RASSF1A Suppression as a Potential Regulator of Mechano-Pathobiology Associated with Mammographic Density in BRCA Mutation Carriers
Abstract
:Simple Summary
Abstract
1. Introduction
2. Results
2.1. MD and Tissue Stiffness
2.2. Effect of MD-Relevant Stiffnesses Recapitulated in Three-Dimensions (3D) on MCF10DCIS.com RASSF1A Gene and Protein Expression
2.3. RASSF1A Expression in DCIS.com Cells Grown within High versus Low MD Microenvironments Cultivated In Vivo
2.4. RASSF1A Protein Expression in Regions of Varied Local Stiffness in Non-Mutated (WT) and BRCA Mutated Patient Tissue
2.5. Effect of MD on RASSF1A Expression in WT versus BRCA Mutant Mammary Tissue
3. Discussion
4. Material and Methods
4.1. Preparation of Human Breast Tissue for Stiffness/Density Measurements
4.2. Rotational Rheometry
4.3. MicroCT
4.4. Determining Stiffness from Volpara Data
4.5. Culture of MCF10DCIS.com in 3D
4.6. Quantitative, Real-Time Polymerase Chain Reaction (QPCR)
4.7. Embedding and Immunohistochemistry (IHC)
4.8. Local Stiffness Determined by Collagen I/Collagen III Ratio
4.9. Visual Selection of High versus Low Areas of Mammographic Density in Assessment of RASSF1A Epithelial Expression
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Australian Institute of Health and Welfare (AIHW). Cancer Data in Australia; Australian Government: Sydney, Australia, 2020.
- Sprague, B.L.; Gangnon, R.E.; Burt, V.; Trentham-Dietz, A.; Hampton, J.M.; Wellman, R.D.; Kerlikowske, K.; Miglioretti, D.L. Prevalence of mammographically dense breasts in the United States. J. Natl. Cancer Inst. 2014, 106. [Google Scholar] [CrossRef] [PubMed]
- Northey, J.J.; Barrett, A.S.; Acerbi, I.; Hayward, M.K.; Talamantes, S.; Dean, I.S.; Mouw, J.K.; Ponik, S.M.; Lakins, J.N.; Huang, P.J.; et al. Stiff stroma increases breast cancer risk by inducing the oncogene ZNF217. J. Clin. Invest. 2020, 130, 5721–5737. [Google Scholar] [CrossRef]
- Lisanti, M.P.; Tsirigos, A.; Pavlides, S.; Reeves, K.J.; Peiris-Pages, M.; Chadwick, A.L.; Sanchez-Alvarez, R.; Lamb, R.; Howell, A.; Martinez-Outschoorn, U.E.; et al. JNK1 stress signaling is hyper-activated in high breast density and the tumor stroma: Connecting fibrosis, inflammation, and stemness for cancer prevention. Cell Cycle 2014, 13, 580–599. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McConnell, J.C.; O’Connell, O.V.; Brennan, K.; Weiping, L.; Howe, M.; Joseph, L.; Knight, D.; O’Cualain, R.; Lim, Y.; Leek, A.; et al. Increased peri-ductal collagen micro-organization may contribute to raised mammographic density. Breast Cancer Res. 2016, 18, 5. [Google Scholar] [CrossRef]
- Huo, C.W.; Chew, G.; Hill, P.; Huang, D.; Ingman, W.; Hodson, L.; Brown, K.A.; Magenau, A.; Allam, A.H.; McGhee, E.; et al. High mammographic density is associated with an increase in stromal collagen and immune cells within the mammary epithelium. Breast Cancer Res. 2015, 17, 79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Provenzano, P.P.; Inman, D.R.; Eliceiri, K.W.; Knittel, J.G.; Yan, L.; Rueden, C.T.; White, J.G.; Keely, P.J. Collagen density promotes mammary tumor initiation and progression. BMC Med. 2008, 6, 11. [Google Scholar] [CrossRef] [Green Version]
- Conklin, M.W.; Eickhoff, J.C.; Riching, K.M.; Pehlke, C.A.; Eliceiri, K.W.; Provenzano, P.P.; Friedl, A.; Keely, P.J. Aligned collagen is a prognostic signature for survival in human breast carcinoma. Am. J. Pathol. 2011, 178, 1221–1232. [Google Scholar] [CrossRef]
- Huang, X.; Reye, G.; Momot, K.I.; Blick, T.; Lloyd, T.; Tilley, W.D.; Hickey, T.E.; Snell, C.E.; Okolicsanyi, R.K.; Haupt, L.M.; et al. Heparanase Promotes Syndecan-1 Expression to Mediate Fibrillar Collagen and Mammographic Density in Human Breast Tissue Cultured ex vivo. Front. Cell Dev. Biol. 2020, 8, 599. [Google Scholar] [CrossRef] [PubMed]
- Boyd, N.F.; Li, Q.; Melnichouk, O.; Huszti, E.; Martin, L.J.; Gunasekara, A.; Mawdsley, G.; Yaffe, M.J.; Minkin, S. Evidence that breast tissue stiffness is associated with risk of breast cancer. PLoS ONE 2014, 9, e100937. [Google Scholar] [CrossRef]
- Acerbi, I.; Cassereau, L.; Dean, I.; Shi, Q.; Au, A.; Park, C.; Chen, Y.Y.; Liphardt, J.; Hwang, E.S.; Weaver, V.M. Human breast cancer invasion and aggression correlates with ECM stiffening and immune cell infiltration. Integr. Biol. (Camb.) 2015, 7, 1120–1134. [Google Scholar] [CrossRef] [Green Version]
- Tutt, A.; Ashworth, A. The relationship between the roles of BRCA genes in DNA repair and cancer predisposition. Trends Mol. Med. 2002, 8, 571–576. [Google Scholar] [CrossRef]
- Kuchenbaecker, K.B.; Hopper, J.L.; Barnes, D.R.; Phillips, K.A.; Mooij, T.M.; Roos-Blom, M.J.; Jervis, S.; van Leeuwen, F.E.; Milne, R.L.; Andrieu, N.; et al. Risks of Breast, Ovarian, and Contralateral Breast Cancer for BRCA1 and BRCA2 Mutation Carriers. JAMA 2017, 317, 2402–2416. [Google Scholar] [CrossRef] [Green Version]
- Antoniou, A.; Pharoah, P.D.; Narod, S.; Risch, H.A.; Eyfjord, J.E.; Hopper, J.L.; Loman, N.; Olsson, H.; Johannsson, O.; Borg, A.; et al. Average risks of breast and ovarian cancer associated with BRCA1 or BRCA2 mutations detected in case Series unselected for family history: A combined analysis of 22 studies. Am. J. Hum. Genet. 2003, 72, 1117–1130. [Google Scholar] [CrossRef] [Green Version]
- Shivakumar, L.; Minna, J.; Sakamaki, T.; Pestell, R.; White, M.A. The RASSF1A tumor suppressor blocks cell cycle progression and inhibits cyclin D1 accumulation. Mol. Cell Biol. 2002, 22, 4309–4318. [Google Scholar] [CrossRef] [Green Version]
- Gao, B.; Xie, X.J.; Huang, C.; Shames, D.S.; Chen, T.T.; Lewis, C.M.; Bian, A.; Zhang, B.; Olopade, O.I.; Garber, J.E.; et al. RASSF1A polymorphism A133S is associated with early onset breast cancer in BRCA1/2 mutation carriers. Cancer Res. 2008, 68, 22–25. [Google Scholar] [CrossRef] [Green Version]
- Gierach, G.L.; Loud, J.T.; Chow, C.K.; Prindiville, S.A.; Eng-Wong, J.; Soballe, P.W.; Giambartolomei, C.; Mai, P.L.; Galbo, C.E.; Nichols, K.; et al. Mammographic density does not differ between unaffected BRCA1/2 mutation carriers and women at low-to-average risk of breast cancer. Breast Cancer Res. Treat. 2010, 123, 245–255. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mitchell, G.; Antoniou, A.C.; Warren, R.; Peock, S.; Brown, J.; Davies, R.; Mattison, J.; Cook, M.; Warsi, I.; Evans, D.G.; et al. Mammographic density and breast cancer risk in BRCA1 and BRCA2 mutation carriers. Cancer Res. 2006, 66, 1866–1872. [Google Scholar] [CrossRef] [Green Version]
- Passaperuma, K.; Warner, E.; Hill, K.A.; Gunasekara, A.; Yaffe, M.J. Is mammographic breast density a breast cancer risk factor in women with BRCA mutations? J. Clin. Oncol. 2010, 28, 3779–3783. [Google Scholar] [CrossRef]
- Ramon, Y.C.T.; Chirivella, I.; Miranda, J.; Teule, A.; Izquierdo, A.; Balmana, J.; Sanchez-Heras, A.B.; Llort, G.; Fisas, D.; Lope, V.; et al. Mammographic density and breast cancer in women from high risk families. Breast Cancer Res. 2015, 17, 93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pankova, D.; Jiang, Y.; Chatzifrangkeskou, M.; Vendrell, I.; Buzzelli, J.; Ryan, A.; Brown, C.; O’Neill, E. RASSF1A controls tissue stiffness and cancer stem-like cells in lung adenocarcinoma. EMBO J. 2019, 38, e100532. [Google Scholar] [CrossRef]
- Hagrass, H.A.; Pasha, H.F.; Shaheen, M.A.; Abdel Bary, E.H.; Kassem, R. Methylation status and protein expression of RASSF1A in breast cancer patients. Mol. Biol. Rep. 2014, 41, 57–65. [Google Scholar] [CrossRef]
- Huo, C.W.; Waltham, M.; Khoo, C.; Fox, S.B.; Hill, P.; Chen, S.; Chew, G.L.; Price, J.T.; Nguyen, C.H.; Williams, E.D.; et al. Mammographically dense human breast tissue stimulates MCF10DCIS.com progression to invasive lesions and metastasis. Breast Cancer Res. 2016, 18, 106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meng, Z.; Moroishi, T.; Guan, K.L. Mechanisms of Hippo pathway regulation. Genes Dev. 2016, 30, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Papaspyropoulos, A.; Bradley, L.; Thapa, A.; Leung, C.Y.; Toskas, K.; Koennig, D.; Pefani, D.E.; Raso, C.; Grou, C.; Hamilton, G.; et al. RASSF1A uncouples Wnt from Hippo signalling and promotes YAP mediated differentiation via p73. Nat. Commun. 2018, 9, 424. [Google Scholar] [CrossRef]
- Valachis, A.; Nearchou, A.D.; Lind, P. Surgical management of breast cancer in BRCA-mutation carriers: A systematic review and meta-analysis. Breast Cancer Res. Treat. 2014, 144, 443–455. [Google Scholar] [CrossRef]
- Blick, T.; Hugo, H.; Widodo, E.; Waltham, M.; Pinto, C.; Mani, S.A.; Weinberg, R.A.; Neve, R.M.; Lenburg, M.E.; Thompson, E.W. Epithelial mesenchymal transition traits in human breast cancer cell lines parallel the CD44(hi/)CD24 (lo/-) stem cell phenotype in human breast cancer. J. Mammary Gland Biol. Neoplasia 2010, 15, 235–252. [Google Scholar] [CrossRef] [PubMed]
- Akbar, M.W.; Isbilen, M.; Belder, N.; Canli, S.D.; Kucukkaraduman, B.; Turk, C.; Sahin, O.; Gure, A.O. A Stemness and EMT Based Gene Expression Signature Identifies Phenotypic Plasticity and is A Predictive but Not Prognostic Biomarker for Breast Cancer. J. Cancer 2020, 11, 949–961. [Google Scholar] [CrossRef] [Green Version]
- Rajabi, H.; Hata, T.; Li, W.; Long, M.D.; Hu, Q.; Liu, S.; Raina, D.; Kui, L.; Yasumizu, Y.; Hong, D.; et al. MUC1-C represses the RASSF1A tumor suppressor in human carcinoma cells. Oncogene 2019, 38, 7266–7277. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, M.; Wang, C.; Yu, B.; Zhang, X.; Shi, F.; Liu, X. Diagnostic value of RASSF1A methylation for breast cancer: A meta-analysis. Biosci. Rep. 2019, 39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Agathanggelou, A.; Honorio, S.; Macartney, D.P.; Martinez, A.; Dallol, A.; Rader, J.; Fullwood, P.; Chauhan, A.; Walker, R.; Shaw, J.A.; et al. Methylation associated inactivation of RASSF1A from region 3p21.3 in lung, breast and ovarian tumours. Oncogene 2001, 20, 1509–1518. [Google Scholar] [CrossRef] [Green Version]
- Agathanggelou, A.; Bieche, I.; Ahmed-Choudhury, J.; Nicke, B.; Dammann, R.; Baksh, S.; Gao, B.; Minna, J.D.; Downward, J.; Maher, E.R.; et al. Identification of novel gene expression targets for the Ras association domain family 1 (RASSF1A) tumor suppressor gene in non-small cell lung cancer and neuroblastoma. Cancer Res. 2003, 63, 5344–5351. [Google Scholar]
- Yang, C.; Tibbitt, M.W.; Basta, L.; Anseth, K.S. Mechanical memory and dosing influence stem cell fate. Nat. Mater. 2014, 13, 645–652. [Google Scholar] [CrossRef] [PubMed]
- Killaars, A.R.; Grim, J.C.; Walker, C.J.; Hushka, E.A.; Brown, T.E.; Anseth, K.S. Extended Exposure to Stiff Microenvironments Leads to Persistent Chromatin Remodeling in Human Mesenchymal Stem Cells. Adv. Sci. 2019, 6, 1801483. [Google Scholar] [CrossRef] [Green Version]
- Huang, X.; Ali, T.S.; Nano, T.; Blick, T.; Tse, B.W.; Sokolowski, K.; Tourell, M.C.; Lloyd, T.; Thompson, E.W.; Momot, K.I.; et al. Quantification of breast tissue density: Correlation between single-sided portable NMR and micro-CT measurements. Magn. Reson. Imaging 2019, 62, 111–120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miller, N.A.; Chapman, J.A.; Qian, J.; Christens-Barry, W.A.; Fu, Y.; Yuan, Y.; Lickley, H.L.; Axelrod, D.E. Heterogeneity Between Ducts of the Same Nuclear Grade Involved by Duct Carcinoma In Situ (DCIS) of the Breast. Cancer Inform. 2010, 9, 209–216. [Google Scholar] [CrossRef]
- Slater, K.; Partridge, J.; Nandivada, H. Tuning the Elastic Moduli of Corning® Matrigel® and Collagen I 3D Matrices by Varying the Protein Concentration; Incorporated, C., Ed.; Corning: Tewskbury, MA, USA, 2019. Available online: https://www.corning.com/catalog/cls/documents/application-notes/CLS-AC-AN-449.pdf (accessed on 5 July 2020).
- Meinert, C.; Theodoropoulos, C.; Klein, T.J.; Hutmacher, D.W.; Loessner, D. A Method for Prostate and Breast Cancer Cell Spheroid Cultures Using Gelatin Methacryloyl-Based Hydrogels. Methods Mol. Biol. 2018, 1786, 175–194. [Google Scholar] [CrossRef] [PubMed]
- Asgari, M.; Latifi, N.; Heris, H.K.; Vali, H.; Mongeau, L. In vitro fibrillogenesis of tropocollagen type III in collagen type I affects its relative fibrillar topology and mechanics. Sci. Rep. 2017, 7, 1392. [Google Scholar] [CrossRef] [Green Version]
Patient No. | BiRADs Density Status | Age | BRCA Status | Figure |
---|---|---|---|---|
GPH012M | 2 | 53 | BRCA1+ | Figure 1B, Figure 5 |
GPH016M | 2 | 46 | BRCA2+ | Figure 1B |
GPH019M | 2 | 43 | NEG | Figure 1B |
MPRIV015R | 1 | 29 | NEG | Figure 1B, Figure 4A, Figure 5 |
MPRIV017R | 2 | 41 | NEG | Figure 1B |
PAH009M | 4 | 28 | BRCA2+ | Figure 1B |
PAH021M | 1 | 23 | BRCA1+ | Figure 1B |
PAH023M | 2 | 67 | NEG | Figure 1A, Figure 1B |
PAH025M | 1 | 34 | NEG | Figure 1A |
PAH030M | 3 | 47 | NEG | Figure 4A, Figure 5 |
PAH032M | 3 | 48 | NEG | Figure 4A, Figure 5 |
PAH033M | 4 | 41 | NEG | Figure 4A |
PAH037M | ? | 27 | BRCA1+ | Figure 4B, Figure 5 |
PAH040M | 4 | 48 | NEG | Figure 1A, Figure 4A |
PAH043M | 3 | 33 | NEG | Figure 4A, Figure 5 |
PAH044M | 2 | 36 | BRCA2+ | Figure 4A, Figure 5 |
PAH045M | 2 | 34 | BRCA1+ | Figure 4B, Figure 5 |
PAH046M | 3 | 34 | BRCA1+ | Figure 4B, Figure 5 |
PAH049M | 3 | 36 | BRCA1+ | Figure 4B, Figure 5 |
PAH050M | 2 | 47 | RAD51D germline | Figure 5 |
Primer Name | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
---|---|---|
RASSF1A | CTCGTCTGCCTGGACTGTTGC | TCAGGTGTCTCCCACTCCACAG |
L32 | GATCTTGATGCCCAACATTGGTTATG | GCACTTCCAGCTCCTTGACG |
Antigen | Antibody | Dilution | Supplier |
RASSF1A | Mouse Monoclonal | 1:100 | ThermoFisher Scientific (Waltham, MA, USA) |
Gamma-H2AX (phospho S139) | Rabbit Polyclonal | 1:400 | Abcam (Cambridge, UK) |
Secondary antigen | Antibody | Dilution | Supplier |
IgG-HRP | Goat Anti-Mouse | 1:20,000 | Dako, Australia |
IgG-HRP | Goat Anti-Rabbit | 1:20,000 | Dako, Australia |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Reye, G.; Huang, X.; Britt, K.L.; Meinert, C.; Blick, T.; Xu, Y.; Momot, K.I.; Lloyd, T.; Northey, J.J.; Thompson, E.W.; et al. RASSF1A Suppression as a Potential Regulator of Mechano-Pathobiology Associated with Mammographic Density in BRCA Mutation Carriers. Cancers 2021, 13, 3251. https://doi.org/10.3390/cancers13133251
Reye G, Huang X, Britt KL, Meinert C, Blick T, Xu Y, Momot KI, Lloyd T, Northey JJ, Thompson EW, et al. RASSF1A Suppression as a Potential Regulator of Mechano-Pathobiology Associated with Mammographic Density in BRCA Mutation Carriers. Cancers. 2021; 13(13):3251. https://doi.org/10.3390/cancers13133251
Chicago/Turabian StyleReye, Gina, Xuan Huang, Kara L. Britt, Christoph Meinert, Tony Blick, Yannan Xu, Konstantin I. Momot, Thomas Lloyd, Jason J. Northey, Erik W. Thompson, and et al. 2021. "RASSF1A Suppression as a Potential Regulator of Mechano-Pathobiology Associated with Mammographic Density in BRCA Mutation Carriers" Cancers 13, no. 13: 3251. https://doi.org/10.3390/cancers13133251
APA StyleReye, G., Huang, X., Britt, K. L., Meinert, C., Blick, T., Xu, Y., Momot, K. I., Lloyd, T., Northey, J. J., Thompson, E. W., & Hugo, H. J. (2021). RASSF1A Suppression as a Potential Regulator of Mechano-Pathobiology Associated with Mammographic Density in BRCA Mutation Carriers. Cancers, 13(13), 3251. https://doi.org/10.3390/cancers13133251