AKT3 Expression in Mesenchymal Colorectal Cancer Cells Drives Growth and Is Associated with Epithelial-Mesenchymal Transition
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Gene Expression Datasets and CMS Labels of CRC Patients
2.2. Generation of Merged CRC (Primary) Cell Line Dataset
2.3. CMS and CRIS Classification of CRC (Primary) Cell Lines
2.4. Kinase Differential Expression Analysis
2.5. Gene Set Enrichment Analysis
2.6. Cell Culture
2.7. RNA Isolation and Gene Expression Profiling of PDX Models
2.8. Human Tumour Sample Collection
2.9. RNA in Situ Hybridisation on Human CRC Tissue
2.10. RNA Isolation, cDNA Conversion and qRT-PCR on Cell Line Samples
2.11. Immunoprecipitation
2.12. Western Blotting
2.13. Cell Viability Assays
2.14. Generation of Stable CRISPR-Edited AKT3 Knockout Clones
3. Results
3.1. AKT3 is Differentially Expressed between CMS in Tumours and Preclinical Models
3.2. AKT3 is Active in CMS4 Lines and Contributes to Outgrowth by Inhibiting p27KIP1
3.3. High AKT3 Expression Is Associated with Enriched EMT Gene Expression
3.4. AKT3 and FRMD6 as Marker Genes for Prognosis
4. Discussions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fearon, E.R. Molecular genetics of colorectal cancer. Annu. Rev. Pathol. 2011, 6, 479–507. [Google Scholar] [CrossRef]
- The Cancer Genome Atlas Network. Comprehensive molecular characterization of human colon and rectal cancer. Nature 2012, 487, 330–337. [Google Scholar] [CrossRef] [PubMed]
- Punt, C.J.A.; Koopman, M.; Vermeulen, L. From tumour heterogeneity to advances in precision treatment of colorectal cancer. Nat. Rev. Clin. Oncol. 2017, 14, 235–246. [Google Scholar] [CrossRef]
- Schlicker, A.; Beran, G.; Chresta, C.M.; McWalter, G.; Pritchard, A.; Weston, S.; Runswick, S.; Davenport, S.; Heathcote, K.; Castro, D.A.; et al. Subtypes of primary colorectal tumors correlate with response to targeted treatment in colorectal cell lines. BMC Med. Genom. 2012, 5, 66. [Google Scholar] [CrossRef] [PubMed]
- de Sousa e Melo, F.; Wang, X.; Jansen, M.; Fessler, E.; Trinh, A.; de Rooij, L.P.; de Jong, J.H.; de Boer, O.J.; van Leersum, R.; Bijlsma, M.F.; et al. Poor-prognosis colon cancer is defined by a molecularly distinct subtype and develops from serrated precursor lesions. Nat. Med. 2013, 19, 614–618. [Google Scholar] [CrossRef] [PubMed]
- Sadanandam, A.; Lyssiotis, C.A.; Homicsko, K.; Collisson, E.A.; Gibb, W.J.; Wullschleger, S.; Ostos, L.C.; Lannon, W.A.; Grotzinger, C.; Del Rio, M.; et al. A colorectal cancer classification system that associates cellular phenotype and responses to therapy. Nat. Med. 2013, 19, 619–625. [Google Scholar] [CrossRef]
- Marisa, L.; de Reynies, A.; Duval, A.; Selves, J.; Gaub, M.P.; Vescovo, L.; Etienne-Grimaldi, M.C.; Schiappa, R.; Guenot, D.; Ayadi, M.; et al. Gene expression classification of colon cancer into molecular subtypes: Characterization, validation, and prognostic value. PLoS Med. 2013, 10, e1001453. [Google Scholar] [CrossRef] [PubMed]
- Budinska, E.; Popovici, V.; Tejpar, S.; D’Ario, G.; Lapique, N.; Sikora, K.O.; Di Narzo, A.F.; Yan, P.; Hodgson, J.G.; Weinrich, S.; et al. Gene expression patterns unveil a new level of molecular heterogeneity in colorectal cancer. J. Pathol. 2013, 231, 63–76. [Google Scholar] [CrossRef] [PubMed]
- Perez-Villamil, B.; Romera-Lopez, A.; Hernandez-Prieto, S.; Lopez-Campos, G.; Calles, A.; Lopez-Asenjo, J.A.; Sanz-Ortega, J.; Fernandez-Perez, C.; Sastre, J.; Alfonso, R.; et al. Colon cancer molecular subtypes identified by expression profiling and associated to stroma, mucinous type and different clinical behavior. BMC Cancer 2012, 12, 260. [Google Scholar] [CrossRef]
- Roepman, P.; Schlicker, A.; Tabernero, J.; Majewski, I.; Tian, S.; Moreno, V.; Snel, M.H.; Chresta, C.M.; Rosenberg, R.; Nitsche, U.; et al. Colorectal cancer intrinsic subtypes predict chemotherapy benefit, deficient mismatch repair and epithelial-to-mesenchymal transition. Int. J. Cancer 2014, 134, 552–562. [Google Scholar] [CrossRef]
- Guinney, J.; Dienstmann, R.; Wang, X.; de Reynies, A.; Schlicker, A.; Soneson, C.; Marisa, L.; Roepman, P.; Nyamundanda, G.; Angelino, P.; et al. The consensus molecular subtypes of colorectal cancer. Nat. Med. 2015, 21, 1350–1356. [Google Scholar] [CrossRef]
- Song, N.; Pogue-Geile, K.L.; Gavin, P.G.; Yothers, G.; Kim, S.R.; Johnson, N.L.; Lipchik, C.; Allegra, C.J.; Petrelli, N.J.; O’Connell, M.J.; et al. Clinical Outcome From Oxaliplatin Treatment in Stage II/III Colon Cancer According to Intrinsic Subtypes: Secondary Analysis of NSABP C-07/NRG Oncology Randomized Clinical Trial. JAMA Oncol. 2016, 2, 1162–1169. [Google Scholar] [CrossRef]
- Del Rio, M.; Mollevi, C.; Bibeau, F.; Vie, N.; Selves, J.; Emile, J.F.; Roger, P.; Gongora, C.; Robert, J.; Tubiana-Mathieu, N.; et al. Molecular subtypes of metastatic colorectal cancer are associated with patient response to irinotecan-based therapies. Eur. J. Cancer 2017, 76, 68–75. [Google Scholar] [CrossRef]
- Trinh, A.; Trumpi, K.; De Sousa, E.M.F.; Wang, X.; de Jong, J.H.; Fessler, E.; Kuppen, P.J.; Reimers, M.S.; Swets, M.; Koopman, M.; et al. Practical and Robust Identification of Molecular Subtypes in Colorectal Cancer by Immunohistochemistry. Clin. Cancer Res. 2017, 23, 387–398. [Google Scholar] [CrossRef]
- Okita, A.; Takahashi, S.; Ouchi, K.; Inoue, M.; Watanabe, M.; Endo, M.; Honda, H.; Yamada, Y.; Ishioka, C. Consensus molecular subtypes classification of colorectal cancer as a predictive factor for chemotherapeutic efficacy against metastatic colorectal cancer. Oncotarget 2018, 9, 18698–18711. [Google Scholar] [CrossRef]
- Mooi, J.K.; Wirapati, P.; Asher, R.; Lee, C.K.; Savas, P.; Price, T.J.; Townsend, A.; Hardingham, J.; Buchanan, D.; Williams, D.; et al. The prognostic impact of consensus molecular subtypes (CMS) and its predictive effects for bevacizumab benefit in metastatic colorectal cancer: Molecular analysis of the AGITG MAX clinical trial. Ann. Oncol. 2018, 29, 2240–2246. [Google Scholar] [CrossRef] [PubMed]
- Allen, W.L.; Dunne, P.D.; McDade, S.; Scanlon, E.; Loughrey, M.; Coleman, H.; McCann, C.; McLaughlin, K.; Nemeth, Z.; Syed, N.; et al. Transcriptional subtyping and CD8 immunohistochemistry identifies poor prognosis stage II/III colorectal cancer patients who benefit from adjuvant chemotherapy. JCO Precis. Oncol. 2018, 2, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Stintzing, S.; Wirapati, P.; Lenz, H.J.; Neureiter, D.; Fischer von Weikersthal, L.; Decker, T.; Kiani, A.; Kaiser, F.; Al-Batran, S.; Heintges, T.; et al. Consensus molecular subgroups (CMS) of colorectal cancer (CRC) and first-line efficacy of FOLFIRI plus cetuximab or bevacizumab in the FIRE3 (AIO KRK-0306) trial. Ann. Oncol. 2019, 30, 1796–1803. [Google Scholar] [CrossRef] [PubMed]
- Lenz, H.J.; Ou, F.S.; Venook, A.P.; Hochster, H.S.; Niedzwiecki, D.; Goldberg, R.M.; Mayer, R.J.; Bertagnolli, M.M.; Blanke, C.D.; Zemla, T.; et al. Impact of Consensus Molecular Subtype on Survival in Patients With Metastatic Colorectal Cancer: Results From CALGB/SWOG 80405 (Alliance). J. Clin. Oncol. 2019, 37, 1876–1885. [Google Scholar] [CrossRef] [PubMed]
- Buikhuisen, J.Y.; Torang, A.; Medema, J.P. Exploring and modelling colon cancer inter-tumour heterogeneity: Opportunities and challenges. Oncogenesis 2020, 9, 66. [Google Scholar] [CrossRef] [PubMed]
- Isella, C.; Terrasi, A.; Bellomo, S.E.; Petti, C.; Galatola, G.; Muratore, A.; Mellano, A.; Senetta, R.; Cassenti, A.; Sonetto, C.; et al. Stromal contribution to the colorectal cancer transcriptome. Nat. Genet. 2015, 47, 312–319. [Google Scholar] [CrossRef]
- Calon, A.; Lonardo, E.; Berenguer-Llergo, A.; Espinet, E.; Hernando-Momblona, X.; Iglesias, M.; Sevillano, M.; Palomo-Ponce, S.; Tauriello, D.V.; Byrom, D.; et al. Stromal gene expression defines poor-prognosis subtypes in colorectal cancer. Nat. Genet. 2015, 47, 320–329. [Google Scholar] [CrossRef]
- McCorry, A.M.; Loughrey, M.B.; Longley, D.B.; Lawler, M.; Dunne, P.D. Epithelial-to-mesenchymal transition signature assessment in colorectal cancer quantifies tumour stromal content rather than true transition. J. Pathol. 2018, 246, 422–426. [Google Scholar] [CrossRef] [PubMed]
- Isella, C.; Brundu, F.; Bellomo, S.E.; Galimi, F.; Zanella, E.; Porporato, R.; Petti, C.; Fiori, A.; Orzan, F.; Senetta, R.; et al. Selective analysis of cancer-cell intrinsic transcriptional traits defines novel clinically relevant subtypes of colorectal cancer. Nat. Commun. 2017, 8, 15107. [Google Scholar] [CrossRef] [PubMed]
- Dunne, P.D.; Alderdice, M.; O’Reilly, P.G.; Roddy, A.C.; McCorry, A.M.B.; Richman, S.; Maughan, T.; McDade, S.S.; Johnston, P.G.; Longley, D.B.; et al. Cancer-cell intrinsic gene expression signatures overcome intratumoural heterogeneity bias in colorectal cancer patient classification. Nat. Commun. 2017, 8, 15657. [Google Scholar] [CrossRef] [PubMed]
- Eide, P.W.; Bruun, J.; Lothe, R.A.; Sveen, A. CMScaller: An R package for consensus molecular subtyping of colorectal cancer pre-clinical models. Sci. Rep. 2017, 7, 16618. [Google Scholar] [CrossRef]
- Sveen, A.; Bruun, J.; Eide, P.W.; Eilertsen, I.A.; Ramirez, L.; Murumagi, A.; Arjama, M.; Danielsen, S.A.; Kryeziu, K.; Elez, E.; et al. Colorectal Cancer Consensus Molecular Subtypes Translated to Preclinical Models Uncover Potentially Targetable Cancer Cell Dependencies. Clin. Cancer Res. 2018, 24, 794–806. [Google Scholar] [CrossRef] [PubMed]
- Linnekamp, J.F.; Hooff, S.R.V.; Prasetyanti, P.R.; Kandimalla, R.; Buikhuisen, J.Y.; Fessler, E.; Ramesh, P.; Lee, K.; Bochove, G.G.W.; de Jong, J.H.; et al. Consensus molecular subtypes of colorectal cancer are recapitulated in in vitro and in vivo models. Cell Death Differ. 2018, 25, 616–633. [Google Scholar] [CrossRef] [PubMed]
- Prasetyanti, P.R.; van Hooff, S.R.; van Herwaarden, T.; de Vries, N.; Kalloe, K.; Rodermond, H.; van Leersum, R.; de Jong, J.H.; Franitza, M.; Nurnberg, P.; et al. Capturing colorectal cancer inter-tumor heterogeneity in patient-derived xenograft (PDX) models. Int. J. Cancer 2019, 144, 366–371. [Google Scholar] [CrossRef]
- Manning, B.D.; Toker, A. AKT/PKB Signaling: Navigating the Network. Cell 2017, 169, 381–405. [Google Scholar] [CrossRef]
- Johnson, S.M.; Gulhati, P.; Rampy, B.A.; Han, Y.; Rychahou, P.G.; Doan, H.Q.; Weiss, H.L.; Evers, B.M. Novel expression patterns of PI3K/Akt/mTOR signaling pathway components in colorectal cancer. J. Am. Coll. Surg. 2010, 210, 767–776. [Google Scholar] [CrossRef] [PubMed]
- Itoh, N.; Semba, S.; Ito, M.; Takeda, H.; Kawata, S.; Yamakawa, M. Phosphorylation of Akt/PKB is required for suppression of cancer cell apoptosis and tumor progression in human colorectal carcinoma. Cancer 2002, 94, 3127–3134. [Google Scholar] [CrossRef] [PubMed]
- Bolstad, B. Preprocesscore: A Collection of Pre-Processing Functions. R Package Version 1.50.0 2020. Available online: https://github.com/bmbolstad/preprocessCore (accessed on 8 January 2021).
- Leek, J.T.; Johnson, W.E.; Parker, H.S.; Fertig, E.J.; Jaffe, A.E.; Zhang, Y.; Storey, J.D.; Torres, L.C. sva: Surrogate Variable Analysis. R package version 3.36.0 2020. Available online: https://github.com/jtleek/sva (accessed on 8 January 2021).
- Carlson, M. org.Hs.eg.db: Genome wide annotation for Human. R package version 3.8.2 2019. Available online: https://master.bioconductor.org/packages/release/data/annotation/html/org.Hs.eg.db.html (accessed on 8 January 2021).
- Carlson, M. hgu133plus2.db: Affymetrix Human Genome U133 Plus 2.0 Array annotation data (chip hgu133plus2). R package version 3.2.3 2016. Available online: https://bioconductor.org/packages/release/data/annotation/html/hgu133plus2.db.html (accessed on 8 January 2021).
- Gentleman, R. annotate: Annotation for microarrays. R package version 1.68.0 2020. Available online: https://www.bioconductor.org/packages/release/bioc/html/annotate.html (accessed on 8 January 2021).
- Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015, 43, e47. [Google Scholar] [CrossRef] [PubMed]
- Ghandi, M.; Huang, F.W.; Jane-Valbuena, J.; Kryukov, G.V.; Lo, C.C.; McDonald, E.R., 3rd; Barretina, J.; Gelfand, E.T.; Bielski, C.M.; Li, H.; et al. Next-generation characterization of the Cancer Cell Line Encyclopedia. Nature 2019, 569, 503–508. [Google Scholar] [CrossRef] [PubMed]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [PubMed]
- Korotkevich, G.; Sukhov, V.; Sergushichev, A. Fast gene set enrichment analysis. bioRxiv 2019. [Google Scholar] [CrossRef]
- Kluin, R.J.C.; Kemper, K.; Kuilman, T.; de Ruiter, J.R.; Iyer, V.; Forment, J.V.; Cornelissen-Steijger, P.; de Rink, I.; Ter Brugge, P.; Song, J.Y.; et al. XenofilteR: Computational deconvolution of mouse and human reads in tumor xenograft sequence data. BMC Bioinform. 2018, 19, 366. [Google Scholar] [CrossRef] [PubMed]
- Lawrence, M.; Huber, W.; Pages, H.; Aboyoun, P.; Carlson, M.; Gentleman, R.; Morgan, M.T.; Carey, V.J. Software for computing and annotating genomic ranges. PLoS Comput. Biol. 2013, 9, e1003118. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Todaro, M.; Alea, M.P.; Di Stefano, A.B.; Cammareri, P.; Vermeulen, L.; Iovino, F.; Tripodo, C.; Russo, A.; Gulotta, G.; Medema, J.P.; et al. Colon cancer stem cells dictate tumor growth and resist cell death by production of interleukin-4. Cell Stem Cell 2007, 1, 389–402. [Google Scholar] [CrossRef] [PubMed]
- De Angelis, M.L.; Zeuner, A.; Policicchio, E.; Russo, G.; Bruselles, A.; Signore, M.; Vitale, S.; De Luca, G.; Pilozzi, E.; Boe, A.; et al. Cancer Stem Cell-Based Models of Colorectal Cancer Reveal Molecular Determinants of Therapy Resistance. Stem Cells Transl. Med. 2016, 5, 511–523. [Google Scholar] [CrossRef] [PubMed]
- de Sousa e Melo, F.; Colak, S.; Buikhuisen, J.; Koster, J.; Cameron, K.; de Jong, J.H.; Tuynman, J.B.; Prasetyanti, P.R.; Fessler, E.; van den Bergh, S.P.; et al. Methylation of cancer-stem-cell-associated Wnt target genes predicts poor prognosis in colorectal cancer patients. Cell Stem Cell 2011, 9, 476–485. [Google Scholar] [CrossRef] [PubMed]
- Spandidos, A.; Wang, X.; Wang, H.; Seed, B. PrimerBank: A resource of human and mouse PCR primer pairs for gene expression detection and quantification. Nucleic Acids Res. 2010, 38, D792–D799. [Google Scholar] [CrossRef] [PubMed]
- Ladner, C.L.; Yang, J.; Turner, R.J.; Edwards, R.A. Visible fluorescent detection of proteins in polyacrylamide gels without staining. Anal. Biochem. 2004, 326, 13–20. [Google Scholar] [CrossRef] [PubMed]
- Brinkman, E.K.; Chen, T.; Amendola, M.; van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 2014, 42, e168. [Google Scholar] [CrossRef] [PubMed]
- Vredeveld, L.C.; Possik, P.A.; Smit, M.A.; Meissl, K.; Michaloglou, C.; Horlings, H.M.; Ajouaou, A.; Kortman, P.C.; Dankort, D.; McMahon, M.; et al. Abrogation of BRAFV 600E-induced senescence by PI3K pathway activation contributes to melanomagenesis. Genes Dev. 2012, 26, 1055–1069. [Google Scholar] [CrossRef] [PubMed]
- Chin, Y.R.; Yoshida, T.; Marusyk, A.; Beck, A.H.; Polyak, K.; Toker, A. Targeting Akt3 signaling in triple-negative breast cancer. Cancer Res. 2014, 74, 964–973. [Google Scholar] [CrossRef] [PubMed]
- ten Hoorn, S.; Trinh, A.; de Jong, J.H.; Koens, L.; Vermeulen, L. Classification of Colorectal Cancer in Molecular Subtypes by Immunohistochemistry. In Colorectal Cancer: Methods and Protocols; Beaulieu, J.-F., Ed.; Springer: New York, NY, USA, 2018; pp. 179–191. [Google Scholar] [CrossRef]
- Cho, H.; Mu, J.; Kim, J.K.; Thorvaldsen, J.L.; Chu, Q.; Crenshaw, E.B., 3rd; Kaestner, K.H.; Bartolomei, M.S.; Shulman, G.I.; Birnbaum, M.J. Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science 2001, 292, 1728–1731. [Google Scholar] [CrossRef]
- Cho, H.; Thorvaldsen, J.L.; Chu, Q.; Feng, F.; Birnbaum, M.J. Akt1/PKBalpha is required for normal growth but dispensable for maintenance of glucose homeostasis in mice. J. Biol. Chem. 2001, 276, 38349–38352. [Google Scholar] [CrossRef]
- Chen, W.S.; Xu, P.Z.; Gottlob, K.; Chen, M.L.; Sokol, K.; Shiyanova, T.; Roninson, I.; Weng, W.; Suzuki, R.; Tobe, K.; et al. Growth retardation and increased apoptosis in mice with homozygous disruption of the Akt1 gene. Genes Dev. 2001, 15, 2203–2208. [Google Scholar] [CrossRef] [PubMed]
- Easton, R.M.; Cho, H.; Roovers, K.; Shineman, D.W.; Mizrahi, M.; Forman, M.S.; Lee, V.M.; Szabolcs, M.; de Jong, R.; Oltersdorf, T.; et al. Role for Akt3/protein kinase Bgamma in attainment of normal brain size. Mol. Cell. Biol. 2005, 25, 1869–1878. [Google Scholar] [CrossRef] [PubMed]
- Tschopp, O.; Yang, Z.Z.; Brodbeck, D.; Dummler, B.A.; Hemmings-Mieszczak, M.; Watanabe, T.; Michaelis, T.; Frahm, J.; Hemmings, B.A. Essential role of protein kinase B gamma (PKB gamma/Akt3) in postnatal brain development but not in glucose homeostasis. Development 2005, 132, 2943–2954. [Google Scholar] [CrossRef]
- Liu, S.L.; Wang, Z.G.; Hu, Y.; Xin, Y.; Singaram, I.; Gorai, S.; Zhou, X.; Shim, Y.; Min, J.H.; Gong, L.W.; et al. Quantitative Lipid Imaging Reveals a New Signaling Function of Phosphatidylinositol-3,4-Bisphophate: Isoform- and Site-Specific Activation of Akt. Mol. Cell 2018, 71, 1092–1104. e5. [Google Scholar] [CrossRef] [PubMed]
- Toker, A.; Dibble, C.C. PI 3-Kinase Signaling: AKTing up inside the Cell. Mol. Cell 2018, 71, 875–876. [Google Scholar] [CrossRef] [PubMed]
- Arboleda, M.J.; Lyons, J.F.; Kabbinavar, F.F.; Bray, M.R.; Snow, B.E.; Ayala, R.; Danino, M.; Karlan, B.Y.; Slamon, D.J. Overexpression of AKT2/protein kinase Bbeta leads to up-regulation of beta1 integrins, increased invasion, and metastasis of human breast and ovarian cancer cells. Cancer Res. 2003, 63, 196–206. [Google Scholar] [PubMed]
- Hutchinson, J.N.; Jin, J.; Cardiff, R.D.; Woodgett, J.R.; Muller, W.J. Activation of Akt-1 (PKB-alpha) can accelerate ErbB-2-mediated mammary tumorigenesis but suppresses tumor invasion. Cancer Res. 2004, 64, 3171–3178. [Google Scholar] [CrossRef] [PubMed]
- Yoeli-Lerner, M.; Yiu, G.K.; Rabinovitz, I.; Erhardt, P.; Jauliac, S.; Toker, A. Akt blocks breast cancer cell motility and invasion through the transcription factor NFAT. Mol. Cell 2005, 20, 539–550. [Google Scholar] [CrossRef] [PubMed]
- Maroulakou, I.G.; Oemler, W.; Naber, S.P.; Tsichlis, P.N. Akt1 ablation inhibits, whereas Akt2 ablation accelerates, the development of mammary adenocarcinomas in mouse mammary tumor virus (MMTV)-ErbB2/neu and MMTV-polyoma middle T transgenic mice. Cancer Res. 2007, 67, 167–177. [Google Scholar] [CrossRef]
- Rychahou, P.G.; Kang, J.; Gulhati, P.; Doan, H.Q.; Chen, L.A.; Xiao, S.Y.; Chung, D.H.; Evers, B.M. Akt2 overexpression plays a critical role in the establishment of colorectal cancer metastasis. Proc. Natl. Acad. Sci. USA 2008, 105, 20315–20320. [Google Scholar] [CrossRef] [PubMed]
- Ericson, K.; Gan, C.; Cheong, I.; Rago, C.; Samuels, Y.; Velculescu, V.E.; Kinzler, K.W.; Huso, D.L.; Vogelstein, B.; Papadopoulos, N. Genetic inactivation of AKT1, AKT2, and PDPK1 in human colorectal cancer cells clarifies their roles in tumor growth regulation. Proc. Natl. Acad. Sci. USA 2010, 107, 2598–2603. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, E.; Robb, C.M.; Smith, L.M.; Brattain, M.G.; Wang, J.; Black, J.D.; Chowdhury, S. Role of Akt2 in regulation of metastasis suppressor 1 expression and colorectal cancer metastasis. Oncogene 2017, 36, 3104–3118. [Google Scholar] [CrossRef]
- Varga, J.; Nicolas, A.; Petrocelli, V.; Pesic, M.; Mahmoud, A.; Michels, B.E.; Etlioglu, E.; Yepes, D.; Haupl, B.; Ziegler, P.K.; et al. AKT-dependent NOTCH3 activation drives tumor progression in a model of mesenchymal colorectal cancer. J. Exp. Med. 2020, 217. [Google Scholar] [CrossRef] [PubMed]
- Davies, M.A.; Stemke-Hale, K.; Tellez, C.; Calderone, T.L.; Deng, W.; Prieto, V.G.; Lazar, A.J.; Gershenwald, J.E.; Mills, G.B. A novel AKT3 mutation in melanoma tumours and cell lines. Br. J. Cancer 2008, 99, 1265–1268. [Google Scholar] [CrossRef]
- Banerji, S.; Cibulskis, K.; Rangel-Escareno, C.; Brown, K.K.; Carter, S.L.; Frederick, A.M.; Lawrence, M.S.; Sivachenko, A.Y.; Sougnez, C.; Zou, L.; et al. Sequence analysis of mutations and translocations across breast cancer subtypes. Nature 2012, 486, 405–409. [Google Scholar] [CrossRef] [PubMed]
- Mosquera, J.M.; Varma, S.; Pauli, C.; MacDonald, T.Y.; Yashinskie, J.J.; Varga, Z.; Sboner, A.; Moch, H.; Rubin, M.A.; Shin, S.J. MAGI3-AKT3 fusion in breast cancer amended. Nature 2015, 520, E11–E12. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Pugh, T.J.; Banerji, S.; Meyerson, M. Pugh et al. reply. Nature 2015, 520, E12–E14. [Google Scholar] [CrossRef] [PubMed]
- Network, T.C.G.A. Comprehensive molecular portraits of human breast tumours. Nature 2012, 490, 61–70. [Google Scholar] [CrossRef]
- Stahl, J.M.; Sharma, A.; Cheung, M.; Zimmerman, M.; Cheng, J.Q.; Bosenberg, M.W.; Kester, M.; Sandirasegarane, L.; Robertson, G.P. Deregulated Akt3 activity promotes development of malignant melanoma. Cancer Res. 2004, 64, 7002–7010. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward | Reverse |
---|---|---|
AKT1 | 5′–agcgacgtggctattgtgaa | 5′–gcgccacagagaagttgttg |
AKT2 | 5′–catcaaagaaggctggctcc | 5′–tcttcagcaggaagtaccgtg |
AKT3 | 5′–aatggacagaagctatccaggc | 5′–tgatgggttgtagaggcatcc |
FRMD6 | 5′–ggacactctgggttgattgtg | 5′–tgtgtcgatcagtggaggtc |
ATP5E | 5′–ccgctttcgctacagcat | 5′–tgggagtatcggatgtagctg |
GUSB | 5′–tggttggagagctcatttgga | 5′–gcactctcgtcggtgactgtt |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Buikhuisen, J.Y.; Gomez Barila, P.M.; Torang, A.; Dekker, D.; de Jong, J.H.; Cameron, K.; Vitale, S.; Stassi, G.; van Hooff, S.R.; Castro, M.A.A.; et al. AKT3 Expression in Mesenchymal Colorectal Cancer Cells Drives Growth and Is Associated with Epithelial-Mesenchymal Transition. Cancers 2021, 13, 801. https://doi.org/10.3390/cancers13040801
Buikhuisen JY, Gomez Barila PM, Torang A, Dekker D, de Jong JH, Cameron K, Vitale S, Stassi G, van Hooff SR, Castro MAA, et al. AKT3 Expression in Mesenchymal Colorectal Cancer Cells Drives Growth and Is Associated with Epithelial-Mesenchymal Transition. Cancers. 2021; 13(4):801. https://doi.org/10.3390/cancers13040801
Chicago/Turabian StyleBuikhuisen, Joyce Y., Patricia M. Gomez Barila, Arezo Torang, Daniëlle Dekker, Joan H. de Jong, Kate Cameron, Sara Vitale, Giorgio Stassi, Sander R. van Hooff, Mauro A. A. Castro, and et al. 2021. "AKT3 Expression in Mesenchymal Colorectal Cancer Cells Drives Growth and Is Associated with Epithelial-Mesenchymal Transition" Cancers 13, no. 4: 801. https://doi.org/10.3390/cancers13040801
APA StyleBuikhuisen, J. Y., Gomez Barila, P. M., Torang, A., Dekker, D., de Jong, J. H., Cameron, K., Vitale, S., Stassi, G., van Hooff, S. R., Castro, M. A. A., Vermeulen, L., & Medema, J. P. (2021). AKT3 Expression in Mesenchymal Colorectal Cancer Cells Drives Growth and Is Associated with Epithelial-Mesenchymal Transition. Cancers, 13(4), 801. https://doi.org/10.3390/cancers13040801