A Portable, Integrated, Sample-In Result-Out Nucleic Acid Diagnostic Device for Rapid and Sensitive Chikungunya Virus Detection
Abstract
1. Introduction
2. Materials and Methods
2.1. Clinical Specimens, Virus Isolates, and Viral RNA Extraction
2.2. Preparation of CHIKV RNA Standards
2.3. RT-LAMP Reaction and Analysis of RT-LAMP Amplicons
2.4. Optimization of RT-LAMP
2.5. RT-qPCR Assay
2.6. AutoLAMP-Based CHIKV Detection
2.7. Sensitivity and Specificity
3. Results
3.1. Illustration of AutoLAMP-Based RT-LAMP-LFD CHIKV Detection
3.2. RT-LAMP Using LFD for CHIKV Detection
3.3. Optimization of RT-LAMP-LFD for the AutoLAMP
3.4. Specificity and Sensitivity of AutoLAMP-Based CHIKV Detection
3.5. Evaluation of AutoLAMP Assay with Clinical Samples
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Burt, F.J.; Chen, W.; Miner, J.J.; Lenschow, D.J.; Merits, A.; Schnettler, E.; Kohl, A.; Rudd, P.A.; Taylor, A.; Herrero, L.; et al. Chikungunya virus: An update on the biology and pathogenesis of this emerging pathogen. Lancet Infect. Dis. 2017, 17, e107–e117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Graf, T.; Vazquez, C.; Giovanetti, M.; de Bruycker-Nogueira, F.; Fonseca, V.; Claro, I.M.; de Jesus, J.G.; Gomez, A.; Xavier, J.; de Mendonca, M.C.L.; et al. Epidemiologic History and Genetic Diversity Origins of Chikungunya and Dengue Viruses, Paraguay. Emerg. Infect. Dis. 2021, 27, 1393–1404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rafe, M.R.; Ahmed, S.N.; Ahmed, Z. Origins, pathophysiology, diagnosis, vaccination and prevention of Chikungunya virus. Curr. Issues Pharm. Med. Sci. 2019, 32, 40–44. [Google Scholar] [CrossRef] [Scilit]
- Silva, J.V.J., Jr.; Ludwig-Begall, L.F.; de Oliveira-Filho, E.F.; Oliveira, R.A.S.; Durães-Carvalho, R.; Lopes, T.R.R.; Silva, D.E.A.; Gil, L.H.V.G. A scoping review of Chikungunya virus infection: Epidemiology, clinical characteristics, viral co-circulation complications, and control. Acta Trop. 2018, 188, 213–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quick, J.; Grubaugh, N.D.; Pullan, S.T.; Claro, I.M.; Smith, A.D.; Gangavarapu, K.; Oliveira, G.; Robles-Sikisaka, R.; Rogers, T.F.; A Beutler, N.; et al. Multiplex PCR method for MinION and Illumina sequencing of Zika and other virus genomes directly from clinical samples. Nat. Protoc. 2017, 12, 1261–1276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Banerjee, T.; Patel, T.; Pashchenko, O.; Elliott, R.; Santra, S. Rapid Detection and One-Step Differentiation of Cross-Reactivity Between Zika and Dengue Virus Using Functional Magnetic Nanosensors. ACS Appl. Bio. Mater. 2021, 4, 3786–3795. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Falzone, L.; Gattuso, G.; Tsatsakis, A.; Spandidos, D.A.; Libra, M. Current and innovative methods for the diagnosis of COVID-19 infection (Review). Int. J. Mol. Med. 2021, 47, 100. [Google Scholar] [CrossRef] [Scilit]
- Álvarez-Díaz, D.A.; Valencia-Álvarez, E.; Rivera, J.A.; Rengifo, A.C.; Usme-Ciro, J.A.; Peláez-Carvajal, D.; Lozano-Jiménez, Y.Y.; Torres-Fernández, O. An updated RT-qPCR assay for the simultaneous detection and quantification of chikungunya, dengue and zika viruses. Infect. Genet. Evol. 2021, 93, 104967. [Google Scholar] [CrossRef] [Scilit]
- Renzoni, A.; Perez, F.; Nsoga, M.T.N.; Yerly, S.; Boehm, E.; Gayet-Ageron, A.; Kaiser, L.; Schibler, M. Analytical Evaluation of Visby Medical RT-PCR Portable Device for Rapid Detection of SARS-CoV-2. Diagnostics 2021, 11, 813. [Google Scholar] [CrossRef] [Scilit]
- Lan, Z.; Guo, Y.; Wang, K.; Zhang, Y.; Chen, Y.; Zheng, D.; Xu, X.; Wu, W. Hundreds-Dollar-Level Multiplex Integrated RT-qPCR Quantitative System for Field Detection. Biosensors 2022, 12, 706. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Chen, F.; Li, Q.; Wang, L.; Fan, C. Isothermal Amplification of Nucleic Acids. Chem. Rev. 2015, 115, 12491–12545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lillis, L.; Siverson, J.; Lee, A.; Cantera, J.; Parker, M.; Piepenburg, O.; Lehman, D.A.; Boyle, D.S. Factors influencing Recombinase polymerase amplification (RPA) assay outcomes at point of care. Mol. Cell. Probes 2016, 30, 74–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lamb, L.E.; Bartolone, S.N.; Chancellor, M.B. Detection of Zika Virus Using Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP). Methods Mol. Biol. 2020, 2142, 137–146. [Google Scholar] [CrossRef] [Scilit]
- Gaber, M.; Ahmad, A.A.; El-Kady, A.M.; Tolba, M.; Suzuki, Y.; Mohammed, S.M.; Elossily, N.A. Dengue fever as a reemerging disease in upper Egypt: Diagnosis, vector surveillance and genetic diversity using RT-LAMP assay. PLoS ONE 2022, 17, e0265760. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, C.; Feng, Y.; Chen, Y.; Gao, J.; Lu, Y. Rapid detection of measles virus using reverse transcription loop-mediated isothermal amplification coupled with a disposable lateral flow device. Diagn. Microbiol. Infect. Dis. 2016, 85, 168–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Wang, X.; Chen, H.; Han, L.; Wang, L.; Chen, T.; Li, S.; Li, H.; Li, Y.; Li, Z.; et al. A Novel Real-Time Reverse Transcription Loop-Mediated Isothermal Amplification Detection Platform: Application to Diagnosis of COVID-19. Front. Bioeng. Biotechnol. 2021, 9, 748746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lopez-Jimena, B.; Wehner, S.; Harold, G.; Bakheit, M.; Frischmann, S.; Bekaert, M.; Faye, O.; Sall, A.A.; Weidmann, M. Development of a single-tube one-step RT-LAMP assay to detect the Chikungunya virus genome. PLoS Negl. Trop. Dis. 2018, 12, e0006448. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atceken, N.; Alseed, M.M.; Dabbagh, S.R.; Yetisen, A.K.; Tasoglu, S. Point-of-Care Diagnostic Platforms for Loop-Mediated Isothermal Amplification. Adv. Eng. Mater. 2022, 25, 2201174. [Google Scholar] [CrossRef] [Scilit]
- Shirshikov, F.V.; Bespyatykh, J.A. Loop-Mediated Isothermal Amplification: From Theory to Practice. Russ. J. Bioorg. Chem. 2022, 48, 1159–1174. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.; Yan, J.; Mao, H.; Zhang, L.; Lyu, Q.; Wu, Z.; Zheng, W.; Feng, C.; Zhang, Y. Characterization of the complete genome of chikungunya in Zhejiang, China, using a modified virus discovery method based on cDNA-AFLP. PLoS ONE 2013, 8, e83014. [Google Scholar] [CrossRef] [Scilit]
- Giovanetti, M.; Vazquez, C.; Lima, M.; Castro, E.; Rojas, A.; de la Fuente, A.G.; Aquino, C.; Cantero, C.; Fleitas, F.; Torales, J.; et al. Rapid Epidemic Expansion of Chikungunya Virus East/Central/South African Lineage, Paraguay. Emerg. Infect. Dis. 2023, 29, 1859–1863. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Primer Name | Sequences (5′ to 3′) |
|---|---|
| CHIKV-F3 | CTCTCCTCTCCACAGGTGTA |
| CHIKV-B3 | CGCAGTCTATGGAGATGTGC |
| CHIKV-FIP(F1c + F2) | CCGTCGAGTCCATRa GCTGTAAA- ACTCAGGARGGAAAGACAGG |
| CHIKV-BIP (B1c + B2) | GCAGACGTGGTCATCTACTGCC- ACTTGRGTCCGCATCTGT |
| CHIKV-LF | FITC-TGGTTCAGTGACTGGGTYAG |
| CHIKV-LB | Biotin-ATGGGAGAAGAARATATCYGAGGC |
| RNA Concentration (Copies mL−1) | No. Positive Tests/No. Reaction Replicates (%) | 95% Cl |
|---|---|---|
| 2000 | 20/20 (100%) | 83.90–100% |
| 1000 | 20/20 (100%) | 83.90–100% |
| 500 | 16/20 (80%) | 58.40–91.93% |
| 250 | 8/20 (40%) | 21.88–61.34% |
| 125 | 0/20 (0%) | 0.00–16.11% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, C.; Chen, Y.; Zhu, G.; Wu, H.; Jiang, Q.; Zhang, R.; Yu, B.; Fang, L.; Wu, Z. A Portable, Integrated, Sample-In Result-Out Nucleic Acid Diagnostic Device for Rapid and Sensitive Chikungunya Virus Detection. Micromachines 2024, 15, 663. https://doi.org/10.3390/mi15050663
Xu C, Chen Y, Zhu G, Wu H, Jiang Q, Zhang R, Yu B, Fang L, Wu Z. A Portable, Integrated, Sample-In Result-Out Nucleic Acid Diagnostic Device for Rapid and Sensitive Chikungunya Virus Detection. Micromachines. 2024; 15(5):663. https://doi.org/10.3390/mi15050663
Chicago/Turabian StyleXu, Changping, Yalin Chen, Guiying Zhu, Huan Wu, Qi Jiang, Rui Zhang, Beibei Yu, Lei Fang, and Zhiwei Wu. 2024. "A Portable, Integrated, Sample-In Result-Out Nucleic Acid Diagnostic Device for Rapid and Sensitive Chikungunya Virus Detection" Micromachines 15, no. 5: 663. https://doi.org/10.3390/mi15050663
APA StyleXu, C., Chen, Y., Zhu, G., Wu, H., Jiang, Q., Zhang, R., Yu, B., Fang, L., & Wu, Z. (2024). A Portable, Integrated, Sample-In Result-Out Nucleic Acid Diagnostic Device for Rapid and Sensitive Chikungunya Virus Detection. Micromachines, 15(5), 663. https://doi.org/10.3390/mi15050663

