Loss of Two-Pore Channel 2 (TPC2) Expression Increases the Metastatic Traits of Melanoma Cells by a Mechanism Involving the Hippo Signalling Pathway and Store-Operated Calcium Entry
Abstract
1. Introduction
2. Results
2.1. Association between TPC2 Expression and the Prognosis of Melanoma Patients
2.2. TPC2 Depletion Impairs Human Melanoma Cell Adhesion Mediated by α2β1 Integrin Receptor
2.3. TPC2 Inhibition in Human Melanoma Cells Increases Their Invasion Capability
2.4. TPC2 and HIPPO Pathway Connection in CHL1 and MeWo Metastatic Cell Lines
2.5. PD-L1 Induced by INTERFERON-γ Is Significantly Higher in CHL1 TPC2 KO Cells
2.6. TPC2 Regulates YAP/TAZ Activity Modulating ORAI 1 Channel Expression
2.7. TPC2 Is Overexpressed while YAP/TAZ Target Genes Are Down Regulated after Vemurafenib Treatment in A375 Melanoma Cells
3. Discussion
4. Materials and Methods
4.1. Cell Lines
4.2. Western Blot Analysis
4.3. CRISPR Design
4.4. Cell Transfection
4.5. Adhesion Assay
4.6. Invasion Assay
4.7. Flow Cytometry and Cell Cycle Analysis
4.8. Bioinformatic Analysis
4.9. Quantitative Real-Time PCR
4.10. Gelatin Zymography for Matrix Metalloproteinases (MMPs) Detection
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Uong, A.; Zon, L.I. Melanocytes in development and cancer. J. Cell Physiol. 2010, 222, 38–41. [Google Scholar] [CrossRef] [PubMed]
- Shain, A.H.; Bastian, B.C. From melanocytes to melanomas. Nat. Rev. Cancer 2016, 16, 345–358. [Google Scholar] [CrossRef] [PubMed]
- Zhu, M.X.; Ma, J.; Parrington, J.; Calcraft, P.J.; Galione, A.; Evans, A.M. Calcium signaling via two-pore channels: Local or global, that is the question. Am. J. Physiol. Cell Physiol. 2010, 298, C430–C441. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zhang, X.; Dong, X.P.; Samie, M.; Li, X.; Cheng, X.; Goschka, A.; Shen, D.; Zhou, Y.; Harlow, J.; et al. TPC proteins are phosphoinositide- activated sodium-selective ion channels in endosomes and lysosomes. Cell 2012, 151, 372–383. [Google Scholar] [CrossRef] [PubMed]
- Cang, C.; Zhou, Y.; Navarro, B.; Seo, Y.J.; Aranda, K.; Shi, L.; Battaglia-Hsu, S.; Nissim, I.; Clapham, D.E.; Ren, D. mTOR regulates lysosomal ATP-sensitive two-pore Na(+) channels to adapt to metabolic state. Cell 2013, 152, 778–790. [Google Scholar] [CrossRef]
- Pitt, S.J.; Reilly-O’Donnell, B.; Sitsapesan, R. Exploring the biophysical evidence that mammalian two-pore channels are NAADP-activated calcium-permeable channels. J. Physiol. 2016, 594, 4171–4179. [Google Scholar] [CrossRef]
- Calcraft, P.J.; Ruas, M.; Pan, Z.; Cheng, X.; Arredouani, A.; Hao, X.; Tang, J.; Rietdorf, K.; Teboul, L.; Chuang, K.T.; et al. NAADP mobilizes calcium from acidic organelles through two-pore channels. Nature 2009, 459, 596–600. [Google Scholar] [CrossRef]
- Galione, A. NAADP receptors. Cold Spring Harb. Perspect. Biol. 2011, 3, a004036. [Google Scholar] [CrossRef]
- Ruas, M.; Davis, L.C.; Chen, C.C.; Morgan, A.J.; Chuang, K.T.; Walseth, T.F.; Grimm, C.; Garnham, C.; Powell, T.; Platt, N.; et al. Expression of Ca(2)(+)-permeable two-pore channels rescues NAADP signalling in TPC-deficient cells. EMBO J. 2015, 34, 1743–1758. [Google Scholar] [CrossRef]
- Lin-Moshier, Y.; Walseth, T.F.; Churamani, D.; Davidson, S.M.; Slama, J.T.; Hooper, R.; Brailoiu, E.; Patel, S.; Marchant, J.S. Photoaffinity labeling of nicotinic acid adenine dinucleotide phosphate (NAADP) targets in mammalian cells. J. Biol. Chem. 2012, 287, 2296–2307. [Google Scholar] [CrossRef]
- Walseth, T.F.; Lin-Moshier, Y.; Jain, P.; Ruas, M.; Parrington, J.; Galione, A.; Marchant, J.S.; Slama, J.T. Photoaffinity labeling of high affinity nicotinic acid adenine dinucleotide phosphate (NAADP)-binding proteins in sea urchin egg. J. Biol. Chem. 2012, 287, 2308–2315. [Google Scholar] [CrossRef] [PubMed]
- Jha, A.; Ahuja, M.; Patel, S.; Brailoiu, E.; Muallem, S. Convergent regulation of the lysosomal two-pore channel-2 by Mg(2)(+), NAADP, PI(3,5)P(2) and multiple protein kinases. EMBO J. 2014, 33, 501–511. [Google Scholar] [CrossRef]
- Gerndt, S.; Chen, C.C.; Chao, Y.K.; Yuan, Y.; Burgstaller, S.; Scotto Rosato, A.; Krogsaeter, E.; Urban, N.; Jacob, K.; Nguyen, O.N.P.; et al. Agonist-mediated switching of ion selectivity in TPC2 differentially promotes lysosomal function. Elife 2020, 9, e54712. [Google Scholar] [CrossRef] [PubMed]
- Favia, A.; Desideri, M.; Gambara, G.; D’Alessio, A.; Ruas, M.; Esposito, B.; Del Bufalo, D.; Parrington, J.; Ziparo, E.; Palombi, F.; et al. VEGF-induced neoangiogenesis is mediated by NAADP and two-pore channel-2-dependent Ca2+ signaling. Proc. Natl. Acad. Sci. USA 2014, 111, E4706–E4715. [Google Scholar] [CrossRef]
- Islam, M.S. Molecular Regulations and Functions of the Transient Receptor Potential Channels of the Islets of Langerhans and Insulinoma Cells. Cells 2020, 9, 685. [Google Scholar] [CrossRef] [PubMed]
- Lewis, R.S. The molecular choreography of a store-operated calcium channel. Nature 2007, 446, 284–287. [Google Scholar] [CrossRef]
- Hooper, R.; Zaidi, M.R.; Soboloff, J. The heterogeneity of store-operated calcium entry in melanoma. Sci. China Life Sci. 2016, 59, 764–769. [Google Scholar] [CrossRef][Green Version]
- Hui, L.; Geiger, N.H.; Bloor-Young, D.; Churchill, G.C.; Geiger, J.D.; Chen, X. Release of calcium from endolysosomes increases calcium influx through N-type calcium channels: Evidence for acidic store-operated calcium entry in neurons. Cell Calcium 2015, 58, 617–627. [Google Scholar] [CrossRef]
- Sbano, L.; Bonora, M.; Marchi, S.; Baldassari, F.; Medina, D.L.; Ballabio, A.; Giorgi, C.; Pinton, P. TFEB-mediated increase in peripheral lysosomes regulates store-operated calcium entry. Sci. Rep. 2017, 7, 40797. [Google Scholar] [CrossRef]
- Han, Y. Analysis of the role of the Hippo pathway in cancer. J. Transl. Med. 2019, 17, 116. [Google Scholar] [CrossRef]
- Yu, F.X.; Zhao, B.; Guan, K.L. Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer. Cell 2015, 163, 811–828. [Google Scholar] [CrossRef] [PubMed]
- Zanconato, F.; Battilana, G.; Forcato, M.; Filippi, L.; Azzolin, L.; Manfrin, A.; Quaranta, E.; Di Biagio, D.; Sigismondo, G.; Guzzardo, V.; et al. Transcriptional addiction in cancer cells is mediated by YAP/TAZ through BRD4. Nat. Med. 2018, 24, 1599–1610. [Google Scholar] [CrossRef] [PubMed]
- Menzel, M.; Meckbach, D.; Weide, B.; Toussaint, N.C.; Schilbach, K.; Noor, S.; Eigentler, T.; Ikenberg, K.; Busch, C.; Quintanilla-Martinez, L.; et al. In melanoma, Hippo signaling is affected by copy number alterations and YAP1 overexpression impairs patient survival. Pigment Cell Melanoma Res. 2014, 27, 671–673. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, O.N.; Grimm, C.; Schneider, L.S.; Chao, Y.K.; Atzberger, C.; Bartel, K.; Watermann, A.; Ulrich, M.; Mayr, D.; Wahl-Schott, C.; et al. Two-Pore Channel Function Is Crucial for the Migration of Invasive Cancer Cells. Cancer Res. 2017, 77, 1427–1438. [Google Scholar] [CrossRef] [PubMed]
- Ran, J.; Lin, D.L.; Wu, R.F.; Chen, Q.H.; Huang, H.P.; Qiu, N.X.; Quan, S. ZEB1 promotes epithelial-mesenchymal transition in cervical cancer metastasis. Fertil. Steril. 2015, 103, 1606–1614.e2. [Google Scholar] [CrossRef] [PubMed]
- Satelli, A.; Li, S. Vimentin in cancer and its potential as a molecular target for cancer therapy. Cell Mol. Life Sci. 2011, 68, 3033–3046. [Google Scholar] [CrossRef]
- Beuret, L.; Flori, E.; Denoyelle, C.; Bille, K.; Busca, R.; Picardo, M.; Bertolotto, C.; Ballotti, R. Up-regulation of MET expression by alpha-melanocyte-stimulating hormone and MITF allows hepatocyte growth factor to protect melanocytes and melanoma cells from apoptosis. J. Biol. Chem. 2007, 282, 14140–14147. [Google Scholar] [CrossRef]
- Gentile, A.; Trusolino, L.; Comoglio, P.M. The Met tyrosine kinase receptor in development and cancer. Cancer Metastasis Rev. 2008, 27, 85–94. [Google Scholar] [CrossRef]
- Dobrokhotov, O.; Samsonov, M.; Sokabe, M.; Hirata, H. Mechanoregulation and pathology of YAP/TAZ via Hippo and non-Hippo mechanisms. Clin. Transl. Med. 2018, 7, 23. [Google Scholar] [CrossRef]
- Hoj, J.P.; Mayro, B.; Pendergast, A.M. A TAZ-AXL-ABL2 Feed-Forward Signaling Axis Promotes Lung Adenocarcinoma Brain Metastasis. Cell Rep. 2019, 29, 3421–3434. [Google Scholar] [CrossRef]
- Dupont, S.; Morsut, L.; Aragona, M.; Enzo, E.; Giulitti, S.; Cordenonsi, M.; Zanconato, F.; Le Digabel, J.; Forcato, M.; Bicciato, S.; et al. Role of YAP/TAZ in mechanotransduction. Nature 2011, 474, 179–183. [Google Scholar] [CrossRef] [PubMed]
- Janse van Rensburg, H.J.; Azad, T.; Ling, M.; Hao, Y.; Snetsinger, B.; Khanal, P.; Minassian, L.M.; Graham, C.H.; Rauh, M.J.; Yang, X. The Hippo Pathway Component TAZ Promotes Immune Evasion in Human Cancer through PD-L1. Cancer Res. 2018, 78, 1457–1470. [Google Scholar] [CrossRef] [PubMed]
- Luo, N.; Formisano, L.; Gonzalez-Ericsson, P.I.; Sanchez, V.; Dean, P.T.; Opalenik, S.R.; Sanders, M.E.; Cook, R.S.; Arteaga, C.L.; Johnson, D.B.; et al. Melanoma response to anti-PD-L1 immunotherapy requires JAK1 signaling, but not JAK2. Oncoimmunology 2018, 7, e1438106. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Sun, A.; Zhao, Y.; Ying, W.; Sun, H.; Yang, X.; Xing, B.; Sun, W.; Ren, L.; Hu, B.; et al. Proteomics identifies new therapeutic targets of early-stage hepatocellular carcinoma. Nature 2019, 567, 257–261. [Google Scholar] [CrossRef]
- Mercer, J.C.; Dehaven, W.I.; Smyth, J.T.; Wedel, B.; Boyles, R.R.; Bird, G.S.; Putney, J.W., Jr. Large store-operated calcium selective currents due to co-expression of Orai1 or Orai2 with the intracellular calcium sensor, Stim1. J. Biol. Chem. 2006, 281, 24979–24990. [Google Scholar] [CrossRef]
- Liu, Z.; Wei, Y.; Zhang, L.; Yee, P.P.; Johnson, M.; Zhang, X.; Gulley, M.; Atkinson, J.M.; Trebak, M.; Wang, H.G.; et al. Induction of store-operated calcium entry (SOCE) suppresses glioblastoma growth by inhibiting the Hippo pathway transcriptional coactivators YAP/TAZ. Oncogene 2019, 38, 120–139. [Google Scholar] [CrossRef]
- Parmenter, T.J.; Kleinschmidt, M.; Kinross, K.M.; Bond, S.T.; Li, J.; Kaadige, M.R.; Rao, A.; Sheppard, K.E.; Hugo, W.; Pupo, G.M.; et al. Response of BRAF-mutant melanoma to BRAF inhibition is mediated by a network of transcriptional regulators of glycolysis. Cancer Discov. 2014, 4, 423–433. [Google Scholar] [CrossRef]
- Garraway, L.A.; Widlund, H.R.; Rubin, M.A.; Getz, G.; Berger, A.J.; Ramaswamy, S.; Beroukhim, R.; Milner, D.A.; Granter, S.R.; Du, J.; et al. Integrative genomic analyses identify MITF as a lineage survival oncogene amplified in malignant melanoma. Nature 2005, 436, 117–122. [Google Scholar] [CrossRef]
- Ambrosio, A.L.; Boyle, J.A.; Aradi, A.E.; Christian, K.A.; Di Pietro, S.M. TPC2 controls pigmentation by regulating melanosome pH and size. Proc. Natl. Acad. Sci. USA 2016, 113, 5622–5627. [Google Scholar] [CrossRef]
- Bellono, N.W.; Escobar, I.E.; Oancea, E. A melanosomal two-pore sodium channel regulates pigmentation. Sci. Rep. 2016, 6, 26570. [Google Scholar] [CrossRef]
- Lin, P.H.; Duann, P.; Komazaki, S.; Park, K.H.; Li, H.; Sun, M.; Sermersheim, M.; Gumpper, K.; Parrington, J.; Galione, A.; et al. Lysosomal two-pore channel subtype 2 (TPC2) regulates skeletal muscle autophagic signaling. J. Biol. Chem. 2015, 290, 3377–3389. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.Y.; Hao, B.X.; Graeff, R.; Wong, C.W.M.; Wu, W.T.; Yue, J. Two pore channel 2 (TPC2) inhibits autophagosomal-lysosomal fusion by alkalinizing lysosomal pH. J. Biol. Chem. 2017, 292, 12088. [Google Scholar] [CrossRef] [PubMed]
- Giurisato, E.; Gamberucci, A.; Ulivieri, C.; Marruganti, S.; Rossi, E.; Giacomello, E.; Randazzo, D.; Sorrentino, V. The KSR2-calcineurin complex regulates STIM1-ORAI1 dynamics and store-operated calcium entry (SOCE). Mol. Biol. Cell 2014, 25, 1769–1781. [Google Scholar] [CrossRef] [PubMed]
- Piovesana, R.; Faroni, A.; Taggi, M.; Matera, A.; Soligo, M.; Canipari, R.; Manni, L.; Reid, A.J.; Tata, A.M. Muscarinic receptors modulate Nerve Growth Factor production in rat Schwann-like adipose-derived stem cells and in Schwann cells. Sci. Rep. 2020, 10, 7159. [Google Scholar] [CrossRef]







| Gene | Forward | Reverse | 
|---|---|---|
| CTGF | AGGAGTGGGTGTGTGACGA | CCAGGCAGTTGGCTCTAATC | 
| CYR61 | CCTTGTGGACAGCCAGTGTA | ACTTGGGCCGGTATTTCTTC | 
| ANKRD1 | AGTAGAGGAACTGGTCACTGG | TGGGCTAGAAGTGTCTTCAGAT | 
| YAP | GCACCTCTGTGTTTTAAGGGTCT | CAACTTTTGCCCTCCTCCAA | 
| TAZ(WWTR1) | GGCTGGGAGATGACCTTCAC | CTGAGTGGGGTGGTTCTGCT | 
| GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG | 
| STIM | ATCTCACAGCTCATGGTATGCTCC | GGAAGGTGCCAAAGAGTGTGTTTC | 
| ORAI | TACTTGAGCCGCGCCAAGCTTAAA | ACCGAGTTGAGATTGTGCACGTTG | 
| PKCβII | GACCAAACACCCAGGCAAAC | GATGGCGGGTGAAAAATCGG | 
| INF2 | CACATCCAACGTGATGGTGAAG | GGAGAGCTCGTTCATGACAATG | 
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
D’Amore, A.; Hanbashi, A.A.; Di Agostino, S.; Palombi, F.; Sacconi, A.; Voruganti, A.; Taggi, M.; Canipari, R.; Blandino, G.; Parrington, J.; et al. Loss of Two-Pore Channel 2 (TPC2) Expression Increases the Metastatic Traits of Melanoma Cells by a Mechanism Involving the Hippo Signalling Pathway and Store-Operated Calcium Entry. Cancers 2020, 12, 2391. https://doi.org/10.3390/cancers12092391
D’Amore A, Hanbashi AA, Di Agostino S, Palombi F, Sacconi A, Voruganti A, Taggi M, Canipari R, Blandino G, Parrington J, et al. Loss of Two-Pore Channel 2 (TPC2) Expression Increases the Metastatic Traits of Melanoma Cells by a Mechanism Involving the Hippo Signalling Pathway and Store-Operated Calcium Entry. Cancers. 2020; 12(9):2391. https://doi.org/10.3390/cancers12092391
Chicago/Turabian StyleD’Amore, Antonella, Ali Ahmed Hanbashi, Silvia Di Agostino, Fioretta Palombi, Andrea Sacconi, Aniruddha Voruganti, Marilena Taggi, Rita Canipari, Giovanni Blandino, John Parrington, and et al. 2020. "Loss of Two-Pore Channel 2 (TPC2) Expression Increases the Metastatic Traits of Melanoma Cells by a Mechanism Involving the Hippo Signalling Pathway and Store-Operated Calcium Entry" Cancers 12, no. 9: 2391. https://doi.org/10.3390/cancers12092391
APA StyleD’Amore, A., Hanbashi, A. A., Di Agostino, S., Palombi, F., Sacconi, A., Voruganti, A., Taggi, M., Canipari, R., Blandino, G., Parrington, J., & Filippini, A. (2020). Loss of Two-Pore Channel 2 (TPC2) Expression Increases the Metastatic Traits of Melanoma Cells by a Mechanism Involving the Hippo Signalling Pathway and Store-Operated Calcium Entry. Cancers, 12(9), 2391. https://doi.org/10.3390/cancers12092391
 
        



 
       