.J.; Murphy, L.C.; Watson, P.H. Reduced expression of the small leucine-rich proteoglycans, lumican, and decorin is associated with poor outcome in node-negative invasive breast cancer. Clin. Cancer Res. 2003, 9, 207–214. [Google Scholar]
- Li, Y.; Liu, Y.; Xia, W.; Lei, D.; Voorhees, J.J.; Fisher, G.J. Age-dependent alterations of decorin glycosaminoglycans in human skin. Sci. Rep. 2013, 3, 2422. [Google Scholar]
- Tsai, K.K.; Chuang, E.Y.-Y.; Little, J.B.; Yuan, Z.-M. Cellular mechanisms for low-dose ionizing radiation-induced perturbation of the breast tissue microenvironment. Cancer Res. 2005, 65, 6734–6744. [Google Scholar] [PubMed]
- Parrinello, S.; Coppe, J.-P.; Krtolica, A.; Campisi, J. Stromal-epithelial interactions in aging and cancer: Senescent fibroblasts alter epithelial cell differentiation. J. Cell Sci. 2005, 118, 485–496. [Google Scholar] [PubMed]
- Sieuwerts, A.; Vries, J.B.-D.; Bosma, P.; Swiggers, S.; Klijn, J.; Foekens, J.; Martens, J. Aging of stromal-derived human breast fibroblasts might contribute to breast cancer progression. Thromb Haemost 2003, 89, 393–404. [Google Scholar]
- Vuillermoz, B.; Wegrowski, Y.; Contet-Audonneau, J.-L.; Danoux, L.; Pauly, G.; Maquart, F.-X. Influence of aging on glycosaminoglycans and small leucine-rich proteoglycans production by skin fibroblasts. Mol. Cell Biochem. 2005, 277, 63–72. [Google Scholar] [PubMed]
- Binet, R.; Ythier, D.; Robles, A.I.; Collado, M.; Larrieu, D.; Fonti, C.; Brambilla, E.; Brambilla, C.; Serrano, M.; Harris, C.C.; et al. WNT16B is a new marker of cellular senescence that regulates p53 activity and the phosphoinositide 3-kinase/AKT pathway. Cancer Res. 2009, 69, 9183–9191. [Google Scholar]
- Stamov, D.R.; Müller, A.; Wegrowski, Y.; Brezillon, S.; Franz, C.M. Quantitative analysis of type I collagen fibril regulation by lumican and decorin using AFM. J. Struct. Biol. 2013, 183, 394–403. [Google Scholar] [PubMed]
- Pietraszek-Gremplewicz, K.; Karamanou, K.; Niang, A.; Dauchez, M.; Belloy, N.; Maquart, F.-X.; Baud, S.; Brézillon, S. Small leucine-rich proteoglycans and matrix metalloproteinase-14: Key partners? Matrix Biol. 2019, 75–76, 271–285. [Google Scholar]
- Bakshi, M.V.; Barjaktarovic, Z.; Azimzadeh, O.; Kempf, S.J.; Merl, J.; Hauck, S.M.; Eriksson, P.; Buratovic, S.; Atkinson, M.J.; Tapio, S. Long-term effects of acute low-dose ionizing radiation on the neonatal mouse heart: A proteomic study. Radiat. Environ. Biophys. 2013, 52, 451–461. [Google Scholar]
- Aravindan, N.; Aravindan, S.; Manickam, K.; Natarajan, M. High Energy Particle Radiation-associated Oncogenic Transformation in Normal Mice: Insight into the Connection between Activation of Oncotargets and Oncogene Addiction. Sci. Rep. 2016, 6, 37623. [Google Scholar]
- Osborne, C.K.; Ross, C.R.; Coronado, E.B.; Fuqua, S.A.W.; Kitten, L.J. Secreted growth factors from estrogen receptor-negative human breast cancer do not support growth of estrogen receptor-positive breast cancer in the nude mouse model. Breast Cancer Res. Treat 1988, 11, 211–219. [Google Scholar]
- Fang, J.; Huang, S.; Liu, H.; Crepin, M.; Xu, T.; Liu, J. Role of FGF-2/FGFR signaling pathway in cancer and its signification in breast cancer. Chin. Sci. Bull. 2003, 48, 1539–1547. [Google Scholar]
- Schmidt, A.; Lorkowski, S.; Seidler, D.; Breithardt, G.; Buddecke, E. TGF-beta1 generates a specific multicomponent extracellular matrix in human coronary SMC. Eur. J. Clin. Investig. 2006, 36, 473–482. [Google Scholar]
- Yamada, T.; Kamiya, N.; Harada, D.; Takagi, M. Effects of transforming growth factor-beta1 on the gene expression of decorin, biglycan, and alkaline phosphatase in osteoblast precursor cells and more differentiated osteoblast cells. Histochem. J. 1999, 31, 687–694. [Google Scholar]
- Takagi, M.; Yamada, T.; Kamiya, N.; Kumagai, T.; Yamaguchi, A. Effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of decorin and biglycan by cultured osteoblastic cells. Histochem. J. 1999, 31, 403–409. [Google Scholar]
- Li, X.; McFarland, D.C.; Velleman, S.G. Effect of transforming growth factor-beta on decorin and beta1 integrin expression during muscle development in chickens. Poult Sci. 2006, 85, 326–332. [Google Scholar]
- Kähäri, V.-M.; Häkkinen, L.; Westermarck, J.; Larjava, H. Differential regulation of decorin and biglycan gene expression by dexamethasone and retinoic acid in cultured human skin fibroblasts. J. Investig. Dermatol. 1995, 104, 503–508. [Google Scholar]
- Mauviel, A.; Santra, M.; Chen, Y.Q.; Uitto, J.; Iozzo, R.V. Transcriptional regulation of decorin gene expression. Induction by quiescence and repression by tumor necrosis factor-alpha. J. Biol. Chem. 1995, 270, 11692–11700. [Google Scholar] [PubMed]
- Van Bockstal, M.; Lambein, K.; Van Gele, M.; De Vlieghere, E.; Limame, R.; Braems, G.; Broecke, R.V.D.; Cocquyt, V.; Denys, H.; Bracke, M.; et al. Differential regulation of extracellular matrix protein expression in carcinoma-associated fibroblasts by TGF-β1 regulates cancer cell spreading but not adhesion. Oncoscience 2014, 1, 634–648. [Google Scholar]
- Schönherr, E.; Järveläinen, H.T.; Kinsella, M.G.; Sandell, L.J.; Wight, T.N. Platelet-derived growth factor and transforming growth factor-beta 1 differentially affect the synthesis of biglycan and decorin by monkey arterial smooth muscle cells. Arterioscler Thromb. 1993, 13, 1026–1036. [Google Scholar] [PubMed]
- Tan, E.M.; Hoffren, J.; Rouda, S.; Greenbaum, S.; Fox, J.W.t.; Moore, J.H., Jr.; Dodge, G.R. Decorin, versican, and biglycan gene expression by keloid and normal dermal fibroblasts: Differential regulation by basic fibroblast growth factor. Exp. Cell Res. 1993, 209, 200–207. [Google Scholar] [PubMed]
- Sonal, D. Prevention of IGF-1 and TGFbeta stimulated type II collagen and decorin expression by bFGF and identification of IGF-1 mRNA transcripts in articular chondrocytes. Matrix Biol. 2001, 20, 233–242. [Google Scholar]
- Mansukhani, A.; Ambrosetti, D.; Holmes, G.; Cornivelli, L.; Basilico, C. Sox2 induction by FGF and FGFR2 activating mutations inhibits Wnt signaling and osteoblast differentiation. J. Cell Biol. 2005, 168, 1065–1076. [Google Scholar]
- Neill, T.; Sharpe, C.; Owens, R.T.; Iozzo, R.V. Decorin-evoked paternally expressed gene 3 (PEG3) is an upstream regulator of the transcription factor EB (TFEB) in endothelial cell autophagy. J. Biol. Chem. 2017, 292, 16211–16220. [Google Scholar] [PubMed]
- Wiszniak, S.; Schwarz, Q. Exploring the Intracrine Functions of VEGF-A. Biomolecules 2021, 11, 128. [Google Scholar]
- Zhong, X.-S.; Zheng, J.Z.; Reed, E.; Jiang, B.-H. SU5416 inhibited VEGF and HIF-1alpha expression through the PI3K/AKT/p70S6K1 signaling pathway. Biochem. Biophys. Res. Commun. 2004, 324, 471–480. [Google Scholar] [PubMed]
- Claffey, K.P.; Abrams, K.; Shih, S.-C.; Brown, L.F.; Mullen, A.; Keough, M. Fibroblast growth factor 2 activation of stromal cell vascular endothelial growth factor expression and angiogenesis. Lab. Investig. 2001, 81, 61–75. [Google Scholar] [PubMed]
- Coppé, J.-P.; Kauser, K.; Campisi, J.; Beauséjour, C.M. Secretion of vascular endothelial growth factor by primary human fibroblasts at senescence. J. Biol. Chem. 2006, 281, 29568–29574. [Google Scholar] [PubMed]
- Gewirtz, D.A. Autophagy and senescence: A partnership in search of definition. Autophagy 2013, 9, 808–812. [Google Scholar]
- Kwon, Y.; Kim, J.W.; Jeoung, J.A.; Kim, M.-S.; Kang, A.C. Autophagy Is Pro-Senescence When Seen in Close-Up, but Anti-Senescence in Long-Shot. Mol. Cells 2017, 40, 607–612. [Google Scholar]
- Subik, K.; Lee, J.-F.; Baxter, L.; Strzepek, T.; Costello, D.; Crowley, P.; Xing, L.; Hung, M.-C.; Bonfiglio, T.; Hicks, D.G.; et al. The Expression Patterns of ER, PR, HER2, CK5/6, EGFR, Ki-67 and AR by Immunohistochemical Analysis in Breast Cancer Cell Lines. Breast Cancer Auckl. 2010, 4, 35–41. [Google Scholar]
- Dai, X.; Cheng, H.; Bai, Z.; Li, J. Breast Cancer Cell Line Classification and Its Relevance with Breast Tumor Subtyping. J. Cancer 2017, 8, 3131–3141. [Google Scholar]
- Reszegi, A.; Horváth, Z.; Fehér, H.; Wichmann, B.; Tátrai, P.; Kovalszky, I.; Baghy, K. Protective Role of Decorin in Primary Hepatocellular Carcinoma. Front Oncol. 2020, 10, 645. [Google Scholar]
- Stott, F.J.; Bates, S.; James, M.C.; McConnell, B.B.; Starborg, M.; Brookes, S.M.; Palmero, I.; Ryan, K.M.; Hara, E.; Vousden, K.H.; et al. The alternative product from the human CDKN2A locus, p14(ARF), participates in a regulatory feedback loop with p53 and MDM2. Embo J. 1998, 17, 5001–5014. [Google Scholar] [PubMed]
- Mason, J.M.; Lin, D.C.; Wei, X.; Che, Y.; Yao, Y.; Kiarash, R.; Cescon, D.W.; Fletcher, G.C.; Awrey, D.E.; Bray, M.R.; et al. Functional characterization of CFI-400945, a Polo-like kinase 4 inhibitor, as a potential anticancer agent. Cancer Cell 2014, 26, 163–176. [Google Scholar]
- Wilson, E.N.; Bristol, M.L.; Di, X.; Maltese, W.A.; Koterba, K.; Beckman, M.J.; Gewirtz, D.A. A switch between cytoprotective and cytotoxic autophagy in the radiosensitization of breast tumor cells by chloroquine and vitamin D. Horm. Cancer 2011, 2, 272–285. [Google Scholar] [PubMed]
- Heravi, M.; Rachid, Z.; Goudarzi, A.; Schlisser, A.; Jean-Claude, B.J.; Radzioch, D.; Muanza, T.M. Interaction of ionizing radiation and ZRBA1, a mixed EGFR/DNA-targeting molecule. Anticancer. Drugs 2009, 20, 659–667. [Google Scholar]
- Lamas, D.J.M.; Cortina, J.E.; Ventura, C.; Sterle, H.A.; Valli, E.; Balestrasse, K.B.; Blanco, H.; Cremaschi, G.A.; Rivera, E.S.; Medina, V.A. Enhancement of ionizing radiation response by histamine in vitro and in vivo in human breast cancer. Cancer Biol. Ther. 2015, 16, 137–148. [Google Scholar]
- Li, D.; Xie, K.; Zhang, L.; Yao, X.; Li, H.; Xu, Q.; Wang, X.; Jiang, J.; Fang, J. Dual blockade of vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (FGF-2) exhibits potent anti-angiogenic effects. Cancer Lett. 2016, 377, 164–173. [Google Scholar]
- Mefford, D.; Mefford, J. Stromal genes add prognostic information to proliferation and histoclinical markers: A basis for the next generation of breast cancer gene signatures. PLoS ONE 2012, 7, e37646. [Google Scholar]
- Oda, G.; Sato, T.; Ishikawa, T.; Kawachi, H.; Nakagawa, T.; Kuwayama, T.; Ishiguro, M.; Iida, S.; Uetake, H.; Sugihara, K. Significance of stromal decorin expression during the progression of breast cancer. Oncol. Rep. 2012, 28, 2003–2008. [Google Scholar]
- Yang, Y.; Xu, W.; Neill, T.; Hu, Z.; Wang, C.-H.; Xiao, X.; Stock, S.R.; Guise, T.; Yun, C.-O.; Brendler, C.B.; et al. Systemic Delivery of an Oncolytic Adenovirus Expressing Decorin for the Treatment of Breast Cancer Bone Metastases. Hum. Gene Ther. 2015, 26, 813–825. [Google Scholar]
- Yamaguchi, Y.; Mann, D.M.; Ruoslahti, E. Negative regulation of transforming growth factor-beta by the proteoglycan decorin. Nature 1990, 346, 281–284. [Google Scholar] [PubMed]










| Target Gene | Forward Primer | Reverse Primer |
|---|---|---|
| p16INK4a | TAGTTACGGTCGGAGGCCGAT | GCACGGGTCGGGTGAGAG |
| p21WAF1 | CTGGAGACTCTCAGGGTCGAA | CCAGGACTGCAGGGTTCCT |
| dcn | CCTGATGACCGCGACTTCGAG | TTTGGCACTTTGTCCAGACCC |
| vegf | CCTCCGAAACCATGAACTTT | TTCTTTGGTCTGCATTCACATT |
| gapdh | GAGTCCACTGGCGTCTTC | GCATTGCTGATGATCTTGAGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mavrogonatou, E.; Papadopoulou, A.; Fotopoulou, A.; Tsimelis, S.; Bassiony, H.; Yiacoumettis, A.M.; Panagiotou, P.N.; Pratsinis, H.; Kletsas, D. Down-Regulation of the Proteoglycan Decorin Fills in the Tumor-Promoting Phenotype of Ionizing Radiation-Induced Senescent Human Breast Stromal Fibroblasts. Cancers 2021, 13, 1987. https://doi.org/10.3390/cancers13081987
Mavrogonatou E, Papadopoulou A, Fotopoulou A, Tsimelis S, Bassiony H, Yiacoumettis AM, Panagiotou PN, Pratsinis H, Kletsas D. Down-Regulation of the Proteoglycan Decorin Fills in the Tumor-Promoting Phenotype of Ionizing Radiation-Induced Senescent Human Breast Stromal Fibroblasts. Cancers. 2021; 13(8):1987. https://doi.org/10.3390/cancers13081987
Chicago/Turabian StyleMavrogonatou, Eleni, Adamantia Papadopoulou, Asimina Fotopoulou, Stathis Tsimelis, Heba Bassiony, Andreas M. Yiacoumettis, Petros N. Panagiotou, Harris Pratsinis, and Dimitris Kletsas. 2021. "Down-Regulation of the Proteoglycan Decorin Fills in the Tumor-Promoting Phenotype of Ionizing Radiation-Induced Senescent Human Breast Stromal Fibroblasts" Cancers 13, no. 8: 1987. https://doi.org/10.3390/cancers13081987
APA StyleMavrogonatou, E., Papadopoulou, A., Fotopoulou, A., Tsimelis, S., Bassiony, H., Yiacoumettis, A. M., Panagiotou, P. N., Pratsinis, H., & Kletsas, D. (2021). Down-Regulation of the Proteoglycan Decorin Fills in the Tumor-Promoting Phenotype of Ionizing Radiation-Induced Senescent Human Breast Stromal Fibroblasts. Cancers, 13(8), 1987. https://doi.org/10.3390/cancers13081987

