Transcriptional Profiling of Aflatoxin B1-Induced Oxidative Stress and Inflammatory Response in Macrophages
Abstract
:1. Introduction
2. Results
2.1. Toxic Effects of AFB1 on Cell Viability
2.2. Effect of AFB1 on ROS Production in RAW264.7 Cells
2.3. Effect of AFB1 on GSH and MDA Contents in RAW264.7 Cells
2.4. Effect of AFB1 Exposure on Gene Expression of Inflammatory Cytokines
2.5. Transcriptomic Analysis of the Effects of AFB1 on RAW264.7 Cells
2.6. KEGG Analysis of the Effect of AFB1 on Oxidative Phosphorylation Pathway
2.7. Relative Signaling Pathways Mediated by AFB1-Induced Oxidative Stress
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. AFB1 Solutions Preparation
5.2. Cell Culture and Treatment
5.3. Cell Viability Assay
5.4. Determination of Intracellular Reactive Oxygen Species
5.5. Determination of Glutathione and Malondialdehyde
5.6. Analysis of Inflammatory Cytokines Expression
5.7. RNA-Seq and Bioinformatics Analysis
5.8. Statistical Analyses
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mitchell, N.J.; Bowers, E.; Hurburgh, C.; Wu, F. Potential economic losses to the US corn industry from aflatoxin contamina tion. Food Addit. Contam. Part A 2016, 33, 540–550. [Google Scholar] [CrossRef]
- Wu, F.; Liu, Y.; Bhatnagar, D. Cost-effectiveness of aflatoxin control methods: Economic incentives. Toxin Rev. 2008, 27, 203–225. [Google Scholar] [CrossRef]
- Kumar, P.; Mahato, D.K.; Kamle, M.; Mohanta, T.K.; Kang, S.G. Aflatoxins: A Global Concern for Food Safety, Human Health and Their Management. Front. Microbiol. 2017, 7, 2170. [Google Scholar] [CrossRef] [Green Version]
- Verma, R.J. Aflatoxin cause DNA damage. Int. J. Hum. Genet. 2004, 4, 231–236. [Google Scholar] [CrossRef]
- Coulombe, R.A., Jr. Biological Action of Mycotoxins. J. Dairy Sci. 1993, 76, 880–891. [Google Scholar] [CrossRef]
- Kucukcakan, B.; Hayrulai-Musliu, Z. Challenging Role of Dietary Aflatoxin B1 Exposure and Hepatitis B Infection on Risk of Hepatocellular Carcinoma. Open Access Maced. J. Med. Sci. 2015, 3, 363–369. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cotty, P.J.; Bhatnagar, D. Variability among atoxigenic Aspergillus flavus strains in ability to prevent aflatoxin contamination and production of aflatoxin biosynthetic pathway enzymes. Appl. Environ. Microbiol. 1994, 60, 2248–2251. [Google Scholar] [CrossRef] [Green Version]
- Tang, L.; Xu, L.; Afriyie-Gyawu, E.; Liu, W.; Wang, P.; Tang, Y.; Wang, Z.; Huebner, H.; Ankrah, N.-A.; Ofori-Adjei, D.; et al. Aflatoxin-albumin adducts and correlation with decreased serum levels of vitamins A and E in an adult Ghanaian population. Food Addit. Contam. Part A 2009, 26, 108–118. [Google Scholar] [CrossRef] [PubMed]
- Tchana, A.N.; Moundipa, P.F.; Tchouanguep, F.M. Aflatoxin Contamination in Food and Body Fluids in Relation to Malnutrition and Cancer Status in Cameroon. Int. J. Environ. Res. Public Health 2010, 7, 178–188. [Google Scholar] [CrossRef]
- Gong, Y.Y.; Cardwell, K.; Hounsa, A.; Egal, S.; Turner, P.C.; Hall, A.J.; Wild, C.P. Dietary aflatoxin exposure and impaired growth in young children from Benin and Togo: Cross sectional study. BMJ 2002, 325, 20–21. [Google Scholar] [CrossRef] [Green Version]
- Turner, P.C.; Collinson, A.C.; Cheung, Y.B.; Gong, Y.; Hall, A.J.; Prentice, A.M.; Wild, C.P. Aflatoxin exposure in utero causes growth faltering in Gambian infants. Int. J. Epidemiol. 2007, 36, 1119–1125. [Google Scholar] [CrossRef] [Green Version]
- Jiang, Y.; Jolly, P.E.; Ellis, W.O.; Wang, J.-S.; Phillips, T.D.; Williams, J.H. Aflatoxin B1 albumin adduct levels and cellular immune status in Ghanaians. Int. Immunol. 2005, 17, 807–814. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meissonnier, G.M.; Pinton, P.; Laffitte, J.; Cossalter, A.-M.; Gong, Y.Y.; Wild, C.P.; Bertin, G.; Galtier, P.; Oswald, I.P. Immunotoxicity of aflatoxin B1: Impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression. Toxicol. Appl. Pharmacol. 2008, 231, 142–149. [Google Scholar] [CrossRef] [PubMed]
- Neal, G.E.; Eaton, D.L.; Judah, D.J.; Verma, A. Metabolism and toxicity of aflatoxins M-1 and B-1 in human-derived in vitro systems. Toxicol. Appl. Pharmacol. 1998, 151, 152–158. [Google Scholar] [CrossRef]
- Shi, D.; Liao, S.; Guo, S.; Li, H.; Yang, M.; Tang, Z. Protective Effects of Selenium on Aflatoxin B1-induced Mitochondrial Permeability Transition, DNA Damage, and Histological Alterations in Duckling Liver. Biol. Trace Element Res. 2014, 163, 162–168. [Google Scholar] [CrossRef]
- Wang, W.-J.; Xu, Z.-L.; Yu, C.; Xu, X.-H. Effects of aflatoxin B1 on mitochondrial respiration, ROS generation and apoptosis in broiler cardiomyocytes. Anim. Sci. J. 2017, 88, 1561–1568. [Google Scholar] [CrossRef]
- Amici, M.; Cecarini, V.; Pettinari, A.; Bonfili, L.; Angeletti, M.; Barocci, S.; Biagetti, M.; Fioretti, E.; Eleuteri, A.M. Binding of aflatoxins to the 20S proteasome: Effects on enzyme functionality and implications for oxidative stress and apoptosis. Biol. Chem. 2007, 388, 107–117. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, W. Aflatoxin B1 impairs mitochondrial functions, activates ROS generation, induces apoptosis and involves Nrf2 signal pathway in primary broiler hepatocytes. Anim. Sci. J. 2016, 87, 1490–1500. [Google Scholar] [CrossRef] [PubMed]
- An, Y.; Shi, X.; Tang, X.; Wang, Y.; Shen, F.; Zhang, Q.; Wang, C.; Jiang, M.; Liu, M.; Yu, L. Aflatoxin B1 Induces Reactive Oxygen Species-Mediated Autophagy and Extracellular Trap Formation in Macrophages. Front. Cell. Infect. Microbiol. 2017, 7, 53. [Google Scholar] [CrossRef] [Green Version]
- Maresca, M.; Li, Y.; Fan, Y.; Zhao, L.; Wei, H.; Ji, C.; Zhang, J. Molecular Mechanisms of Lipoic Acid Protection against Aflatoxin B1-Induced Liver Oxidative Damage and Inflammatory Responses in Broilers. Toxins 2015, 7, 5435–5447. [Google Scholar] [CrossRef] [Green Version]
- Oswald, I.P.; Marin, D.E.; Bouhet, S.; Pinton, P.; Taranu, I.; Accensi, F. Immunotoxicological risk of mycotoxins for domestic animals. Food Addit. Contam. 2005, 22, 354–360. [Google Scholar] [CrossRef] [PubMed]
- Rushing, B.R.; Selim, M.I. Aflatoxin B1: A review on metabolism, toxicity, occurrence in food, occupational exposure, and detoxification methods. Food Chem. Toxicol. 2019, 124, 81–100. [Google Scholar] [CrossRef]
- Greenberg, S.; Grinstein, S. Phagocytosis and innate immunity. Curr. Opin. Immunol. 2002, 14, 136–145. [Google Scholar] [CrossRef]
- Grivennikov, S.I.; Greten, F.; Karin, M. Immunity, Inflammation, and Cancer. Cell 2010, 140, 883–899. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hinton, D.M.; Myers, M.J.; Raybourne, R.A.; Francke-Carroll, S.; Sotomayor, R.E.; Shaddock, J.; Warbritton, A.; Chou, M.W. Immunotoxicity of Aflatoxin B1 in Rats: Effects on Lymphocytes and the Inflammatory Response in a Chronic Intermittent Dosing Study. Toxicol. Sci. 2003, 73, 362–377. [Google Scholar] [CrossRef] [PubMed]
- Cusumano, V.; Costa, G.B.; Seminara, S. Effect of aflatoxins on rat peritoneal macrophages. Appl. Environ. Microbiol. 1990, 56, 3482–3484. [Google Scholar] [CrossRef] [Green Version]
- Ghosh, R.; Chauhan, H.; Jha, G. Suppression of cell-mediated immunity by purified aflatoxin B1 in broiler chicks. Vet. Immunol. Immunopathol. 1991, 28, 165–172. [Google Scholar] [CrossRef]
- Neldonortiz, D.L.; Qureshi, M.A. Direct and microsomal activated aflatoxin-b1 exposure and its effects on turkey peritoneal macrophage functions invitro. Toxicol. Appl. Pharmacol. 1991, 109, 432–442. [Google Scholar] [CrossRef]
- Neldonortiz, D.L.; Qureshi, M.A. The effects of direct and microsomal activated aflatoxin-b1 on chicken peritoneal-macrophages invitro. Vet. Immunol. Immunopathol. 1992, 31, 61–76. [Google Scholar] [CrossRef]
- Rossano, F.; De Luna, L.O.; Buommino, E.; Cusumano, V.; Losi, E.; Catania, M.R. Secondary metabolites of Aspergillus exert immunobiological effects on human monocytes. Res. Microbiol. 1999, 150, 13–19. [Google Scholar] [CrossRef]
- Moon, E.Y.; Rhee, D.K.; Pyo, S. In vitro suppressive effect of aflatoxin B1 on murine peritoneal macrophage functions. Toxicology 1999, 133, 171–179. [Google Scholar] [CrossRef]
- Epelman, S.; LaVine, K.J.; Randolph, G.J. Origin and Functions of Tissue Macrophages. Immunity 2014, 41, 21–35. [Google Scholar] [CrossRef] [Green Version]
- Wynn, T.A.; Chawla, A.; Pollard, J.W. Macrophage biology in development, homeostasis and disease. Nature 2013, 496, 445–455. [Google Scholar] [CrossRef] [PubMed]
- Davies, L.; Jenkins, S.J.; Allen, J.E.; Taylor, P.R. Tissue-resident macrophages. Nat. Immunol. 2013, 14, 986–995. [Google Scholar] [CrossRef] [PubMed]
- Methenitou, G.; Maravelias, C.; Athanaselis, S.; Dona, A.; Koutselinis, A. Immunomodulative effects of aflatoxins and selenium on human natural killer cells. Vet. Hum. Toxicol. 2001, 43, 232–234. [Google Scholar] [PubMed]
- Pang, V.F.; Chiang, C.; Chang, C. The in vitro effects of aflatoxin B 1 on physiological functions of swine alveolar macrophages. Vet. Med. Sci. 2020, 6, 919–925. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.; George, S.; Hay, C.; Lee, J.; Qian, H.; Sun, X. Individual and combined effects of Aflatoxin B 1, Deoxynivalenol and Zearalenone on HepG2 and RAW 264.7 cell lines. Food Chem. Toxicol. 2017, 103, 18–27. [Google Scholar] [CrossRef]
- Halliwell, B.; Whiteman, M. Measuring reactive species and oxidative damage in vivo and in cell culture: How should you do it and what do the results mean? Br. J. Pharmacol. 2004, 142, 231–255. [Google Scholar] [CrossRef] [Green Version]
- Valko, M.; Leibfritz, D.; Moncol, J.; Cronin, M.T.D.; Mazur, M.; Telser, J. Free radicals and antioxidants in normal physiological functions and human disease. Int. J. Biochem. Cell Biol. 2007, 39, 44–84. [Google Scholar] [CrossRef]
- Mary, V.S.; Theumer, M.G.; Arias, S.L.; Rubinstein, H.R. Reactive oxygen species sources and biomolecular oxidative damage induced by aflatoxin B1 and fumonisin B1 in rat spleen mononuclear cells. Toxicology 2012, 302, 299–307. [Google Scholar] [CrossRef]
- Paul, S.; Jakhar, R.; Bhardwaj, M.; Kang, S.C. Glutathione-S-transferase omega 1 (GSTO1-1) acts as mediator of signaling pathways involved in aflatoxin Bl-induced apoptosis-autophagy crosstalk in macrophages. Free Radic. Biol. Med. 2015, 89, 1218–1230. [Google Scholar] [CrossRef]
- Benzie, I. Lipid peroxidation: A review of causes, consequences, measurement and dietary influences. Int. J. Food Sci. Nutr. 1996, 47, 233–261. [Google Scholar] [CrossRef]
- Gesing, A.; Karbownik-Lewinska, M. Protective effects of melatonin and N-acetylserotonin on aflatoxin B1-induced lipid peroxidation in rats. Cell Biochem. Funct. 2008, 26, 314–319. [Google Scholar] [CrossRef]
- Shen, H.-M.; Shi, C.; Lee, H.; Ong, C.N. Aflatoxin B1-Induced Lipid Peroxidation in Rat Liver. Toxicol. Appl. Pharmacol. 1994, 127, 145–150. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.; Fang, Y.-Z.; Yang, S.; Lupton, J.R.; Turner, N.D. Glutathione Metabolism and Its Implications for Health. J. Nutr. 2004, 134, 489–492. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hou, L.; Gan, F.; Zhou, X.; Zhou, Y.; Qian, G.; Liu, Z.; Huang, K. Immunotoxicity of ochratoxin A and aflatoxin B1 in combination is associated with the nuclear factor kappa B signaling pathway in 3D4/21 cells. Chemosphere 2018, 199, 718–727. [Google Scholar] [CrossRef]
- Maurya, B.K.; Trigun, S.K. Fisetin Modulates Antioxidant Enzymes and Inflammatory Factors to Inhibit Aflatoxin-B1 Induced Hepatocellular Carcinoma in Rats. Oxidative Med. Cell. Longev. 2016, 2016, 1972793. [Google Scholar] [CrossRef] [Green Version]
- Gugyala, R.R.; Sharma, R.P. The effect of aflatoxin B-1 on cytokine mRNA and corresponding protein levels in peritoneal macrophages and splenic lymphocytes. Int. J. Immunopharmacol. 1997, 18, 599–608. [Google Scholar]
- Sun, Y.; Liu, Z.; Liu, D.; Chen, J.; Gan, F.; Huang, K. Low-Level Aflatoxin B1 Promotes Influenza Infection and Modulates a Switch in Macrophage Polarization from M1 to M2. Cell. Physiol. Biochem. 2018, 49, 1151–1167. [Google Scholar] [CrossRef]
- Chan, D.C. Mitochondria: Dynamic Organelles in Disease, Aging, and Development. Cell 2006, 125, 1241–1252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Picard, M.; Taivassalo, T.; Gouspillou, G.; Hepple, R.T. Mitochondria: Isolation, structure and function. J. Physiol. 2011, 589, 4413–4421. [Google Scholar] [CrossRef] [PubMed]
- Kausar, S.; Wang, F.; Cui, H. The Role of Mitochondria in Reactive Oxygen Species Generation and Its Implications for Neurodegenerative Diseases. Cells 2018, 7, 274. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brand, M.D. The sites and topology of mitochondrial superoxide production. Exp. Gerontol. 2010, 45, 466–472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lenaz, G. The Mitochondrial Production of Reactive Oxygen Species: Mechanisms and Implications in Human Pathology. IUBMB Life 2001, 52, 159–164. [Google Scholar] [CrossRef]
- LaRosa, V.; Remacle, C. Insights into the respiratory chain and oxidative stress. Biosci. Rep. 2018, 38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Berrisford, J.M.; Baradaran, R.; Sazanov, L.A. Structure of bacterial respiratory complex I. Biochim. Biophys. Acta Bioenerg. 2016, 1857, 892–901. [Google Scholar] [CrossRef] [PubMed]
- Brandt, U. A two-state stabilization-change mechanism for proton-pumping complex I. Biochim. Biophys. Acta Bioenerg. 2011, 1807, 1364–1369. [Google Scholar] [CrossRef] [Green Version]
- Robb, E.L.; Hall, A.R.; Prime, T.A.; Eaton, S.; Szibor, M.; Viscomi, C.; James, A.M.; Murphy, M.P. Control of mitochondrial superoxide production by reverse electron transport at complex I. J. Biol. Chem. 2018, 293, 9869–9879. [Google Scholar] [CrossRef] [Green Version]
- Ohnishi, T. Iron-sulfur clusters semiquinones in Complex I. Biochim. Biophys. Acta Bioenerg. 1998, 1364, 186–206. [Google Scholar] [CrossRef] [Green Version]
- Owens, K.M.; Aykin-Burns, N.; Dayal, D.; Coleman, M.C.; Domann, F.E.; Spitz, D.R. Genomic instability induced by mutant succinate dehydrogenase subunit D (SDHD) is mediated by O2−• and H2O2. Free Radic. Biol. Med. 2012, 52, 160–166. [Google Scholar] [CrossRef] [Green Version]
- Ralph, S.J.; Moreno-Sanchez, R.; Neuzil, J.; Rodriguez-Enriquez, S. Inhibitors of Succinate: Quinone Reductase/Complex II Regulate Production of Mitochondrial Reactive Oxygen Species and Protect Normal Cells from Ischemic Damage but Induce Specific Cancer Cell Death. Pharm. Res. 2011, 28, 2695–2730. [Google Scholar] [CrossRef]
- Bleier, L.; Droese, S. Superoxide generation by complex III: From mechanistic rationales to functional consequences. Biochim. Biophys. Acta Bioenerg. 2013, 1827, 1320–1331. [Google Scholar] [CrossRef] [Green Version]
- Droese, S.; Brandt, U. Molecular Mechanisms of Superoxide Production by the Mitochondrial Respiratory Chain. In Mitochondrial Oxidative Phosphorylation: Nuclear-Encoded Genes, Enzyme Regulation, and Pathophysiology; Kadenbach, B., Ed.; Springer: New York, NY, USA, 2012; Volume 748, pp. 145–169. [Google Scholar]
- O’Banion, M.K. Cyclooxygenase-2: Molecular Biology, Pharmacology, and Neurobiology. Crit. Rev. Neurobiol. 1999, 13, 45–82. [Google Scholar] [CrossRef]
- Consilvio, C.; Vincent, A.M.; Feldman, E.L. Neuroinflammation, COX-2, and ALS—A dual role? Exp. Neurol. 2004, 187, 1–10. [Google Scholar] [CrossRef]
- Poli, G.; Leonarduzzi, G.M.; Biasi, F.; Chiarpotto, E. Oxidative Stress and Cell Signalling. Curr. Med. Chem. 2004, 11, 1163–1182. [Google Scholar] [CrossRef] [PubMed]
- Rendra, E.; Riabov, V.; Mossel, D.M.; Sevastyanova, T.; Harmsen, M.C.; Kzhyshkowska, J. Reactive oxygen species (ROS) in macrophage activation and function in diabetes. Immunobiology 2019, 224, 242–253. [Google Scholar] [CrossRef] [PubMed]
- Blackwell, T.S.; Christman, J.W. The role of nuclear factor-kappa B in cytokine gene regulation. Am. J. Respir. Cell Mol. Biol. 1997, 17, 3–9. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-kappa B signaling in inflammation. Sig. Transduct. Target Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schreck, R.; Albermann, K.; Baeuerle, P.A. Nuclear factor kappa-b—An oxidative stress-responsive transcription factor of eukaryotic cells (a review). Free Radic. Res. Commun. 1992, 17, 221–237. [Google Scholar] [CrossRef] [PubMed]
- Schreck, R.; Rieber, P.; Baeuerle, P. Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1. EMBO J. 1991, 10, 2247–2258. [Google Scholar] [CrossRef]
- Holmstroem, K.M.; Finkel, T. Cellular mechanisms and physiological consequences of redox-dependent signalling. Nat. Rev. Mol. Cell Biol. 2014, 15, 411–421. [Google Scholar] [CrossRef] [PubMed]
- Schieber, M.; Chandel, N.S. ROS Function in Redox Signaling and Oxidative Stress. Curr. Biol. 2014, 24, R453–R462. [Google Scholar] [CrossRef] [Green Version]
- Ray, P.D.; Huang, B.-W.; Tsuji, Y. Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cell. Signal. 2012, 24, 981–990. [Google Scholar] [CrossRef] [Green Version]
- Laplante, M.; Sabatini, D.M. mTOR Signaling in Growth Control and Disease. Cell 2012, 149, 274–293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chaudhuri, J.; Chowdhury, A.A.; Biswas, N.; Manna, A.; Chatterjee, S.; Mukherjee, T.; Chaudhuri, U.; Jaisankar, P.; Bandyopadhyay, S. Superoxide activates mTOR-eIF4E-Bax route to induce enhanced apoptosis in leukemic cells. Apoptosis 2014, 19, 135–148. [Google Scholar] [CrossRef]
- Sohrabi, Y.; Lagache, S.M.M.; Schnack, L.; Godfrey, R.; Kahles, F.; Bruemmer, D.; Waltenberger, J.; Findeisen, H.M. mTOR-dependent oxidative stress regulates oxLDL-Induced trained innate immunity in human monocytes. Front. Immunol. 2019, 9, 3155. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Genes ID | Gene Name | Abbreviations | Log2FC | p-Value | Regulation |
---|---|---|---|---|---|
ENSMUSG00000027398 | Interleukin 1 beta | IL-1β | 0.41 | 0.68 | NS |
ENSMUSG00000025746 | Interleukin 6 | IL-6 | 0.00 | 1.00 | NS |
ENSMUSG00000016529 | Interleukin 10 | IL-10 | 0.00 | 1.00 | NS |
ENSMUSG00000058427 | Chemokine ligand 2 | CXCL2 | 1.09 | <0.001 | UP |
ENSMUSG00000024401 | Tumor necrosis factor alpha | TNF-α | 0.70 | <0.001 | UP |
ENSMUSG00000020826 | nitric oxide synthase 2 | NOS2 | −0.05 | 0.72 | NS |
ENSMUSG00000021253 | Transforming growth factor, beta | TGF-β | −0.34 | 0.99 | NS |
ENSMUSG00000019987 | Arginase 1 | ARG1 | −0.32 | 0.78 | NS |
ENSMUSG00000075122 | CD80 antigen | CD80 | 0.30 | <0.001 | UP |
ENSMUSG00000022901 | CD86 antigen | CD86 | −0.94 | 0.02 | DOWN |
ENSMUSG00000008845 | CD163 antigen | CD163 | −0.36 | 0.74 | NS |
ENSMUSG00000034783 | CD206 antigen | CD206 | −0.27 | 0.89 | NS |
KEGG ID | KEGG Term | p-Value | No. of DEGs | DEGs |
---|---|---|---|---|
ko03320 | PPAR signaling pathway | 0.1676 | 5 | ACAA1B, FABP5, PLIN1, UCP1, CPT1C |
ko04150 | mTOR signaling pathway | 0.2307 | 11 | MAP2K2, LAMTOR5, STRADB, ATP6V1G2, FZD2, SLC3A2, SLC7A5, EIF4EBP1 |
ko04064 | NF-κB signaling pathway | 0.5093 | 4 | BCL2A1B, BCL2A1A, RELB, IKBKG |
ko04151 | PI3K-Akt signaling pathway | 0.7190 | 11 | ITGB7, MAP2K2, LPAR1, COL2A1, LAMB3, EPHA2, CDKN1A, COL1A2, EIF4EBP1, IKBKG, OSM |
ko04630 | JAK-STAT signaling pathway | 0.8721 | 4 | SOCS6, IL12RB2, CDKN1A, OSM |
ko04010 | MAPK signaling pathway | 0.9162 | 6 | MAP2K2, GADD45A, FAS, DDIT3, RELB, IKBKG |
ko04668 | TNF signaling pathway | 0.9344 | 4 | CXCL2, FAS, IKBKG, PGAM5 |
Genes | Primer Position | Primer Sequence | Genebank Number |
---|---|---|---|
GAPDH | Forward | AGGTCGGTGTGAACGGATTTG | GU214026.1 |
Reverse | TGTAGACCATGTAGTTGAGGTCA | ||
NOS2 | Forward | GTTCTCAGCCCAACAATACAAGA | AY090567.1 |
Reverse | GTGGACGGGTCGATGTCAC | ||
ARG1 | Forward | CCCGACTTCTGGGACTTCTG | AB047402.1 |
Reverse | AGTAGGTTCCGAAGACTGGGT | ||
TNF-α | Forward | CCCTCACACTCAGATCATCTTCT | NM_013693.3 |
Reverse | GCTACGACGTGGGCTACAG | ||
TGF-β | Forward | CTCCCGTGGCTTCTAGTGC | NM_011577.2 |
Reverse | GCCTTAGTTTGGACAGGATCTG | ||
IL-6 | Forward | TAGTCCTTCCTACCCCAATTTCC | NM_031168.2 |
Reverse | TTGGTCCTTAGCCACTCCTTC | ||
IL-10 | Forward | GCTCTTACTGACTGGCATGAG | NM_010548.2 |
Reverse | CGCAGCTCTAGGAGCATGTG | ||
CXCL2 | Forward | CCAACCACCAGGCTACAGG | NM_008625.2 |
Reverse | GCGTCACACTCAAGCTCTG | ||
CD86 | Forward | TGTTTCCGTGGAGACGCAAG | NM_019388.3 |
Reverse | TTGAGCCTTTGTAAATGGGCA | ||
CD206 | Forward | CTCTGTTCAGCTATTGGACGC | NM_008625.2 |
Reverse | CGGAATTTCTGGGATTCAGCTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, J.; Liu, Y.; Guo, Y.; Ma, Q.; Ji, C.; Zhao, L. Transcriptional Profiling of Aflatoxin B1-Induced Oxidative Stress and Inflammatory Response in Macrophages. Toxins 2021, 13, 401. https://doi.org/10.3390/toxins13060401
Ma J, Liu Y, Guo Y, Ma Q, Ji C, Zhao L. Transcriptional Profiling of Aflatoxin B1-Induced Oxidative Stress and Inflammatory Response in Macrophages. Toxins. 2021; 13(6):401. https://doi.org/10.3390/toxins13060401
Chicago/Turabian StyleMa, Jinglin, Yanrong Liu, Yongpeng Guo, Qiugang Ma, Cheng Ji, and Lihong Zhao. 2021. "Transcriptional Profiling of Aflatoxin B1-Induced Oxidative Stress and Inflammatory Response in Macrophages" Toxins 13, no. 6: 401. https://doi.org/10.3390/toxins13060401
APA StyleMa, J., Liu, Y., Guo, Y., Ma, Q., Ji, C., & Zhao, L. (2021). Transcriptional Profiling of Aflatoxin B1-Induced Oxidative Stress and Inflammatory Response in Macrophages. Toxins, 13(6), 401. https://doi.org/10.3390/toxins13060401