Breast Cancer Patient Prognosis Is Determined by the Interplay between TP53 Mutation and Alternative Transcript Expression: Insights from TP53 Long Amplicon Digital PCR Assays
Abstract
:Simple Summary
Abstract
1. Introduction
2. Results
2.1. A Cohort of New Zealand Breast Cancers Has a High Proportion of TP53 Splicing Mutations
2.2. Detailed Analysis of TP53 Splicing Mutations and Their Consequences on RNA Transcript Expression
2.3. TP53 Intron 4 Splice Mutations Are a Mechanism to Overexpress ∆133TP53 Transcripts
2.4. Analysis of All TP53 Reference Transcripts in New Zealand Breast Cancer Cohort
2.4.1. Quantitation of ∆40p53-Encoding Transcripts
2.4.2. Association of TP53 Mutation Type with Expression of Individual TP53 RNA Transcripts
2.5. TP53 Information Is Associated with Clinical and Pathological Features
2.6. TP53 Mutation Status and t2/t1 Transcript Ratio Are Associated with Breast Cancer Patient Outcome
3. Discussion
4. Materials and Methods
4.1. Patient Samples and Human Ethics
4.2. TP53 Gene Sequencing
4.3. Digital PCR Assays
4.3.1. Long Amplicon ddPCR Methodology
4.3.2. Long Amplicon ddPCR Assays to Detect TP53 RNAs Expressed in Tumors with TP53 Gene Splice Site Mutations
4.3.3. Long Amplicon Multiplex ddPCR Assay to Quantitate the TP53 t8 Transcripts
4.4. Bioinformatics and Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kandoth, C.; McLellan, M.D.; Vandin, F.; Ye, K.; Niu, B.; Lu, C.; Xie, M.; Zhang, Q.; McMichael, J.F.; Wyczalkowski, M.A.; et al. Mutational landscape and significance across 12 major cancer types. Nature 2013, 502, 333–339. [Google Scholar] [CrossRef] [Green Version]
- Bouaoun, L.; Sonkin, D.; Ardin, M.; Hollstein, M.; Byrnes, G.; Zavadil, J.; Olivier, M. TP53Variations in Human Cancers: New Lessons from the IARC TP53 Database and Genomics Data. Hum. Mutat. 2016, 37, 865–876. [Google Scholar] [CrossRef]
- Pereira, B.; Chin, S.-F.; Rueda, O.M.; Vollan, H.-K.M.; Provenzano, E.; Bardwell, H.A.; Pugh, M.; Jones, L.A.; Russell, R.; Sammut, S.-J.; et al. The somatic mutation profiles of 2433 breast cancers refine their genomic and transcriptomic landscapes. Nat. Commun. 2016, 7, 11479. [Google Scholar] [CrossRef] [Green Version]
- Donehower, L.A.; Soussi, T.; Korkut, A.; Liu, Y.; Schultz, A.; Cardenas, M.; Li, X.; Babur, O.; Hsu, T.K.; Lichtarge, O.; et al. Integrated Analysis of TP53 Gene and Pathway Alterations in The Cancer Genome Atlas. Cell Rep. 2019, 28, 1370–1384. [Google Scholar] [CrossRef] [Green Version]
- Banerji, S.; Cibulskis, K.; Rangel-Escareno, C.; Brown, K.K.; Carter, S.L.; Frederick, A.M.; Lawrence, M.S.; Sivachenko, A.Y.; Sougnez, C.; Zou, L.; et al. Sequence analysis of mutations and translocations across breast cancer subtypes. Nature 2012, 486, 405–409. [Google Scholar] [CrossRef]
- Silwal-Pandit, L.; Vollan, H.K.M.; Chin, S.-F.; Rueda, O.M.; McKinney, S.; Osako, T.; Quigley, D.A.; Kristensen, V.N.; Aparicio, S.; Børresen-Dale, A.-L.; et al. TP53 Mutation Spectrum in Breast Cancer Is Subtype Specific and Has Distinct Prognostic Relevance. Clin. Cancer Res. 2014, 20, 3569–3580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mehta, S.Y.; Morten, B.C.; Antony, J.; Henderson, L.; Lasham, A.; Campbell, H.; Cunliffe, H.; Horsfield, J.A.; Reddel, R.R.; Avery-Kiejda, K.A.; et al. Regulation of the interferon-gamma (IFN-gamma) pathway by p63 and Delta133p53 isoform in different breast cancer subtypes. Oncotarget 2018, 9, 29146–29161. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Joruiz, S.M.; Bourdon, J.-C. p53 Isoforms: Key Regulators of the Cell Fate Decision. Cold Spring Harb. Perspect. Med. 2016, 6, a026039. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zerbino, D.R.; Achuthan, P.; Akanni, W.; Amode, M.R.; Barrell, D.; Bhai, J.; Billis, K.; Cummins, C.; Gall, A.; Girón, C.G.; et al. Ensembl 2018. Nucleic Acids Res. 2018, 46, D754–D761. [Google Scholar] [CrossRef] [PubMed]
- Dalgleish, R.; Flicek, P.; Cunningham, F.; Astashyn, A.; Tully, R.E.; Proctor, G.; Chen, Y.; McLaren, W.M.; Larsson, P.; Vaughan, B.W.; et al. Locus Reference Genomic sequences: An improved basis for describing human DNA variants. Genome Med. 2010, 2, 24–27. [Google Scholar] [CrossRef]
- Anbarasan, T.; Bourdon, J.-C. The Emerging Landscape of p53 Isoforms in Physiology, Cancer and Degenerative Diseases. Int. J. Mol. Sci. 2019, 20, 6257. [Google Scholar] [CrossRef] [Green Version]
- Mehta, S.; Tsai, P.; Lasham, A.; Campbell, H.; Reddel, R.; Braithwaite, A.; Print, C. A Study of TP53 RNA Splicing Illustrates Pitfalls of RNA-seq Methodology. Cancer Res. 2016, 76, 7151–7159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lasham, A.; Tsai, P.; Fitzgerald, S.J.; Mehta, S.Y.; Knowlton, N.S.; Braithwaite, A.W.; Print, C.G. Accessing a New Dimension in TP53 Biology: Multiplex Long Amplicon Digital PCR to Specifically Detect and Quantitate Individual TP53 Transcripts. Cancers 2020, 12, 769. [Google Scholar] [CrossRef] [Green Version]
- Avery-Kiejda, K.A.; Morten, B.; Wong-Brown, M.W.; Mathe, A.; Scott, R.J. The relative mRNA expression of p53 isoforms in breast cancer is associated with clinical features and outcome. Carcinogenesis 2013, 35, 586–596. [Google Scholar] [CrossRef]
- Bourdon, J.-C.; Khoury, M.P.; Diot, A.; Baker, L.; Fernandes, K.; Aoubala, M.; Quinlan, P.; Purdie, A.C.; Jordan, L.B.; Prats, A.-C.; et al. p53 mutant breast cancer patients expressing p53γ have as good a prognosis as wild-type p53 breast cancer patients. Breast Cancer Res. 2011, 13, R7. [Google Scholar] [CrossRef]
- Gadea, G.; Arsic, N.; Fernandes, K.; Diot, A.; Joruiz, S.M.; Abdallah, S.; Meuray, V.; Vinot, S.; Anguille, C.; Remenyi, J. Tp53 drives invasion through expression of its Δ133p53β variant. eLife 2016, 5, e14734. [Google Scholar] [CrossRef] [PubMed]
- Razavi, P.; Chang, M.T.; Xu, G.; Bandlamudi, C.; Ross, D.S.; Vasan, N.; Cai, Y.; Bielski, C.M.; Donoghue, M.T.; Jonsson, P.; et al. The Genomic Landscape of Endocrine-Resistant Advanced Breast Cancers. Cancer Cell 2018, 34, 427–438.e6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Curtis, C.; Shah, S.P.; Chin, S.F.; Turashvili, G.; Rueda, O.M.; Dunning, M.J.; Speed, D.; Lynch, A.G.; Samarajiwa, S.; Yuan, Y.; et al. The genomic and transcriptomic architecture of 2000 breast tumours reveals novel subgroups. Natature 2012, 486, 346–352. [Google Scholar] [CrossRef]
- Leroy, B.; Anderson, M.; Soussi, T. TP53 Mutations in Human Cancer: Database Reassessment and Prospects for the Next Decade. Hum. Mutat. 2014, 35, 672–688. [Google Scholar] [CrossRef]
- Grossman, R.L.; Heath, A.P.; Ferretti, V.; Varmus, H.E.; Lowy, D.R.; Kibbe, W.A.; Staudt, L.M. Toward a Shared Vision for Cancer Genomic Data. N. Engl. J. Med. 2016, 375, 1109–1112. [Google Scholar] [CrossRef]
- TCGA BRCA Gene Expression Level 3 Data. Available online: https://gdac.broadinstitute.org/ (accessed on 10 June 2019).
- Ghosh, A.; Stewart, D.; Matlashewski, G. Regulation of Human p53 Activity and Cell Localization by Alternative Splicing. Mol. Cell. Biol. 2004, 24, 7987–7997. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sorlie, T.; Tibshirani, R.; Parker, J.; Hastie, T.; Marron, J.S.; Nobel, A.; Deng, S.; Johnsen, H.; Pesich, R.; Geisler, S.; et al. Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc. Natl. Acad. Sci. USA 2003, 100, 8418–8423. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muthukaruppan, A.; Lasham, A.; Blenkiron, C.; Woad, K.J.; Black, M.A.; Knowlton, N.; McCarthy, N.; Findlay, M.P. Genomic profiling of breast tumours from New Zealand patients. N. Z. Med. J. 2017, 130, 40–56. [Google Scholar]
- Haybittle, J.L.; Blamey, R.W.; Elston, C.W.; Johnson, E.J.; Doyle, P.J.; Campbell, F.C.; Nicholson, I.R.; Griffiths, K. A prognostic index in primary breast cancer. Br. J. Cancer 1982, 45, 361–366. [Google Scholar] [CrossRef] [Green Version]
- Ravdin, P.M.; Siminoff, L.A.; Davis, G.J.; Mercer, M.B.; Hewlett, J.; Gerson, N.; Parker, H.L. Computer Program to Assist in Making Decisions About Adjuvant Therapy for Women with Early Breast Cancer. J. Clin. Oncol. 2001, 19, 980–991. [Google Scholar] [CrossRef]
- Wishart, G.C.; Azzato, E.M.; Greenberg, D.C.; Rashbass, J.; Kearins, O.; Lawrence, G.; Caldas, C.; Pharoah, P.D. Predict: A new UK prognostic model that predicts survival following surgery for invasive breast cancer. Breast Cancer Res. BCR 2010, 12, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Calabrese, C.; Davidson, N.R.; Demircioglu, D.; Fonseca, N.A.; He, Y.; Kahles, A.; Lehmann, K.V.; Liu, F.; Shiraishi, Y.; Soulette, C.M.; et al. Genomic basis for RNA alterations in cancer. Nat. Cell Biol. 2020, 578, 129–136. [Google Scholar] [CrossRef] [Green Version]
- Olivier, M.; Bouaoun, L.; Sonkin, D.; Ardin, M.; Hollstein, M.; Byrnes, G.; Zavadil, J. TP53 variations in human cancers: New lessons from the IARC TP53 Database and genomic studies. Eur. J. Cancer 2016, 61, S15. [Google Scholar] [CrossRef]
- Smeby, J.; Sveen, A.; Eilertsen, I.A.; Danielsen, S.A.; Hoff, A.M.; Eide, P.W.; Johannessen, B.; Hektoen, M.; Skotheim, R.I.; Guren, M.G.; et al. Transcriptional and functional consequences of TP53 splice mutations in colorectal cancer. Oncogenesis 2019, 8, 35. [Google Scholar] [CrossRef]
- Jayasinghe, R.G.; Cao, S.; Gao, Q.; Wendl, M.C.; Vo, N.S.; Reynolds, S.M.; Zhao, Y.; Climente-González, H.; Chai, S.; Wang, F.; et al. Systematic Analysis of Splice-Site-Creating Mutations in Cancer. Cell Rep. 2018, 23, 270–281.e3. [Google Scholar] [CrossRef] [Green Version]
- Soukarieh, O.; Gaildrat, P.; Hamiet, M.; Drouet, A.; Baert-Desurmont, S.; Frébourg, T.; Tosi, M.; Martins, A. Exonic splicing mutations are more prevalent than currently estimated and can be predicted using in silico tools. PLoS Genet. 2016, 12, e1005756. [Google Scholar] [CrossRef] [Green Version]
- Garziera, M.; Cecchin, E.; Giorda, G.; Sorio, R.; Scalone, S.; De Mattia, E.; Roncato, R.; Gagno, S.; Poletto, E.; Romanato, L.; et al. Clonal Evolution of TP53 c.375 + 1G > A Mutation in Pre-and Post-Neo-Adjuvant Chemotherapy (NACT) Tumor Samples in High-Grade Serous Ovarian Cancer (HGSOC). Cells 2019, 8, 1186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frebourg, T.; Barbier, N.; Yan, Y.X.; Garber, E.J.; Dreyfus, M.; Fraumeni, J.; Li, F.P.; Friend, S.H. Germ-line p53 mutations in 15 families with Li-Fraumeni syndrome. Am. J. Hum. Genet. 1995, 56, 608–615. [Google Scholar] [PubMed]
- Koster, J.; Plasterk, R.H.A. A library of Neo Open Reading Frame peptides (NOPs) as a sustainable resource of common neoantigens in up to 50% of cancer patients. Sci. Rep. 2019, 9, 6577. [Google Scholar] [CrossRef]
- Duffy, M.J.; Synnott, N.C.; Crown, J. Mutant p53 in breast cancer: Potential as a therapeutic target and biomarker. Breast Cancer Res. Treat. 2018, 170, 213–219. [Google Scholar] [CrossRef] [PubMed]
- Statistics New Zealand. Ethnic Group Summaries Reveal New Zealand’s Multicultural Make-Up. Available online: https://www.stats.govt.nz/news/ethnic-group-summaries-reveal-new-zealands-multicultural-make-up (accessed on 26 January 2021).
- Thorvaldsdóttir, H.; Robinson, J.T.; Mesirov, J.P. Integrative Genomics Viewer (IGV): High-performance genomics data visualization and exploration. Brief. Bioinform. 2012, 14, 178–192. [Google Scholar] [CrossRef] [Green Version]
- Droplet Digital PCR. Laboratories. B.-R. Applications Guide. Available online: https://www.bio-rad.com/webroot/web/pdf/lsr/literature/Bulletin_6407.pdf (accessed on 20 March 2018).
- Goldman, M.J.; Craft, B.; Hastie, M.; Repečka, K.; McDade, F.; Kamath, A.; Banerjee, A.; Luo, Y.; Rogers, D.; Brooks, A.N.; et al. Visualizing and interpreting cancer genomics data via the Xena platform. Nat. Biotechnol. 2020, 38, 675–678. [Google Scholar] [CrossRef]
- Harrington, D.; Fleming, T. A class of rank test procedures for censored survival data. Biometrika 1982, 69, 553–566. [Google Scholar] [CrossRef]
- Therneau, T. Survival: Survival Analysis, Including Penalized Likelihood; R Package (Version 2.36-5); R foundation for Statistical Computing: Vienna, Austria, 2011. [Google Scholar]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2014. [Google Scholar]
TP53 Mutation Type | Frequency | Number of Tumors |
---|---|---|
Frameshift | 26% | 8 |
Missense | 45% | 14 |
Nonsense | 10% | 3 |
Splicing | 16% | 5 |
In-Frame indel | 3% | 1 |
TP53 Information | Raw p Value | Adjusted p Value 1 | Hazard Ratio 2 | 95% Confidence Intervals 2 | Raw p Value 2 | Adjusted p Value 1,2 |
---|---|---|---|---|---|---|
TP53 mutant | 2.9 × 10−3 | 0.037 | 4.36 | 1.47–12.97 | 8.1 × 10−3 | 9.2 × 10−3 |
t2/t1 ratio | 7.3 × 10−5 | 1.8 × 10−3 | 1.85 | 1.32–2.59 | 3.4 × 10−4 | 5.1 × 10−4 |
TP53 Information | Hazard Ratio | 95% Confidence Intervals | p Value |
---|---|---|---|
TP53 mutation | 4.61 | 1.94–10.95 | 5.4 × 10−4 |
t2/t1 ratio | 1.65 | 1.18–2.32 | 3.6 × 10−3 |
Tumor size | 1.84 | 1.30–2.61 | 6.3 × 10−4 |
Lymph node status | 4.18 | 1.50–11.64 | 6.2 × 10−3 |
Assay (Intron) | Oligonucleotide | TP53 Location | Sequence (5′–3′) |
---|---|---|---|
4 | Forward primer 1 | Exon 3 | ACTTCCTGAAAACAACGTTCTG |
4 | Reverse primer 1 | Exon 6 | CCACACGCAAATTTCCTTCC |
4 | Probe_HEX 1 | Exon 4 | 5HEX_TGCCCTGGTAGGTTTTCTGGGAAGGGAC_3IABkFQ |
5 | Forward primer 2 | Exon 5 | CAGCTGTGGGTTGATTCCA |
5 | Reverse primer 2 | Exon 7 | GTGATGATGGTGAGGATGGG |
5 | Probe_HEX 2 | Exon 5 | 5HEX_TGCTTGTAGATGGCCATGGC_3IABkFQ |
7 | Forward primer 3 | Exon 7 | CCCATCCTCACCATCATCAC |
7 | Reverse primer 3 | Exon 8 | GTGAGGCTCCCCTTTCTTG |
7 | Probe_HEX 3 | Exon 8 | 5HEX_ATTCTCTTCCTCTGTGCGCC_3IABkFQ |
Assay | ddPCR Cycling Conditions |
---|---|
Intron 4 splice mutation | 94 °C for 10 min, 50 cycles of 94 °C for 30 s, 64 °C for 1 min, 72 °C for 6 min, 98 °C for 10 min and then 12 °C hold |
Intron 5 splice mutation | 94 °C for 10 min, 50 cycles of 94 °C for 30 s, 62 °C for 30 s, 72 °C for 1 min, 98 °C for 10 min and then 12 °C hold |
Intron 7 splice mutation | 94 °C for 10 min, 50 cycles of 94 °C for 30 s, 62 °C for 1 min, 72 °C for 3 min, 98 °C for 10 min and then 12 °C hold |
Oligonucleotide | Location | Sequence (5′–3′) |
---|---|---|
Forward primer | Intron 2 | AGTGGATCCATTGGAAGGGCAGGC |
Reverse primer 1 | Exon 10 | CTGGGCATCCTTGAGTTCC |
α probe_HEX 1 | Exons 9/10 | 5HEX_CGGATCTGAAGGGTGAAATATTCTCCA_3IABkFQ |
β probe_FAM_1 1 | Exon 9β | 56-FAM_ACTTTGCCTGATACAGATGCTACT_3IABkFQ |
β probe_FAM_2 1 | Exon 9β | 56-FAM_TCTGTATCAGGCAAAGTCATAGAACCAT_3IABkFQ |
γ probe_FAM 1 | Exons 9/9γ | 56-FAM_AGCATCTGAAGGGTGAAATATTCTCCA_3IABkFQ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lasham, A.; Knowlton, N.; Mehta, S.Y.; Braithwaite, A.W.; Print, C.G. Breast Cancer Patient Prognosis Is Determined by the Interplay between TP53 Mutation and Alternative Transcript Expression: Insights from TP53 Long Amplicon Digital PCR Assays. Cancers 2021, 13, 1531. https://doi.org/10.3390/cancers13071531
Lasham A, Knowlton N, Mehta SY, Braithwaite AW, Print CG. Breast Cancer Patient Prognosis Is Determined by the Interplay between TP53 Mutation and Alternative Transcript Expression: Insights from TP53 Long Amplicon Digital PCR Assays. Cancers. 2021; 13(7):1531. https://doi.org/10.3390/cancers13071531
Chicago/Turabian StyleLasham, Annette, Nicholas Knowlton, Sunali Y. Mehta, Antony W. Braithwaite, and Cristin G. Print. 2021. "Breast Cancer Patient Prognosis Is Determined by the Interplay between TP53 Mutation and Alternative Transcript Expression: Insights from TP53 Long Amplicon Digital PCR Assays" Cancers 13, no. 7: 1531. https://doi.org/10.3390/cancers13071531