A Multi-Enzyme Complex That Mitigates Hepatotoxicity, Improves Egg Production and Quality, and Enhances Gut and Liver Health in Laying Hens Exposed to Trace Aflatoxin B1
Abstract
1. Introduction
2. Results
2.1. Complex Enzyme Preparation Ameliorated AFB1-Induced Decline in Laying Hen Performance
2.2. Complex Enzyme Preparation Ameliorates AFB1-Induced Egg Quality Decline
2.3. Complex Enzyme Preparations to Alleviate AFB1-Induced Liver Injury
2.4. Changes in Antioxidant Activity of the Liver
2.5. The mRNA Expression Levels of Tight Junctions in the Intestinal Epithelial Barrier and Alerations in Intestinal Morphology
2.6. Diversity and Composition of Cecum Microorganisms
2.7. Hepatic Metabolism
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Preparation of Aflatoxins
5.2. Chemicals
5.3. Experimental Design and Treatment
5.4. Sample Collection
5.5. Microbiological Analysis of Cecum Samples
5.6. Hepatic Metabolomics Analysis
5.7. Histopathological Analysis
5.8. Real-Time Fluorescence Quantitative PCR
5.9. Statistical Analyses
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Haque, M.A.; Wang, Y.; Shen, Z.; Li, X.; Saleemi, M.K.; He, C. Mycotoxin contamination and control strategy in human, domestic animal and poultry: A review. Microb. Pathog. 2020, 142, 104095. [Google Scholar] [CrossRef]
- Jaimez, J.; Fente, C.A.; Vazquez, B.I.; Franco, C.M.; Cepeda, A.; Mahuzier, G.; Prognon, P. Application of the assay of aflatoxins by liquid chromatography with fluorescence detection in food analysis. J. Chromatogr. A 2000, 882, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Ishfaq, M.; Wang, J. Effects of Lactobacillus salivarius supplementation on the growth performance, liver function, meat quality, immune responses and Salmonella Pullorum infection resistance of broilers challenged with Aflatoxin B1. Poult. Sci. 2021, 101, 101651. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Mahato, D.K.; Kamle, M.; Mohanta, T.K.; Kang, S.G. Aflatoxins: A Global Concern for Food Safety, Human Health and Their Management. Front. Microbiol. 2017, 7, 2170. [Google Scholar] [CrossRef] [PubMed]
- Alm-Eldeen, A.A.; Basyony, M.A.; Elfiky, N.K.; Ghalwash, M.M. Effect of the Egyptian propolis on the hepatic antioxidant defense and pro-apoptotic p53 and anti-apoptotic bcl2 expressions in aflatoxin B1 treated male mice. Biomed. Pharmacother. 2017, 87, 247–255. [Google Scholar] [CrossRef]
- Applegate, T.J.; Schatzmayr, G.; Pricket, K.; Troche, C.; Jiang, Z. Effect of aflatoxin culture on intestinal function and nutrient loss in laying hens. Poult. Sci. 2009, 88, 1235–1241. [Google Scholar] [CrossRef] [PubMed]
- Cao, Q.; Lin, L.; Xu, T.; Lu, Y.; Zhang, C.; Yue, K.; Huang, S.; Dong, H.; Jian, F. Aflatoxin B1 alters meat quality associated with oxidative stress, inflammation, and gut-microbiota in sheep. Ecotoxicol. Environ. Saf. 2021, 225, 112754. [Google Scholar] [CrossRef]
- Lin, L.; Fu, P.; Chen, N.; Gao, N.; Cao, Q.; Yue, K.; Xu, T.; Zhang, C.; Zhang, C.; Liu, F.; et al. Total flavonoids of Rhizoma Drynariae protect hepatocytes against aflatoxin B1-induced oxidative stress and apoptosis in broiler chickens. Ecotoxicol. Environ. Saf. 2022, 230, 113148. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Li, C.; Tang, H.; Gong, M.; Yue, Z.; Zhao, M.; Liu, L.; Li, F. Dietary lysine supplementation improves growth performance and skeletal muscle development in rabbits fed a low protein diet. J. Anim. Physiol. Anim. Nutr. 2022, 106, 1118–1129. [Google Scholar] [CrossRef] [PubMed]
- Radjabzadeh, D.; Bosch, J.A.; Uitterlinden, A.G.; Zwinderman, A.H.; Ikram, M.A.; van Meurs, J.B.J.; Luik, A.I.; Nieuwdorp, M.; Lok, A.; van Duijn, C.M.; et al. Gut microbiome-wide association study of depressive symptoms. Nat. Commun. 2022, 13, 7128. [Google Scholar] [CrossRef]
- Fouad, A.M.; Ruan, D.; El-Senousey, H.K.; Chen, W.; Jiang, S.; Zheng, C. Harmful Effects and Control Strategies of Aflatoxin B1 Produced by Aspergillus flavus and Aspergillus parasiticus Strains on Poultry: Review. Toxins 2019, 11, 176. [Google Scholar] [CrossRef] [PubMed]
- Uyar, A.; Yener, Z.; Dogan, A. Protective effects of Urtica dioica seed extract in aflatoxicosis: Histopathological and biochemical findings. Br. Poult. Sci. 2016, 57, 235–245. [Google Scholar] [CrossRef] [PubMed]
- Hathout, A.S.; Aly, S.E. Biological detoxification of mycotoxins: A review. Ann. Microbiol. 2014, 64, 905–919. [Google Scholar] [CrossRef]
- Akinrinmade, F.J.; Akinrinde, A.S.; Amid, A. Changes in serum cytokine levels, hepatic and intestinal morphology in aflatoxin B1-induced injury: Modulatory roles of melatonin and flavonoid-rich fractions from Chromolena odorata. Mycotoxin. Res. 2016, 32, 53–60. [Google Scholar] [CrossRef]
- Chen, J.; Lv, Z.; Cheng, Z.; Wang, T.; Li, P.; Wu, A.; Nepovimova, E.; Long, M.; Wu, W.; Kuca, K. Bacillus amyloliquefaciens B10 inhibits aflatoxin B1-induced cecal inflammation in mice by regulating their intestinal flora. Food Chem. Toxicol. 2021, 156, 112438. [Google Scholar] [CrossRef] [PubMed]
- Manafi, M. Toxicity of aflatoxin B1 on laying Japanese quails (Coturnix coturnix japonica). J. Appl. Anim. Res. 2018, 46, 953–959. [Google Scholar] [CrossRef]
- Adebo, O.A.; Njobeh, P.B.; Gbashi, S.; Nwinyi, O.C.; Mavumengwana, V. Review on microbial degradation of aflatoxins. Crit. Rev. Food Sci. Nutr. 2017, 57, 3208–3217. [Google Scholar] [CrossRef] [PubMed]
- Raj, J.; Farkaš, H.; Jakovčević, Z.; Vasiljević, M.; Kumar, R.; Asrani, R.K. Effects of supplemented multicomponent mycotoxin detoxifying agent in laying hens fed aflatoxin B1 and T2-toxin contaminated feeds. Poult. Sci. 2023, 102, 102795. [Google Scholar] [CrossRef] [PubMed]
- Karimi Torshizi, M.A.; Sedaghat, A. A consortium of detoxifying bacteria mitigates the aflatoxin B1 toxicosis on performance, health, and blood constituents of laying hens. Poult. Sci. 2023, 102, 102601. [Google Scholar] [CrossRef] [PubMed]
- Kasmani, F.B.; Torshizi, M.A.K.; Allameh, A.; Shariatmadari, F. A Novel Aflatoxin-Binding Bacillus Probiotic: Performance, Serum Biochemistry, and Immunological Parameters in Japanese Quail. Poult. Sci. 2012, 91, 1846–1853. [Google Scholar] [CrossRef]
- Li, X.; Lv, Z.; Chen, J.; Nepovimova, E.; Long, M.; Wu, W.; Kuca, K. Bacillus amyloliquefaciens B10 can alleviate liver apoptosis and oxidative stress induced by aflatoxin B1. Food Chem. Toxicol. 2021, 151, 112124. [Google Scholar] [CrossRef]
- Singh, C.; Prakash, C.; Mishra, P.; Tiwari, K.N.; Mishra, S.K.; More, R.S.; Kumar, V.; Singh, J. Hepatoprotective efficacy of Premna integrifolia L. leaves against aflatoxin B1-induced toxicity in mice. Toxicon 2019, 166, 88–100. [Google Scholar] [CrossRef] [PubMed]
- Vipin, A.V.; Raksha, R.K.; Kurrey, N.K.; Anu Appaiah, K.A.; Venkateswaran, G. Protective effects of phenolics rich extract of ginger against Aflatoxin B1-induced oxidative stress and hepatotoxicity. Biomed. Pharmacother. 2017, 91, 415–424. [Google Scholar]
- Abdel-Daim, M.M.; Abdeen, A.; Jalouli, M.; Abdelkader, A.; Megahed, A.; Alkahtane, A.; Almeer, R.; Alhoshani, N.M.; Al-Johani, N.S.; Alkahtani, S.; et al. Fucoidan supplementation modulates hepato-renal oxidative stress and DNA damage induced by aflatoxin B1 intoxication in rats. Sci. Total Environ. 2021, 768, 144781. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Muhammad, I.; Li, W.; Sun, X.; Cheng, P.; Zhang, X. Sensitivity of Arbor Acres broilers and chemoprevention of aflatoxin B1-induced liver injury by curcumin, a natural potent inducer of phase-II enzymes and Nrf2. Environ. Toxicol. Pharmacol. 2018, 59, 94–104. [Google Scholar] [CrossRef]
- Miao, L.; Gong, Y.; Li, H.; Xie, C.; Xu, Q.; Dong, X.; Elwan, H.; Zou, X. Alterations in cecal microbiota and intestinal barrier function of laying hens fed on fluoride supplemented diets. Ecotoxicol. Environ. Saf. 2020, 193, 110372. [Google Scholar] [CrossRef] [PubMed]
- Vaziri, N.D.; Yuan, J.; Nazertehrani, S.; Ni, Z.; Liu, S. Chronic Kidney Disease Causes Disruption of Gastric and Small Intestinal Epithelial Tight Junction. Am. J. Nephrol. 2013, 38, 99–103. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zhang, C.; Guo, C.; Li, X. Chitosan Ameliorates DSS-Induced Ulcerative Colitis Mice by Enhancing Intestinal Barrier Function and Improving Microflora. Int. J. Mol. Sci. 2019, 20, 5751. [Google Scholar] [CrossRef] [PubMed]
- Johansson, M.E.V.; Larsson, J.M.H.; Hansson, G.C. The two mucus layers of colon are organized by the MUC2 mucin, whereas the outer layer is a legislator of host–microbial interactions. Proc. Natl. Acad. Sci. USA 2011, 108, 4659–4665. [Google Scholar] [CrossRef]
- Cheng, M.; Zhang, X.; Miao, Y.; Cao, J.; Wu, Z.; Weng, P. The modulatory effect of (-)-epigallocatechin 3-O-(3-O-methyl) gallate (EGCG3"Me) on intestinal microbiota of high fat diet-induced obesity mice model. Food Res. Int. 2017, 92, 9–16. [Google Scholar] [CrossRef]
- Ma, Q.; Li, Y.; Wang, J.; Li, P.; Duan, Y.; Dai, H.; An, Y.; Cheng, L.; Wang, T.; Wang, C.; et al. Investigation of gut microbiome changes in type 1 diabetic mellitus rats based on high-throughput sequencing. Biomed. Pharmacother. 2020, 124, 109873. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Cui, L.; Liu, M.; Qi, Z.; Luo, H.; Huang, H.; Tu, T.; Qin, X.; Wang, Y.; Zhang, J.; et al. Theoretical insights into the mechanism underlying aflatoxin B1 transformation by the BsCotA-methyl syringate system. Ecotoxico. Environ. Saf. 2024, 272, 116049. [Google Scholar] [CrossRef] [PubMed]
- Yuan, C.; Fan, J.; Jiang, L.; Ye, W.; Chen, Z.; Wu, W.; Huang, Q.; Qian, L. Integrated Analysis of Gut Microbiome and Liver Metabolome to Evaluate the Effects of Fecal Microbiota Transplantation on Lipopolysaccharide/D-galactosamine-Induced Acute Liver Injury in Mice. Nutrients 2023, 15, 1149. [Google Scholar] [CrossRef] [PubMed]
- Khan, S.; Moore, R.J.; Stanley, D.; Chousalkar, K.K. The Gut Microbiota of Laying Hens and Its Manipulation with Prebiotics and Probiotics To Enhance Gut Health and Food Safety. Appl. Environ. Microbiol. 2020, 86, e00600-20. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Bai, Y.; Yang, Y.; Wu, X.; Li, R. A Comparison of Production Performance, Egg Quality, and Cecal Microbiota in Laying Hens Receiving Graded Levels of Vitamin B12. Front. Vet. Sci. 2021, 8, 712183. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Liang, X.; Wang, K.; Lin, J.; Wang, X.; Wang, P.; Zhang, Y.; Nie, Q.; Liu, H.; Zhang, Z.; et al. Intestinal hypoxia-inducible factor 2α regulates lactate levels to shape the gut microbiome and alter thermogenesis. Cell Metab. 2021, 33, 1988–2003.e7. [Google Scholar] [CrossRef]
- Zhao, L. The gut microbiota and obesity: From correlation to causality. Nat. Rev. Microbiol. 2013, 11, 639–647. [Google Scholar] [CrossRef] [PubMed]
- Ning, L.; Zhou, Y.L.; Sun, H.; Zhang, Y.; Shen, C.; Wang, Z.; Xuan, B.; Zhao, Y.; Ma, Y.; Yan, Y.; et al. Microbiome and metabolome features in inflammatory bowel disease via multi-omics integration analyses across cohorts. Nat. Commun. 2023, 14, 7135. [Google Scholar] [CrossRef]
- Huber-Ruano, I.; Calvo, E.; Mayneris-Perxachs, J.; Rodríguez-Peña, M.M.; Ceperuelo-Mallafré, V.; Cedó, L.; Núñez-Roa, C.; Miro-Blanch, J.; Arnoriaga-Rodríguez, M.; Balvay, A.; et al. Orally administered Odoribacter laneus improves glucose control and inflammatory profile in obese mice by depleting circulating succinate. Microbiome 2022, 10, 135. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Zeng, X.; Zhang, C.; Wang, Q.; Zhang, W.; Xie, J.; Chen, J.; Hu, Q.; Wang, Q.; Yang, H.; et al. Higher niacin intakes improve the lean meat rate of Ningxiang pigs by regulating lipid metabolism and gut microbiota. Front. Nutr. 2022, 9, 959039. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Guo, L.; Qin, T.; Lai, P.; Jing, Y.; Zhang, Z.; Zhou, G.; Gao, P.; Ding, G. Effects of X-ray cranial irradiation on metabolomics and intestinal flora in mice. Ecotoxicol. Environ. Saf. 2024, 270, 115898. [Google Scholar] [CrossRef]
- Stincone, A.; Prigione, A.; Cramer, T.; Wamelink, M.M.C.; Campbell, K.; Cheung, E.; Olin-Sandoval, V.; Grüning, N.; Krüger, A.; Alam, M.T.; et al. The return of metabolism: Biochemistry and physiology of the pentose phosphate pathway. Biol. Rev. 2015, 90, 927–963. [Google Scholar] [CrossRef]
- Khwatenge, C.N.; Kimathi, B.M.; Nahashon, S.N. Transcriptome Analysis and Expression of Selected Cationic Amino Acid Transporters in the Liver of Broiler Chicken Fed Diets with Varying Concentrations of Lysine. Int. J. Mol. Sci. 2020, 21, 5594. [Google Scholar] [CrossRef] [PubMed]
- Holeček, M. Histidine in Health and Disease: Metabolism, Physiological Importance, and Use as a Supplement. Nutrients 2020, 12, 848. [Google Scholar] [CrossRef] [PubMed]
- Xu, P.; Dong, S.; Luo, X.; Wei, B.; Zhang, C.; Ji, X.; Zhang, J.; Zhu, X.; Meng, G.; Jia, B.; et al. Humic acids alleviate aflatoxin B1-induced hepatic injury by reprogramming gut microbiota and absorbing toxin. Ecotoxicol. Environ. Saf. 2023, 259, 115051. [Google Scholar] [CrossRef]





| Experimental | Egg Production (%) | FCR (g Feed/g Egg Produced) |
|---|---|---|
| Control | 77.51 b | 2.76 b |
| E1 | 78.72 ab | 2.38 b |
| E2 | 81.57 a | 2.21 a |
| E3 | 80.84 ab | 2.33 ab |
| SEM | 0.01 | 0.75 |
| p-value | 0.034 | 0.049 |
| Experimental | Eggshell Thickness (mm) | Eggshell Strength (kg/cm) | Yolk Colour | Albumen Height | Haugh Unit |
|---|---|---|---|---|---|
| Control | 0.35 | 3.07 | 6.38 | 5.08 b | 69.49 c |
| E1 | 0.33 | 2.97 | 6.63 | 5.70 b | 74.54 bc |
| E2 | 0.34 | 2.90 | 6.47 | 9.01 a | 90.95 a |
| E3 | 0.35 | 3.33 | 6.40 | 7.87 a | 85.50 ab |
| SEM | 0.003 | 0.10 | 0.06 | 0.55 | 2.99 |
| p-value | 0.48 | 0.44 | 0.52 | 0.02 | 0.03 |
| Item | Treatment | ||||
|---|---|---|---|---|---|
| Control | E1 | E2 | E3 | ||
| Duodenum | Villus heigt, mm | 1.13 ± 0.10 b | 0.90 ± 0.04 b | 1.55 ± 0.18 a | 1.52 ± 0.07 a |
| crypt depth, m | 292.42 ± 24.46 a | 145.93 ± 13.99 b | 164.83 ± 19.12 b | 169.96 ± 12.28 b | |
| V/C | 3.63 ± 0.25 c | 6.33 ± 0.46 b | 9.46 ± 0.26 a | 8.97 ± 0.41 a | |
| Jejunum | Villus heigt, mm | 0.99 ± 0.06 c | 1.03 ± 0.60 c | 1.42 ± 0.08 b | 1.76 ± 0.07 a |
| crypt depth, m | 240.56 ± 15.39 a | 236.44 ± 22.14 a | 178.41 ± 10.66 b | 211.63 ± 25.44 ab | |
| V/C | 4.21 ± 0.40 b | 4.51 ± 0.47 b | 8.06 ± 0.57 a | 8.77 ± 1.08 a | |
| Ileum | Villus heigt, mm | 1.12 ± 0.93 c | 0.94 ± 0.05 c | 1.46 ± 0.12 b | 1.82 ± 0.09 a |
| crypt depth, m | 258.00 ± 29.11 a | 232.31 ± 18.98 ab | 172.45 ± 16.66 bc | 164.96 ± 17.49 c | |
| V/C | 4.44 ± 0.31 c | 4.19 ± 0.49 c | 8.50 ± 0.23 b | 11.47 ± 1.22 a | |
| Items | Value |
|---|---|
| Ingredients, % | |
| Maize | 55.50 |
| Fermented maize | 5.80 |
| Soybean meal | 24.00 |
| Soybean oil | 2.20 |
| Limestone powder | 6.50 |
| Fish meal | 2.00 |
| Premix | 4.00 |
| Total | 100.00 |
| Nutrient composition | |
| Metabolism energy, Mcal/kg | 2.82 |
| Crude protein | 16.40 |
| Methionine | 0.34 |
| Lysine | 0.94 |
| Calcium | 3.34 |
| Total phosphorus | 0.41 |
| Enzyme complex composition, U/g | |
| Laccase | 50 |
| Gibberellinone-degrading enzyme | 500 |
| Glucose oxidase | 200 |
| -galactosidase | 500 |
| Mannanase | 10,000 |
| Target Gene | Forward Primer | Reverse Primer |
|---|---|---|
| -actin | TGCGTAGGGTTTTGTGTTGG | AACTCCAGACTCCCACACTG |
| ZO-1 | GCTCACAAGCTACGCAAAAA | ACCATCTGCCTTTCCTTCAG |
| MUC2 | GCCTGCCCAGGAAATCAAG | CGACAAGTTTGCTGGCACAT |
| Nrf2 | GAGAAAGCCTTGCTGGCTCA | TGAAGTATCTGTGCTCTGCGAA |
| SOD2 | TACAGCTCAGGTGTCGCTTC | GCGAAGGAACCAAAGTCACG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Z.; Chen, R.; Ma, X.; Wu, W.; Huang, Q.; Ye, W.; Wu, C.; Yao, B.; Xu, J.; Qian, L. A Multi-Enzyme Complex That Mitigates Hepatotoxicity, Improves Egg Production and Quality, and Enhances Gut and Liver Health in Laying Hens Exposed to Trace Aflatoxin B1. Toxins 2024, 16, 517. https://doi.org/10.3390/toxins16120517
Chen Z, Chen R, Ma X, Wu W, Huang Q, Ye W, Wu C, Yao B, Xu J, Qian L. A Multi-Enzyme Complex That Mitigates Hepatotoxicity, Improves Egg Production and Quality, and Enhances Gut and Liver Health in Laying Hens Exposed to Trace Aflatoxin B1. Toxins. 2024; 16(12):517. https://doi.org/10.3390/toxins16120517
Chicago/Turabian StyleChen, Zhuo, Rui Chen, Xin Ma, Wenzi Wu, Qixin Huang, Wenxin Ye, Chulong Wu, Bin Yao, Jianhong Xu, and Lichun Qian. 2024. "A Multi-Enzyme Complex That Mitigates Hepatotoxicity, Improves Egg Production and Quality, and Enhances Gut and Liver Health in Laying Hens Exposed to Trace Aflatoxin B1" Toxins 16, no. 12: 517. https://doi.org/10.3390/toxins16120517
APA StyleChen, Z., Chen, R., Ma, X., Wu, W., Huang, Q., Ye, W., Wu, C., Yao, B., Xu, J., & Qian, L. (2024). A Multi-Enzyme Complex That Mitigates Hepatotoxicity, Improves Egg Production and Quality, and Enhances Gut and Liver Health in Laying Hens Exposed to Trace Aflatoxin B1. Toxins, 16(12), 517. https://doi.org/10.3390/toxins16120517

