Deoxynivalenol Induces Caspase-8-Mediated Apoptosis through the Mitochondrial Pathway in Hippocampal Nerve Cells of Piglet
Abstract
1. Introduction
2. Results
2.1. DON Induces Apoptotic Nuclear Changes in PHNCs
2.2. DON Significantly Increases Rate of Apoptosis in PHNCs
2.3. DON Reduces Mitochondrial Membrane Potential
2.4. Influence of DON on Genes Expression Associated with Apoptosis
2.5. Effects of DON on Proteins Related with Apoptosis
2.6. Effect of DON on Caspase-3 Activity
2.7. Effect of DON on the Transcriptional Activities of AIF and P53
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Treatment
4.2. Viability Assay
4.3. Hoechst 33,258 Staining
4.4. Determination of Apoptotic Cells
4.5. Detection of the Mitochondrial Membrane Potential (MMP)
4.6. RT-PCR Analysis
4.7. Western Blot Analysis
4.8. Immunofluorescence Analysis
4.9. Transcriptional Activity
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wegulo, S.N. Factors Influencing Deoxynivalenol Accumulation in Small Grain Cereals. Toxins 2012, 4, 1157–1180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wan, J.; Chen, B.; Rao, J. Occurrence and preventive strategies to control mycotoxins in cereal-based food. Compr. Rev. Food Sci. Food Saf. 2020, 19, 928–953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mudili, V.; Siddaih, C.N.; Nagesh, M.; Garapati, P.; Naveen, K.K.; Murali, H.S.; Yli, M.T.; Batra, H.V. Mould incidence and mycotoxin contamination in freshly harvested maize kernels originated from India. J. Sci. Food Agric. 2014, 94, 2674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nordkvist, E.; Häggblom, P. Fusarium mycotoxin contamination of cereals and bedding straw at Swedish pig farms. Anim. Feed Sci. Technol. 2014, 198, 231–237. [Google Scholar] [CrossRef] [Scilit]
- Brera, C.; Bertazzoni, V.; Debegnach, F.; Gregori, E.; Prantera, E.; De, S.B. Exposure assessment for Italian population groups to deoxynivalenol deriving from pasta consumption. Toxins 2013, 5, 2293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Philippe, P.; Isabelle, P. Effect of deoxynivalenol and other type B trichothecenes on the intestine: A Review. Toxins 2014, 6, 1615–1643. [Google Scholar] [CrossRef] [Scilit]
- Pestka, J. Deoxynivalenol: Mechanisms of action, human exposure, and toxicological relevance. Arch. Toxicol. 2010, 84, 663–679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, H.; Ji, J.; Wang, J.; Sun, X. Deoxynivalenol: Masked forms, fate during food processing, and potential biological remedies. Compr. Rev. Food Sci. Food Saf. 2020, 19, 895–926. [Google Scholar] [CrossRef] [Scilit]
- Ma, R.; Zhang, L.; Liu, M.; Su, Y.; Xie, W.; Zhang, N.; Dai, J.; Wang, Y.; Rajput, S.; Qi, D. Individual and combined occurrence of mycotoxins in feed ingredients and complete feeds in China. Toxins 2018, 10, 113. [Google Scholar] [CrossRef] [Scilit]
- Pestka, J. Deoxynivalenol-induced proinflammatory gene expression: Mechanisms and pathological sequelae. Toxins (Basel) 2010, 2, 1300–1317. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Jiang, Y.; Zhu, L.; Cao, L.; Xu, W.; Sajid, U.; Feng, S.; Li, Y.; Wu, J. Autophagy protects PC12 cells against deoxynivalenol toxicity via the Class III PI3K/beclin 1/Bcl-2 pathway. J. Cell. Physiol. 2020, 235, 7803–7815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, S.; Banerjee, S.; Chattopadhyay, P.; Borthakur, S.K.; Veer, V. Deoxynivalenol induces cytotoxicity and genotoxicity in animal primary cell culture. Toxicol. Methods 2015, 25, 184–191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Tang, J.; Geng, F.; Zhu, L.; Chu, X.; Zhang, Y.; Rahman, S.U.; Chen, X.; Jiang, Y.; Zhu, D.; et al. Effects of deoxynivalenol exposure on cerebral lipid peroxidation, neurotransmitter and calcium homeostasis of chicks in vivo. Toxicon 2018, 150, 60–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gaigé, S.; Bonnet, M.S.; Tardivel, C.; Pinton, P.; Trouslard, J.; Jean, A.; Guzylack, L.; Troadec, J.D.; Dallaporta, M. c-Fos immunoreactivity in the pig brain following deoxynivalenol intoxication: Focus on NUCB2/nesfatin-1 expressing neurons. Neurotoxicology 2013, 34, 135–149. [Google Scholar] [CrossRef] [Scilit]
- Gu, W.; Zhu, P.; Jiang, D.; He, X.; Li, Y.; Ji, J.; Zhang, L.; Sun, Y.; Sun, X. A novel and simple cell-based electrochemical impedance biosensor for evaluating the combined toxicity of DON and ZEN. Biosens. Bioelectron. 2015, 70, 447–454. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pestka, J.J.; Lin, W.S.; Miller, E.R. Emetic activity of the trichothecene 15-acetyldeoxynivalenol in swine. Food Chem. Toxicol. 1987, 25, 855–858. [Google Scholar] [CrossRef] [Scilit]
- Krantis, A.; Durst, T. Novel Multi-Ring Organic Compounds for Regulating Gut Motility and Food Intake. U.S. Patent 10/250986, 18 July 2002. [Google Scholar]
- Awad, W.A.; Aschenbach, J.R.; Setyabudi, F.M.C.S.; Razzazifazeli, E.; Böhm, J.; Zentek, J. In Vitro Effects of Deoxynivalenol on Small Intestinal d-Glucose Uptake and Absorption of Deoxynivalenol across the Isolated Jejunal Epithelium of Laying Hens. Poult. Sci. 2007, 86, 15–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prelusky, D.; Rotter, B.; Thompson, B.; Trenholm, H. Effect of the appetite stimulant cyproheptadine on deoxynivalenol-induced reductions in feed consumption and weight gain in the mouse. J. Environ. Sci. Health B 1997, 32, 429–448. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Chen, X.; Cao, L.; Zhu, L.; Zhang, Y.; Chu, X.; Zhu, D.; Sajid, U.R.; Peng, C.; Feng, S.; et al. Mechanism of deoxynivalenol-induced neurotoxicity in weaned piglets is linked to lipid peroxidation, dampened neurotransmitter levels, and interference with calcium signaling. Ecotoxicol. Environ. Saf. 2020, 1194, 110382. [Google Scholar] [CrossRef] [Scilit]
- Li, D.; Ye, Y.; Lin, S.; Deng, L.; Fan, X.; Zhang, Y.; Deng, X.; Li, Y.; Yan, H.; Ma, Y. Evaluation of deoxynivalenol-induced toxic effects on DF-1 cells in vitro: Cell-cycle arrest, oxidative stress, and apoptosis. Environ. Toxicol. Pharmacol. 2014, 37, 141–149. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Kim, C.N.; Yang, J.; Jemmerson, R.; Wang, X. Induction of apoptotic program in cell-free extracts: Requirement for dATP and cytochromec. Cell 1996, 86, 147–157. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Fan, M.; Chu, X.; Zhang, Y.; Rahman, S.U.; Jiang, Y.; Chen, X.; Zhu, D.; Feng, S.; Li, Y.; et al. Deoxynivalenol induces toxicity and apoptosis in piglet hippocampal nerve cells via the MAPK signaling pathway. Toxicon 2018, 155, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mikami, O.; Yamamoto, S.; Yamanaka, N.; Nakajima, Y. Porcine hepatocyte apoptosis and reduction ofalbumin secretion induced by deoxynivalenol. Toxicology 2004, 204, 241–249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Königs, M.; Lenczyk, M.; Schwerdt, G.; Holzinger, H.; Gekle, M.; Humpf, H.U. Cytotoxicity, metabolism and cellular uptake of the mycotoxin deoxynivalenol in human proximal tubule cells and lung fibroblasts in primary culture. Toxicology 2007, 240, 48–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Y.; Zhang, A.; Shi, Z.; He, C.; Ding, J.; Wang, X.; Ma, J.; Zhang, H. A mitochondria-mediated apoptotic pathway induced by deoxynivalenol in human colon cancer cells. Toxicol. Vitr. 2012, 26, 414. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Xu, W.; Fan, M.; Meng, T.; Chen, X.; Jiang, Y.; Zhu, D.; Hu, W.; Gong, J.; Feng, S. Deoxynivalenol induces apoptosis in PC12 cells via the mitochondrial pathway. Environ. Toxicol. Pharmacol. 2016, 43, 193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, Y.; Zhang, M.; Li, N.; Wan, J.; Ge, W.; Tan, S.; Shen, W.; Li, L. Zearalenone exposure triggered porcine granulosa cells apoptosis via microRNAs-mediated focal adhesion pathway. Toxicol. Lett. 2020, 330, 80–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, X.; Yan, G.; Chang, J.; Wang, P.; Yin, Q.; Liu, C.; Zhu, Q.; Lu, F. Comparative Transcriptome Analysis Reveals the Protective Mechanism of Glycyrrhinic Acid for Deoxynivalenol-Induced Inflammation and Apoptosis in IPEC-J2 Cells. Oxid. Med. Cell Longev. 2020, 2020, 5974157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benzie, I.F.F.; Strain, J.J. The Ferric Reducing Ability of Plasma (FRAP) as a Measure of “Antioxidant Power”: The FRAP Assay. Anal. Biochem. 1996, 239, 70–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, S.; Tian, Q.; Shang, C.; Yang, L.; Wei, N.; Shang, G.; Ji, Y.; Kou, H.; Lu, S.; Liu, H. Synergistic Utilization of Necrostatin-1 and Z-VAD-FMK Efficiently Promotes the Survival of Compression-Induced Nucleus Pulposus Cells via Alleviating Mitochondrial Dysfunction. BioMed Res. Int. 2020, 2020, 6976317. [Google Scholar] [CrossRef] [Scilit]
- Fu, J.; Chen, X.; Liu, X.; Xu, D.; Yang, H.; Zeng, C.; Long, H.; Zhou, C.; Wu, H.; Zheng, G.; et al. ELABELA ameliorates hypoxic/ischemic-induced bone mesenchymal stem cell apoptosis via alleviation of mitochondrial dysfunction and activation of PI3K/AKT and ERK1/2 pathways. Stem Cell Res. Ther. 2020, 11, 541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boldin, M.P.; Goncharov, T.M.; Goltsev, Y.V.; Wallach, D. Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1- and TNF receptor-induced cell death. Cell 1996, 85, 803–815. [Google Scholar] [CrossRef] [Scilit]
- Fernandesalnemri, T.; Armstrong, R.C.; Krebs, J.; Srinivasula, S.M.; Wang, L.; Bullrich, F.; Fritz, L.C.; Trapani, J.A.; Tomaselli, K.J.; Litwack, G.; et al. In vitro activation of CPP32 and Mch3 by Mch4, a novel human apoptotic cysteine protease containing two FADD-like domains. Proc. Natl. Acad. Sci. USA 1996, 93, 7464–7469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salvesen, G.S.; Dixit, V.M. Caspases: Intracellular signaling by proteolysis. Cell 1997, 91, 443–446. [Google Scholar] [CrossRef] [Scilit]
- Tsujimoto, Y.; Finger, L.R.; Yunis, J.; Nowell, P.C.; Croce, C.M. Cloning of the chromosome breakpoint of neoplastic B cells with the t (14;18) chromosome translocation. Science 1984, 226, 1097–1099. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vaux, D.L.; Cory, S.; Adams, J.M. Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature 1988, 335, 440. [Google Scholar] [CrossRef] [Scilit]
- Reed, J.C. Bcl-2 and the regulation of programmed cell death. J. Cell Biol. 1994, 124, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sutton, V.R.; Davis, J.E.; Cancilla, M.; Johnstone, R.W.; Ruefli, A.A.; Sedelies, K.; Browne, K.A.; Trapani, J.A. Initiation of apoptosis by granzyme B requires direct cleavage of bid, but not direct granzyme B-mediated caspase activation. J. Exp. Med. 2000, 192, 1403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farrow, S.N.; White, J.H.; Martinou, I.; Raven, T.; Pun, K.T.; Grinham, C.J.; Martinou, J.C.; Brown, R. Cloning of a bcl-2 homologue by interaction with adenovirus E1B 19K. Nature 1995, 374, 731. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krajewski, S.; Krajewska, M.; Shabaik, A.; Miyashita, T.; Wang, H.G.; Reed, J.C. Immunohistochemical determination of in vivo distribution of Bax, a dominant inhibitor of Bcl-2. Am. J. Pathol. 1994, 145, 1323–1336. [Google Scholar] [PubMed]
- Luo, X.; Budihardjo, I.; Zou, H.; Slaughter, C.; Wang, X. Bid, a Bcl2 Interacting Protein, Mediates Cytochrome c Release from Mitochondria in Response to Activation of Cell Surface Death Receptors. Cell 1998, 94, 481–490. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Zhu, H.; Xu, C.J.; Yuan, J. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 1998, 94, 491–501. [Google Scholar] [CrossRef] [Scilit]
- Cheng, E.H.; Kirsch, D.G.; Clem, R.J.; Ravi, R.; Kastan, M.B.; Bedi, A.; Ueno, K.; Hardwick, J.M. Conversion of Bcl-2 to a Bax-like death effector by caspases. Science 1997, 278, 1966–1968. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orzáez, B.M.; Sancho, M.; Enrique, M.; Payá, P. Cyclin-Dependent Kinase (CDK) Inhibitors. In Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2016; p. 1336. [Google Scholar]
- Lemarié, A.; Lagadicgossmann, D.; Morzadec, C.; Allain, N.; Fardel, O.; Vernhet, L. Cadmium induces caspase-independent apoptosis in liver Hep3B cells: Role for calcium in signaling oxidative stress-related impairment of mitochondria and relocation of endonuclease G and apoptosis-inducing factor. Free Radic. Biol. Med. 2004, 36, 1517–1531. [Google Scholar] [CrossRef] [Scilit]
- Miyashita, T.; Reed, J.C. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 1995, 80, 293–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clarke, A.R.; Gledhill, S.; Hooper, M.L.; Bird, C.C.; Wyllie, A.H. p53 dependence of early apoptotic and proliferative responses within the mouse intestinal epithelium following gamma-irradiation. Oncogene 1994, 9, 1767–1773. [Google Scholar] [PubMed]
- Johnstone, R.; Ruefli, A.; Lowe, S. Apoptosis: A link between cancer genetics and chemotherapy. Cell 2002, 108, 153–164. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Zhu, C.; Ye, J.; Lv, Y.; Wang, L.; Chen, Z.; Jiang, Z. Protection of Porcine Intestinal-Epithelial Cells from Deoxynivalenol-Induced Damage by Resveratrol via the Nrf2 Signaling Pathway. J. Agric. Food Chem. 2019, 67, 1726–1735. [Google Scholar] [CrossRef] [Scilit]
- Wan, D.; Wu, Q.; Qu, W.; Liu, G.; Wang, X. Pyrrolidine Dithiocarbamate (PDTC) Inhibits DON-Induced Mitochondrial Dysfunction and Apoptosis via the NF-κB/iNOS Pathway. Oxid. Med. Cell Longev. 2018, 1324173. [Google Scholar] [CrossRef] [Scilit]
- Zhu, L.; Yuan, H.; Guo, C.; Lu, Y.; Deng, S.; Yang, Y.; Wei, Q.; Wen, L.; He, Z. Zearalenone induces apoptosis and necrosis in porcine granulosa cells via a caspase-3- and caspase-9-dependent mitochondrial signaling pathway. J. Cell Physiol. 2012, 227, 1814–1820. [Google Scholar] [CrossRef] [Scilit]







| Gene | Accession Number | Primer | Sequences (5′→3′) | Product/bp |
|---|---|---|---|---|
| GAPDH | NM_002046 | Forward | GGTGAAGGTCGGTGTGAACG | 232 |
| Reverse | CTCGCTCCTGGAAGATGGTG | |||
| Bcl-2 | NC_000067.6 | Forward | TGGGATGCCTTTGTGGAACT | 153 |
| Reverse | GCAGGTTTGTCGACCTCACT | |||
| Bax | NC_000073.6 | Forward | GGTTTCATCCAGGATCGAGCA | 151 |
| Reverse | TCCTCTGCAGCTCCATATTGC | |||
| Bid | NM_197966.1 | Forward | AGCTACACAGCTTGTGCCAT | 186 |
| Reverse | CAGCTCGTCTTCGAGGTCTG | |||
| P53 | NC_000077.6 | Forward | CCCAAACTGCTAGCTCCCAT | 217 |
| Reverse | GGAGGATTGTGTCTCAGCCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, L.; Jiang, Y.; Zhu, L.; Xu, W.; Chu, X.; Zhang, Y.; Rahman, S.U.; Feng, S.; Li, Y.; Wu, J.; et al. Deoxynivalenol Induces Caspase-8-Mediated Apoptosis through the Mitochondrial Pathway in Hippocampal Nerve Cells of Piglet. Toxins 2021, 13, 73. https://doi.org/10.3390/toxins13020073
Cao L, Jiang Y, Zhu L, Xu W, Chu X, Zhang Y, Rahman SU, Feng S, Li Y, Wu J, et al. Deoxynivalenol Induces Caspase-8-Mediated Apoptosis through the Mitochondrial Pathway in Hippocampal Nerve Cells of Piglet. Toxins. 2021; 13(2):73. https://doi.org/10.3390/toxins13020073
Chicago/Turabian StyleCao, Li, Yunjing Jiang, Lei Zhu, Wei Xu, Xiaoyan Chu, Yafei Zhang, Sajid Ur Rahman, Shibin Feng, Yu Li, Jinjie Wu, and et al. 2021. "Deoxynivalenol Induces Caspase-8-Mediated Apoptosis through the Mitochondrial Pathway in Hippocampal Nerve Cells of Piglet" Toxins 13, no. 2: 73. https://doi.org/10.3390/toxins13020073
APA StyleCao, L., Jiang, Y., Zhu, L., Xu, W., Chu, X., Zhang, Y., Rahman, S. U., Feng, S., Li, Y., Wu, J., & Wang, X. (2021). Deoxynivalenol Induces Caspase-8-Mediated Apoptosis through the Mitochondrial Pathway in Hippocampal Nerve Cells of Piglet. Toxins, 13(2), 73. https://doi.org/10.3390/toxins13020073

