Common and Unique Transcription Signatures of YAP and TAZ in Gastric Cancer Cells
Abstract
:Simple Summary
Abstract
1. Introduction
2. Results
2.1. Generation of RNA-seq Data to Examine YAP and TAZ Effects on Transcription in Gastric Cancer MKN28 Cells
2.2. Comprehensive Identification of YAP- and TAZ-Transcriptional Targets in Human Gastric Cancer MKN28 Cells
2.3. Common and Unique Transcription Signatures of YAP and TAZ in Gastric Cancer Cells
2.4. YAP Is Indispensable for Adhesion to the Cell Substrate upon Altering Its Rigidity
3. Discussion
4. Materials and Methods
4.1. Cell Culture and PAA Hydrogel-Coated Dishes
4.2. Generation of CRISPR/Cas9 YAP and TAZ Knock-Outs and Overexpression of YAP or TAZ
4.3. Protein Isolation and Western Blot
4.4. Immunofluorescent (IF) Staining and Confocal Microscopy
4.5. RNA Sample Preparation and RNA-seq
4.6. RNA-seq Data Analysis
4.7. RNA Isolation and Quantitative Reverse Transcription PCR (RT-qPCR) Assay
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Huang, J.; Wu, S.; Barrera, J.; Matthews, K.; Pan, D. The Hippo Signaling Pathway Coordinately Regulates Cell Proliferation and Apoptosis by Inactivating Yorkie, the Drosophila Homolog of YAP. Cell 2005, 122, 421–434. [Google Scholar] [CrossRef] [Green Version]
- Calses, P.C.; Crawford, J.J.; Lill, J.R.; Dey, A. Hippo Pathway in Cancer: Aberrant Regulation and Therapeutic Opportunities. Trends Cancer 2019, 5, 297–307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Finch-Edmondson, M.; Sudol, M. Framework to function: Mechanosensitive regulators of gene transcription. Cell. Mol. Biol. Lett. 2016, 21, 28. [Google Scholar] [CrossRef] [PubMed]
- Morin-Kensicki, E.M.; Boone, B.N.; Howell, M.; Stonebraker, J.R.; Teed, J.; Alb, J.G.; Magnuson, T.R.; O’Neal, W.; Milgram, S.L. Defects in Yolk Sac Vasculogenesis, Chorioallantoic Fusion, and Embryonic Axis Elongation in Mice with Targeted Disruption of Yap65. Mol. Cell. Biol. 2006, 26, 77–87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hossain, Z.; Ali, S.M.; Ko, H.L.; Xu, J.; Ng, C.P.; Guo, K.; Qi, Z.; Ponniah, S.; Hong, W.; Hunziker, W. Glomerulocystic kidney disease in mice with a targeted inactivation of Wwtr1. Proc. Natl. Acad. Sci. USA 2007, 104, 1631–1636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Makita, R.; Uchijima, Y.; Nishiyama, K.; Amano, T.; Chen, Q.; Takeuchi, T.; Mitani, A.; Nagase, T.; Yatomi, Y.; Aburatani, H.; et al. Multiple renal cysts, urinary concentration defects, and pulmonary emphysematous changes in mice lacking TAZ. Am. J. Physiol. Physiol. 2008, 294, F542–F553. [Google Scholar] [CrossRef]
- Panciera, T.; Azzolin, L.; Cordenonsi, M.; Piccolo, S. Mechanobiology of YAP and TAZ in physiology and disease. Nat. Rev. Mol. Cell Biol. 2017, 18, 758–770. [Google Scholar] [CrossRef]
- Low, B.C.; Pan, C.Q.; Shivashankar, G.; Bershadsky, A.; Sudol, M.; Sheetz, M.P. YAP/TAZ as mechanosensors and mechanotransducers in regulating organ size and tumor growth. FEBS Lett. 2014, 588, 2663–2670. [Google Scholar] [CrossRef] [Green Version]
- Zanconato, F.; Cordenonsi, M.; Piccolo, S. YAP and TAZ: A signalling hub of the tumour microenvironment. Nat. Rev. Cancer 2019, 19, 454–464. [Google Scholar] [CrossRef]
- Zanconato, F.; Cordenonsi, M.; Piccolo, S. YAP/TAZ at the Roots of Cancer. Cancer Cell 2016, 29, 783–803. [Google Scholar] [CrossRef]
- Motoyama, T.; Hojo, H.; Watanabe, H. Comparison of seven cell lines derived from human gastric carcinomas. Pathol. Int. 1986, 36, 65–83. [Google Scholar] [CrossRef] [PubMed]
- Finch-Edmondson, M.L.; Strauss, R.P.; Passman, A.M.; Sudol, M.; Yeoh, G.C.; Callus, B.A. TAZ Protein Accumulation Is Negatively Regulated by YAP Abundance in Mammalian Cells. J. Biol. Chem. 2015, 290, 27928–27938. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, B.; Wei, X.; Li, W.; Udan, R.S.; Yang, Q.; Kim, J.; Xie, J.; Ikenoue, T.; Yu, J.; Li, L.; et al. Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes Dev. 2007, 21, 2747–2761. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meng, Z.; Moroishi, T.; Guan, K.-L. Mechanisms of Hippo pathway regulation. Genes Dev. 2016, 30, 1–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lei, Q.-Y.; Zhang, H.; Zhao, B.; Zha, Z.-Y.; Bai, F.; Pei, X.-H.; Zhao, S.; Xiong, Y.; Guan, K.-L. TAZ Promotes Cell Proliferation and Epithelial-Mesenchymal Transition and Is Inhibited by the Hippo Pathway. Mol. Cell. Biol. 2008, 28, 2426–2436. [Google Scholar] [CrossRef] [Green Version]
- de Hoon, M.; Imoto, S.; Nolan, J.; Miyano, S. Open source clustering software. Bioinformatics 2004, 20, 1453–1454. [Google Scholar] [CrossRef] [Green Version]
- Tarazona, S.; Furió-Tarí, P.; Turrà, D.; di Pietro, A.; Nueda, M.J.; Ferrer, A.; Conesa, A. Data quality aware analysis of differential expression in RNA-seq with NOISeq R/Bioc package. Nucleic Acids Res. 2015, 43, e140. [Google Scholar] [CrossRef] [Green Version]
- Lin, K.C.; Park, H.W.; Guan, K.-L. Regulation of the Hippo Pathway Transcription Factor TEAD. Trends Biochem. Sci. 2017, 42, 862–872. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. Cluster Profiler: An R Package for Comparing Biological Themes Among Gene Clusters. OMICS A J. Integr. Biol. 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Janmey, P.A.; Fletcher, D.A.; Reinhart-King, C.A. Stiffness Sensing by Cells. Physiol. Rev. 2020, 100, 695–724. [Google Scholar] [CrossRef]
- Qiao, Y.; Chen, J.; Lim, Y.B.; Finch-Edmondson, M.L.; Seshachalam, V.P.; Qin, L.; Jiang, T.; Low, B.C.; Singh, H.; Lim, C.T.; et al. YAP Regulates Actin Dynamics through ARHGAP29 and Promotes Metastasis. Cell Rep. 2017, 19, 1495–1502. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wolfenson, H.; Lavelin, I.; Geiger, B. Dynamic Regulation of the Structure and Functions of Integrin Adhesions. Dev. Cell 2013, 24, 447–458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Korporaal, S.; Akkerman, J. Platelet Signaling Induced by Lipoproteins. Cardiovasc. Hematol. Agents Med. Chem. 2006, 4, 93–109. [Google Scholar] [CrossRef]
- Siegel-Axel, D.I.; Daub, K.; Seizer, P.; Lindemann, S.; Gawaz, M. Platelet lipoprotein interplay: Trigger of foam cell formation and driver of atherosclerosis. Cardiovasc. Res. 2008, 78, 8–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ross, J.S.; E Stagliano, N.; Donovan, M.J.; E Breitbart, R.; Ginsburg, G.S. Atherosclerosis and cancer: Common molecular pathways of disease development and progression. Ann. N. Y. Acad. Sci. 2001, 947, 292–293. [Google Scholar] [CrossRef]
- Ross, J.S.; Stagliano, N.E.; Donovan, M.J.; Breitbart, R.E.; Ginsburg, G.S. Atherosclerosis. Pathol. Patterns Rev. 2001, 116, S97–S107. [Google Scholar] [CrossRef] [PubMed]
- Palacios-Acedo, A.L.; Mège, D.; Crescence, L.; Dignat-George, F.; Dubois, C.; Panicot-Dubois, L. Platelets, Thrombo-Inflammation, and Cancer: Collaborating with the Enemy. Front. Immunol. 2019, 10, 1805. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Luo, J.-Y.; Li, B.; Tian, X.Y.; Chen, L.-J.; Huang, Y.; Liu, J.; Deng, D.; Lau, C.W.; Wan, S.; et al. Integrin-YAP/TAZ-JNK cascade mediates atheroprotective effect of unidirectional shear flow. Nat. Cell Biol. 2016, 540, 579–582. [Google Scholar] [CrossRef]
- Wang, K.-C.; Yeh, Y.-T.; Nguyen, P.; Limqueco, E.; Lopez, J.; Thorossian, S.; Guan, K.-L.; Li, Y.-S.J.; Chien, S. Flow-dependent YAP/TAZ activities regulate endothelial phenotypes and atherosclerosis. Proc. Natl. Acad. Sci. USA 2016, 113, 11525–11530. [Google Scholar] [CrossRef] [Green Version]
- Nardone, G.; La Cruz, J.O.-D.; Vrbsky, J.; Martini, C.; Pribyl, J.; Skládal, P.; Pešl, M.; Caluori, G.; Pagliari, S.; Martino, F.; et al. YAP regulates cell mechanics by controlling focal adhesion assembly. Nat. Commun. 2017, 8, 15321. [Google Scholar] [CrossRef]
- Lee, H.J.; Diaz, M.F.; Price, K.M.; Ozuna, J.A.; Zhang, S.; Sevick-Muraca, E.M.; Hagan, J.P.; Wenzel, P.L. Fluid shear stress activates YAP1 to promote cancer cell motility. Nat. Commun. 2017, 8, 14122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Paoli, P.; Giannoni, E.; Chiarugi, P. Anoikis molecular pathways and its role in cancer progression. Biochim. Biophys. Acta Bioenerg. 2013, 1833, 3481–3498. [Google Scholar] [CrossRef] [Green Version]
- Simpson, C.D.; Anyiwe, K.; Schimmer, A.D. Anoikis resistance and tumor metastasis. Cancer Lett. 2008, 272, 177–185. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Ng, J.M.-K.; Wong, C.C.; Ng, E.K.W.; Yu, J. Molecular alterations of cancer cell and tumour microenvironment in metastatic gastric cancer. Oncogene 2018, 37, 4903–4920. [Google Scholar] [CrossRef] [PubMed]
- Zhao, B.; Li, L.; Wang, L.; Wang, C.-Y.; Yu, J.; Guan, K.-L. Cell detachment activates the Hippo pathway via cytoskeleton reorganization to induce anoikis. Genes Dev. 2012, 26, 54–68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haemmerle, M.; Taylor, M.L.; Gutschner, T.; Pradeep, S.; Cho, M.S.; Sheng, J.; Lyons, Y.M.; Nagaraja, A.S.; Dood, R.L.; Wen, Y.; et al. Platelets reduce anoikis and promote metastasis by activating YAP1 signaling. Nat. Commun. 2017, 8, 1–15. [Google Scholar] [CrossRef]
- Gaffney, C.J.; Oka, T.; Mazack, V.; Hilman, D.; Gat, U.; Muramatsu, T.; Inazawa, J.; Golden, A.; Carey, D.J.; Farooq, A.; et al. Identification, basic characterization and evolutionary analysis of differentially spliced mRNA isoforms of human YAP1 gene. Gene 2012, 509, 215–222. [Google Scholar] [CrossRef] [Green Version]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, 36. [Google Scholar] [CrossRef] [Green Version]
- Trapnell, C.; Hendrickson, D.G.; Sauvageau, M.; Goff, L.A.; Rinn, J.L.; Pachter, L. Differential analysis of gene regulation at transcript resolution with RNA-seq. Nat. Biotechnol. 2013, 31, 46–53. [Google Scholar] [CrossRef]
- R Core Team. A Language and Environment for Statistical Computing. R Foundation for Statistical Computing. Available online: https://www.R-project.org (accessed on 27 April 2020).
- Saldanha, A.J. Java Treeview—Extensible visualization of microarray data. Bioinformatics 2004, 20, 3246–3248. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward | Reverse |
---|---|---|
PARVA | AGAAAGCCAAGGAGGTGTCCG | TCCAGCTCAAAGGGAATTGGG |
FHL2 | GCATTTTGACTTTGGGGTTGCT | AGATTCGTTGCAATGGTGGC |
AJUBA | AGGTTCCAGCCCCTTCTCTAT | CTCCTGAAACCCTGAAAACAGAT |
BCAR1 | ATCCCTGCCTCAGAAACGTG | CACCGTCATGATGTCACCCT |
LIMS2 | CACCATGACGGGAAGCAATATGT | GCTGTTGACAATGCGCTCG |
DPP4 | GCCGACGATGAAGACACCG | TTTGTTCAGCAGAACCACGGG |
CYR61 | TCCCTGTTTTTGGAATGGAG | GAGCACTGGGACCATGAAGT |
CTGF | TGCATCCGTACTCCCAAAAT | ATGTCTTCATGCTGGTGCAG |
HPRT1 | ATGGACAGGACTGAACGTCTT | TCCAGCAGGTCAGCAAAGAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, Y.; Finch-Edmondson, M.; Cognart, H.; Zhu, B.; Song, H.; Low, B.C.; Sudol, M. Common and Unique Transcription Signatures of YAP and TAZ in Gastric Cancer Cells. Cancers 2020, 12, 3667. https://doi.org/10.3390/cancers12123667
Lee Y, Finch-Edmondson M, Cognart H, Zhu B, Song H, Low BC, Sudol M. Common and Unique Transcription Signatures of YAP and TAZ in Gastric Cancer Cells. Cancers. 2020; 12(12):3667. https://doi.org/10.3390/cancers12123667
Chicago/Turabian StyleLee, Yaelim, Megan Finch-Edmondson, Hamizah Cognart, Bowen Zhu, Haiwei Song, Boon Chuan Low, and Marius Sudol. 2020. "Common and Unique Transcription Signatures of YAP and TAZ in Gastric Cancer Cells" Cancers 12, no. 12: 3667. https://doi.org/10.3390/cancers12123667
APA StyleLee, Y., Finch-Edmondson, M., Cognart, H., Zhu, B., Song, H., Low, B. C., & Sudol, M. (2020). Common and Unique Transcription Signatures of YAP and TAZ in Gastric Cancer Cells. Cancers, 12(12), 3667. https://doi.org/10.3390/cancers12123667