Characterization of Total RNA, CD44, FASN, and PTEN mRNAs from Extracellular Vesicles as Biomarkers in Gastric Cancer Patients
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Patients
2.2. EV Isolation from Plasma
2.3. Transmission Electron Microscopy (TEM)
2.4. Western Blot Analysis
2.5. mRNA Isolation, cDNA Syntheses and qPCR Analyses
2.6. Nanoparticle Tracking Analysis (NTA)
2.7. Statistical Analyses
3. Results
3.1. Study Population
3.2. EV Characterization
3.3. FASN, PTEN, and CD44 mRNA Analyses
3.4. FASN, PTEN, and CD44 mRNA Levels after Neoadjuvant Chemotherapy and Curatively Intended Gastrectomy
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Jemal, A.; Bray, F.; Center, M.M.; Ferlay, J.; Ward, E.; Forman, D. Global cancer statistics. CA Cancer J. Clin. 2011, 61, 69–90. [Google Scholar] [CrossRef]
- Ferlay, J.; Steliarova-Foucher, E.; Lortet-Tieulent, J.; Rosso, S.; Coebergh, J.W.; Comber, H.; Forman, D.; Bray, F. Cancer incidence and mortality patterns in Europe: Estimates for 40 countries in 2012. Eur. J. Cancer 2013, 49, 1374–1403. [Google Scholar] [CrossRef] [PubMed]
- Alderson, D.; Cunningham, D.; Nankivell, M.; Blazeby, J.M.; Griffin, S.M.; Crellin, A.; Grabsch, H.I.; Langer, R.; Pritchard, S.; Okines, A.; et al. Neoadjuvant cisplatin and fluorouracil versus epirubicin, cisplatin, and capecitabine followed by resection in patients with oesophageal adenocarcinoma (UK MRC OE05): An open-label, randomised phase 3 trial. Lancet Oncol. 2017, 18, 1249–1260. [Google Scholar] [CrossRef]
- Cunningham, D.; Allum, W.H.; Stenning, S.P.; Thompson, J.N.; Van de Velde, C.J.; Nicolson, M.; Scarffe, J.H.; Lofts, F.J.; Falk, S.J.; Iveson, T.J.; et al. Perioperative chemotherapy versus surgery alone for resectable gastroesophageal cancer. N. Engl. J. Med. 2006, 355, 11–20. [Google Scholar] [CrossRef]
- Ychou, M.; Boige, V.; Pignon, J.P.; Conroy, T.; Bouche, O.; Lebreton, G.; Ducourtieux, M.; Bedenne, L.; Fabre, J.M.; Saint-Aubert, B.; et al. Perioperative chemotherapy compared with surgery alone for resectable gastroesophageal adenocarcinoma: An FNCLCC and FFCD multicenter phase III trial. J. Clin. Oncol. 2011, 29, 1715–1721. [Google Scholar] [CrossRef]
- Moehler, M.; Al-Batran, S.E.; Andus, T.; Arends, J.; Arnold, D.; Baretton, G.; Bornschein, J.; Budach, W.; Daum, S.; Dietrich, C.; et al. S3-Leitlinie Magenkarzinom—Diagnostik und Therapie der Adenokarzinome des Magens und des ösophagogastralen Übergangs—Langversion 2.0—August 2019. AWMF-Registernummer: 032/009OL. Z. Gastroenterol. 2019, 57, 1517–1632. [Google Scholar] [CrossRef] [PubMed]
- Stocker, G.; Thieme, R.; Lordick, F. Neoadjuvant and perioperative treatment of gastric cancer, current studies and new biomarkers. Chirurg 2021, 92, 499–505. [Google Scholar] [CrossRef]
- Al-Batran, S.E.; Homann, N.; Pauligk, C.; Goetze, T.O.; Meiler, J.; Kasper, S.; Kopp, H.G.; Mayer, F.; Haag, G.M.; Luley, K.; et al. Perioperative chemotherapy with fluorouracil plus leucovorin, oxaliplatin, and docetaxel versus fluorouracil or capecitabine plus cisplatin and epirubicin for locally advanced, resectable gastric or gastro-oesophageal junction adenocarcinoma (FLOT4): A randomised, phase 2/3 trial. Lancet 2019, 393, 1948–1957. [Google Scholar] [CrossRef]
- Lordick, F.; Al-Batran, S.E.; Dietel, M.; Gaiser, T.; Hofheinz, R.D.; Kirchner, T.; Kreipe, H.H.; Lorenzen, S.; Mohler, M.; Quaas, A.; et al. HER2 testing in gastric cancer: Results of a German expert meeting. J. Cancer Res. Clin. Oncol. 2017, 143, 835–841. [Google Scholar] [CrossRef]
- The Cancer Genome Atlas Research Network. Comprehensive molecular characterization of gastric adenocarcinoma. Nature 2014, 513, 202–209. [Google Scholar] [CrossRef]
- Lauren, P. The Two Histological Main Types of Gastric Carcinoma: Diffuse and So-Called Intestinal-Type Carcinoma. An Attempt at a Histo-Clinical Classification. Acta Pathol. Microbiol. Scand. 1965, 64, 31–49. [Google Scholar] [CrossRef]
- Sohn, B.H.; Hwang, J.E.; Jang, H.J.; Lee, H.S.; Oh, S.C.; Shim, J.J.; Lee, K.W.; Kim, E.H.; Yim, S.Y.; Lee, S.H.; et al. Clinical Significance of Four Molecular Subtypes of Gastric Cancer Identified by The Cancer Genome Atlas Project. Clin. Cancer Res. 2017, 23, 4441–4449. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Fu, Z.; Xu, S.; Xu, Y.; Xu, P. The prognostic value of CD44 expression in gastric cancer: A meta-analysis. Biomed. Pharm. 2014, 68, 693–697. [Google Scholar] [CrossRef] [PubMed]
- Tamura, M.; Gu, J.; Matsumoto, K.; Aota, S.; Parsons, R.; Yamada, K.M. Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Science 1998, 280, 1614–1617. [Google Scholar] [CrossRef]
- Zheng, H.C.; Sun, J.M.; Li, X.H.; Yang, X.F.; Zhang, Y.C.; Xin, Y. Role of PTEN and MMP-7 expression in growth, invasion, metastasis and angiogenesis of gastric carcinoma. Pathol. Int. 2003, 53, 659–666. [Google Scholar] [CrossRef]
- Xiang, H.G.; Hao, J.; Zhang, W.J.; Lu, W.J.; Dong, P.; Liu, Y.B.; Chen, L. Expression of Fatty Acid Synthase Negatively Correlates with PTEN and Predicts Peritoneal Dissemination of Human Gastric Cancer. Asian Pac. J. Cancer Prev. 2015, 16, 6851–6855. [Google Scholar] [CrossRef]
- Alix-Panabieres, C.; Pantel, K. Clinical prospects of liquid biopsies. Nat. Biomed. Eng. 2017, 1, 65. [Google Scholar] [CrossRef]
- Pan, B.T.; Teng, K.; Wu, C.; Adam, M.; Johnstone, R.M. Electron microscopic evidence for externalization of the transferrin receptor in vesicular form in sheep reticulocytes. J. Cell Biol. 1985, 101, 942–948. [Google Scholar] [CrossRef]
- Demory Beckler, M.; Higginbotham, J.N.; Franklin, J.L.; Ham, A.J.; Halvey, P.J.; Imasuen, I.E.; Whitwell, C.; Li, M.; Liebler, D.C.; Coffey, R.J. Proteomic analysis of exosomes from mutant KRAS colon cancer cells identifies intercellular transfer of mutant KRAS. Mol. Cell Proteom. 2013, 12, 343–355. [Google Scholar] [CrossRef] [PubMed]
- Kahlert, C.; Melo, S.A.; Protopopov, A.; Tang, J.; Seth, S.; Koch, M.; Zhang, J.; Weitz, J.; Chin, L.; Futreal, A.; et al. Identification of double-stranded genomic DNA spanning all chromosomes with mutated KRAS and p53 DNA in the serum exosomes of patients with pancreatic cancer. J. Biol. Chem. 2014, 289, 3869–3875. [Google Scholar] [CrossRef] [PubMed]
- Taylor, D.D.; Gercel-Taylor, C. Exosomes/microvesicles: Mediators of cancer-associated immunosuppressive microenvironments. Semin. Immunopathol. 2011, 33, 441–454. [Google Scholar] [CrossRef] [PubMed]
- Hinger, S.A.; Cha, D.J.; Franklin, J.L.; Higginbotham, J.N.; Dou, Y.; Ping, J.; Shu, L.; Prasad, N.; Levy, S.; Zhang, B.; et al. Diverse Long RNAs Are Differentially Sorted into Extracellular Vesicles Secreted by Colorectal Cancer Cells. Cell Rep. 2018, 25, 715–725. [Google Scholar] [CrossRef] [PubMed]
- Valadi, H.; Ekstrom, K.; Bossios, A.; Sjostrand, M.; Lee, J.J.; Lotvall, J.O. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat. Cell Biol. 2007, 9, 654–659. [Google Scholar] [CrossRef]
- Hurwitz, S.N.; Rider, M.A.; Bundy, J.L.; Liu, X.; Singh, R.K.; Meckes, D.G., Jr. Proteomic profiling of NCI-60 extracellular vesicles uncovers common protein cargo and cancer type-specific biomarkers. Oncotarget 2016, 7, 86999–87015. [Google Scholar] [CrossRef]
- Kowal, J.; Arras, G.; Colombo, M.; Jouve, M.; Morath, J.P.; Primdal-Bengtson, B.; Dingli, F.; Loew, D.; Tkach, M.; Thery, C. Proteomic comparison defines novel markers to characterize heterogeneous populations of extracellular vesicle subtypes. Proc. Natl. Acad. Sci. USA 2016, 113, E968–E977. [Google Scholar] [CrossRef]
- Haraszti, R.A.; Didiot, M.C.; Sapp, E.; Leszyk, J.; Shaffer, S.A.; Rockwell, H.E.; Gao, F.; Narain, N.R.; DiFiglia, M.; Kiebish, M.A.; et al. High-resolution proteomic and lipidomic analysis of exosomes and microvesicles from different cell sources. J. Extracell. Vesicles 2016, 5, 32570. [Google Scholar] [CrossRef]
- Altadill, T.; Campoy, I.; Lanau, L.; Gill, K.; Rigau, M.; Gil-Moreno, A.; Reventos, J.; Byers, S.; Colas, E.; Cheema, A.K. Enabling Metabolomics Based Biomarker Discovery Studies Using Molecular Phenotyping of Exosome-Like Vesicles. PLoS ONE 2016, 11, e0151339. [Google Scholar] [CrossRef]
- Alexander, M.; Hu, R.; Runtsch, M.C.; Kagele, D.A.; Mosbruger, T.L.; Tolmachova, T.; Seabra, M.C.; Round, J.L.; Ward, D.M.; O’Connell, R.M. Exosome-delivered microRNAs modulate the inflammatory response to endotoxin. Nat. Commun. 2015, 6, 7321. [Google Scholar] [CrossRef]
- Muller, L.; Simms, P.; Hong, C.S.; Nishimura, M.I.; Jackson, E.K.; Watkins, S.C.; Whiteside, T.L. Human tumor-derived exosomes (TEX) regulate Treg functions via cell surface signaling rather than uptake mechanisms. Oncoimmunology 2017, 6, e1261243. [Google Scholar] [CrossRef]
- Tkach, M.; Kowal, J.; Zucchetti, A.E.; Enserink, L.; Jouve, M.; Lankar, D.; Saitakis, M.; Martin-Jaular, L.; Thery, C. Qualitative differences in T-cell activation by dendritic cell-derived extracellular vesicle subtypes. EMBO J. 2017, 36, 3012–3028. [Google Scholar] [CrossRef]
- Kugeratski, F.G.; Hodge, K.; Lilla, S.; McAndrews, K.M.; Zhou, X.; Hwang, R.F.; Zanivan, S.; Kalluri, R. Quantitative proteomics identifies the core proteome of exosomes with syntenin-1 as the highest abundant protein and a putative universal biomarker. Nat. Cell Biol. 2021, 23, 631–641. [Google Scholar] [CrossRef] [PubMed]
- Thery, C.; Witwer, K.W.; Aikawa, E.; Alcaraz, M.J.; Anderson, J.D.; Andriantsitohaina, R.; Antoniou, A.; Arab, T.; Archer, F.; Atkin-Smith, G.K.; et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): A position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J. Extracell. Vesicles 2018, 7, 1535750. [Google Scholar] [CrossRef] [PubMed]
- Werner, M.; Höfler, H. Therapie Gastrointestinaler Tumoren—Prinzipien der Chirurgischen Klinik und Poliklinik der Technischen Universität München; Springer: Berlin/Heidelberg, Germany, 2000. [Google Scholar]
- Gorji-Bahri, G.; Moradtabrizi, N.; Vakhshiteh, F.; Hashemi, A. Validation of common reference genes stability in exosomal mRNA-isolated from liver and breast cancer cell lines. Cell Biol. Int. 2021, 45, 1098–1110. [Google Scholar] [CrossRef] [PubMed]
- Furuta, E.; Okuda, H.; Kobayashi, A.; Watabe, K. Metabolic genes in cancer: Their roles in tumor progression and clinical implications. Biochim. Biophys. Acta 2010, 1805, 141–152. [Google Scholar] [CrossRef]
- Esslimani-Sahla, M.; Thezenas, S.; Simony-Lafontaine, J.; Kramar, A.; Lavaill, R.; Chalbos, D.; Rochefort, H. Increased expression of fatty acid synthase and progesterone receptor in early steps of human mammary carcinogenesis. Int. J. Cancer 2007, 120, 224–229. [Google Scholar] [CrossRef]
- Kao, Y.C.; Lee, S.W.; Lin, L.C.; Chen, L.T.; Hsing, C.H.; Hsu, H.P.; Huang, H.Y.; Shiue, Y.L.; Chen, T.J.; Li, C.F. Fatty acid synthase overexpression confers an independent prognosticator and associates with radiation resistance in nasopharyngeal carcinoma. Tumor Biol. 2013, 34, 759–768. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Wang, L.; Yang, Y.; Gong, L.; Xiao, B.; Liu, X. A serum exosomal microRNA panel as a potential biomarker test for gastric cancer. Biochem. Biophys. Res. Commun. 2017, 493, 1322–1328. [Google Scholar] [CrossRef]
- Taylor, D.D.; Gercel-Taylor, C. MicroRNA signatures of tumor-derived exosomes as diagnostic biomarkers of ovarian cancer. Gynecol. Oncol. 2008, 110, 13–21. [Google Scholar] [CrossRef]
- Li, C.; Li, J.F.; Cai, Q.; Qiu, Q.Q.; Yan, M.; Liu, B.Y.; Zhu, Z.G. MiRNA-199a-3p: A potential circulating diagnostic biomarker for early gastric cancer. J. Surg. Oncol. 2013, 108, 89–92. [Google Scholar] [CrossRef]
- Ma, G.J.; Gu, R.M.; Zhu, M.; Wen, X.; Li, J.T.; Zhang, Y.Y.; Zhang, X.M.; Chen, S.Q. Plasma post-operative miR-21 expression in the prognosis of gastric cancers. Asian Pac. J. Cancer Prev. 2013, 14, 7551–7554. [Google Scholar] [CrossRef]
- Ganig, N.; Baenke, F.; Thepkaysone, M.L.; Lin, K.; Rao, V.S.; Wong, F.C.; Polster, H.; Schneider, M.; Helm, D.; Pecqueux, M.; et al. Proteomic Analyses of Fibroblast- and Serum-Derived Exosomes Identify QSOX1 as a Marker for Non-invasive Detection of Colorectal Cancer. Cancers 2021, 13, 1351. [Google Scholar] [CrossRef] [PubMed]
- Melo, S.A.; Luecke, L.B.; Kahlert, C.; Fernandez, A.F.; Gammon, S.T.; Kaye, J.; LeBleu, V.S.; Mittendorf, E.A.; Weitz, J.; Rahbari, N.; et al. Glypican-1 identifies cancer exosomes and detects early pancreatic cancer. Nature 2015, 523, 177–182. [Google Scholar] [CrossRef] [PubMed]
- Rahbari, M.; Pecqueux, M.; Aust, D.; Stephan, H.; Tiebel, O.; Chatzigeorgiou, A.; Tonn, T.; Baenke, F.; Rao, V.; Ziegler, N.; et al. Expression of Glypican 3 is an Independent Prognostic Biomarker in Primary Gastro-Esophageal Adenocarcinoma and Corresponding Serum Exosomes. J. Clin. Med. 2019, 8, 696. [Google Scholar] [CrossRef]
- Smyth, E.; Zhang, S.; Cunningham, D.; Wotherspoon, A.; Soong, R.; Peckitt, C.; Valeri, N.; Fassan, M.; Rugge, M.; Okines, A.; et al. Pharmacogenetic Analysis of the UK MRC (Medical Research Council) MAGIC Trial: Association of Polymorphisms with Toxicity and Survival in Patients Treated with Perioperative Epirubicin, Cisplatin, and 5-fluorouracil (ECF) Chemotherapy. Clin. Cancer Res. 2017, 23, 7543–7549. [Google Scholar] [CrossRef]
- Lorenzen, S.; Stahl, M.; Hofheinz, R.D.; Al-Batran, S.E.; Lordick, F. Influence of Taxanes on Treatment Sequence in Gastric Cancer. Oncol. Res. Treat. 2019, 43, 42–47. [Google Scholar] [CrossRef] [PubMed]
- Bang, Y.J.; Van Cutsem, E.; Feyereislova, A.; Chung, H.C.; Shen, L.; Sawaki, A.; Lordick, F.; Ohtsu, A.; Omuro, Y.; Satoh, T.; et al. Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of HER2-positive advanced gastric or gastro-oesophageal junction cancer (ToGA): A phase 3, open-label, randomised controlled trial. Lancet 2010, 376, 687–697. [Google Scholar] [CrossRef]
- Ishii, T.; Kawazoe, A.; Shitara, K. Dawn of precision medicine on gastric cancer. Int. J. Clin. Oncol. 2019, 24, 779–788. [Google Scholar] [CrossRef]
- Brandl, A.; Pachmayr, E.; Gul-Klein, S.; Alberto, M.; Thuss-Patience, P.; Rau, B. Surgical treatment of peritoneal metastases of gastric cancer. Chirurg 2018, 89, 669–677. [Google Scholar] [CrossRef] [PubMed]
- Geng, X.; Liu, H.; Lin, T.; Hu, Y.; Chen, H.; Zhao, L.; Mou, T.; Qi, X.; Yu, J.; Li, G. Survival benefit of gastrectomy for gastric cancer with peritoneal carcinomatosis: A propensity score-matched analysis. Cancer Med. 2016, 5, 2781–2791. [Google Scholar] [CrossRef]
- Roviello, F.; Caruso, S.; Marrelli, D.; Pedrazzani, C.; Neri, A.; De Stefano, A.; Pinto, E. Treatment of peritoneal carcinomatosis with cytoreductive surgery and hyperthermic intraperitoneal chemotherapy: State of the art and future developments. Surg. Oncol. 2011, 20, e38–e54. [Google Scholar] [CrossRef] [PubMed]
- Pietrantonio, F.; Miceli, R.; Raimondi, A.; Kim, Y.W.; Kang, W.K.; Langley, R.E.; Choi, Y.Y.; Kim, K.M.; Nankivell, M.G.; Morano, F.; et al. Individual Patient Data Meta-Analysis of the Value of Microsatellite Instability As a Biomarker in Gastric Cancer. J. Clin. Oncol. 2019, 37, 3392–3400. [Google Scholar] [CrossRef] [PubMed]
- Smyth, E.C.; Wotherspoon, A.; Peckitt, C.; Gonzalez, D.; Hulkki-Wilson, S.; Eltahir, Z.; Fassan, M.; Rugge, M.; Valeri, N.; Okines, A.; et al. Mismatch Repair Deficiency, Microsatellite Instability, and Survival: An Exploratory Analysis of the Medical Research Council Adjuvant Gastric Infusional Chemotherapy (MAGIC) Trial. JAMA Oncol. 2017, 3, 1197–1203. [Google Scholar] [CrossRef] [PubMed]






| Name | Forward | Reverse | Reference | Length (BP) |
|---|---|---|---|---|
| GAPDH | GAGTCAACGGATTTGGTCGTA | TTCCCGTTCTCAGCCTTGAC | NM_002046 | 178 |
| FASN | CAGAGCAGCCATGGAGGAG | CATCGTCCGTGACCATGTCC | NM_004104 | 109 |
| CD44S | GCAGTCAACAGTCGAAGAAGG | TGTCCTCCACAGCTCCATT | NM_000610 | 76 |
| PTEN | AGTGGCACTGTTGTTTCACA | CACCTTTAGCTGGCAGACCA | NM_000314 | 97 |
| Characteristics | Number of Cases | Controls | uGCP | tGCP |
|---|---|---|---|---|
| Mean age [years] | 67 | 64 | 60 | |
| Gender | ||||
| Male | 72 (71.3%) | 12 (85.7%) | 41 (68.3%) | 19 (70.7%) |
| Female | 29 (28.7%) | 2 (14.3%) | 19 (31.7%) | 8 (29.3%) |
| T-category | ||||
| T1 | 6 (6.9%) | 5 (8.3%) | 1 (3.7%) | |
| T2 | 11 (12.6%) | 6 (10.0%) | 5 (18.5%) | |
| T3 | 46 (52.9%) | 35 (58.3%) | 11 (40.7%) | |
| T4 | 13 (14.9%) | 5 (8.3%) | 8 (29.6%) | |
| Tx | 11 (12.6%) | 9 (15.0%) | 2 (7.4%) | |
| N-category | ||||
| N0 | 24 (27.6%) | 15 (25.0%) | 9 (33.3%) | |
| N+ | 52 (59.8%) | 37 (61.7%) | 15 (55.6%) | |
| Nx | 11 (12.6%) | 8 (13.3%) | 3 (11.1%) | |
| M-category | ||||
| M0 | 34 (39.1%) | 28 (46.7%) | 6 (22.2%) | |
| M+ | 52 (59.7%) | 31 (51.7%) | 21 (77.8%) | |
| Mx | 1 (1.1%) | 1 (1.7%) | 0 (0.0%) | |
| Localization | ||||
| AEG-II and -III | 34 (39.1%) | 26 (43.3%) | 8 (29.6%) | |
| Gastric Corpus and Antrum | 53 (60.9%) | 34 (56.7%) | 19 (70.4%) | |
| Grading | ||||
| G1 | 4 (4.6%) | 2 (3.3%) | 2 (7.4%) | |
| G2 | 14 (16.1%) | 11 (18.3%) | 3 (11.1%) | |
| G3 | 52 (59.8%) | 38 (63.3%) | 14 (51.9%) | |
| n.a. | 17 (19.5%) | 9 (15.0%) | 8 (29.6%) | |
| Laurén’s-classification | ||||
| Intestinal type | 16 (18.4%) | 10 (16.7%) | 6 (22.2%) | |
| Diffuse type | 57 (65.5%) | 37 (42.5%) | 20 (74.1%) | |
| Mixed type | 1 (1.1%) | 1 (1.7%) | 0 (0.0%) | |
| n.a. | 13 (14.9%) | 12 (20%) | 1 (3.7%) | |
| UICC-stage | ||||
| I | 8 (9.2%) | 5 (8.3%) | 3 (11.1%) | |
| II | 8 (9.2%) | 7 (11.7%) | 1 (3.7%) | |
| III | 15 (17.2%) | 14 (23.3%) | 1 (3.7%) | |
| IV | 55 (63.2%) | 34 (56.7%) | 22 (81.5%) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rhode, P.; Mehdorn, M.; Lyros, O.; Kahlert, C.; Kurth, T.; Venus, T.; Schierle, K.; Estrela-Lopis, I.; Jansen-Winkeln, B.; Lordick, F.; et al. Characterization of Total RNA, CD44, FASN, and PTEN mRNAs from Extracellular Vesicles as Biomarkers in Gastric Cancer Patients. Cancers 2021, 13, 5975. https://doi.org/10.3390/cancers13235975
Rhode P, Mehdorn M, Lyros O, Kahlert C, Kurth T, Venus T, Schierle K, Estrela-Lopis I, Jansen-Winkeln B, Lordick F, et al. Characterization of Total RNA, CD44, FASN, and PTEN mRNAs from Extracellular Vesicles as Biomarkers in Gastric Cancer Patients. Cancers. 2021; 13(23):5975. https://doi.org/10.3390/cancers13235975
Chicago/Turabian StyleRhode, Philipp, Matthias Mehdorn, Orestis Lyros, Christoph Kahlert, Thomas Kurth, Tom Venus, Katrin Schierle, Irina Estrela-Lopis, Boris Jansen-Winkeln, Florian Lordick, and et al. 2021. "Characterization of Total RNA, CD44, FASN, and PTEN mRNAs from Extracellular Vesicles as Biomarkers in Gastric Cancer Patients" Cancers 13, no. 23: 5975. https://doi.org/10.3390/cancers13235975
APA StyleRhode, P., Mehdorn, M., Lyros, O., Kahlert, C., Kurth, T., Venus, T., Schierle, K., Estrela-Lopis, I., Jansen-Winkeln, B., Lordick, F., Gockel, I., & Thieme, R. (2021). Characterization of Total RNA, CD44, FASN, and PTEN mRNAs from Extracellular Vesicles as Biomarkers in Gastric Cancer Patients. Cancers, 13(23), 5975. https://doi.org/10.3390/cancers13235975

