Investigating the Efficiency of Hydroxycinnamic Acids to Inhibit the Production of Enniatins by Fusarium avenaceum and Modulate the Expression of Enniatins Biosynthetic Genes
Abstract
:1. Introduction
2. Results
2.1. Effect of Hydroxycinnamic Acids on the Radial Growth of F. avenaceum I612
2.2. Effect of Hydroxycinnamic Acids on Mycelium Weights and Production of ENNs by F. avenaceum I612
2.3. Effect of FER, CAF and COUM on Fungal Biomass and Production of ENNs by a Panel of F. avenaceum Strains
2.4. Effect of FER on the Expression of ENNs Biosynthetic Genes from F. avenaceum I612
2.5. Biotransformation of FER in F. avenaceum I612 Broths
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Chemicals and Standards
5.2. F. avenaceum Strains, Media and Culture Conditions
5.3. Extraction and Analysis of Enniatins
5.4. Extraction and Analysis of Phenolic Acids and Their Transformation Products by I612
5.5. Extraction of Total RNA, Preparation of cDNA and Real-Time RT-PCR Analysis
5.6. Expression of Results and Statistical Analyses
Author Contributions
Funding
Conflicts of Interest
References
- Pitt, J.I.; Miller, J.D. A concise history of mycotoxin research. J. Agric. Food Chem. 2017, 65, 7021–7033. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Li, J.; Jiang, Y.; Duan, X.; Qu, H.; Yang, B.; Chen, F.; Sivakumar, D. Natural occurrence, analysis, and prevention of mycotoxins in fruits and their processed products. Crit. Rev. Food Sci. Nutr. 2014, 54, 64–83. [Google Scholar] [CrossRef] [PubMed]
- Torres, A.M.; Palacios, S.A.; Yerkovich, N.; Palazzini, J.M.; Battilani, P.; Leslie, J.F.; Logrieco, A.F.; Chulze, S.N. Fusarium head blight and mycotoxins in wheat: Prevention and control strategies across the food chain. World Mycotoxin J. 2019, 12, 333–355. [Google Scholar] [CrossRef]
- Agriopoulou, S.; Stamatelopoulou, E.; Varzakas, T. Advances in occurrence, importance, and mycotoxin control strategies: Prevention and detoxification in foods. Foods 2020, 9, 137. [Google Scholar] [CrossRef] [PubMed]
- Van Egmond, H.P.; Schothorst, R.C.; Jonker, M.A. Regulations relating to mycotoxins in food. Anal. Bioanal. Chem. 2007, 389, 147–157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vaclavikova, M.; Malachova, A.; Veprikova, Z.; Dzuman, Z.; Zachariasova, M.; Hajslova, J. ‘Emerging’ mycotoxins in cereals processing chains: Changes of enniatins during beer and bread making. Food Chem. 2013, 136, 750–757. [Google Scholar] [CrossRef] [PubMed]
- Santini, A.; Meca, G.; Uhlig, S.; Ritieni, A. Fusaproliferin, beauvericin and enniatins: Occurrence in food—A review. World Mycotoxin J. 2012, 5, 71–81. [Google Scholar] [CrossRef]
- Lee, H.J.; Ryu, D. Worldwide occurrence of mycotoxins in cereals and cereal-derived food products: Public health perspectives of their co-occurrence. J. Agric. Food Chem. 2017, 65, 7034–7051. [Google Scholar] [CrossRef]
- Gautier, C.; Pinson-Gadais, L.; Richard-Forget, F. Fusarium mycotoxins enniatins: An updated review of their occurrence, the producing Fusarium species, and the abiotic determinants of their accumulation in crop harvests. J. Agric. Food Chem. 2020, 68, 4788–4798. [Google Scholar] [CrossRef]
- Gruber-Dorninger, C.; Novak, B.; Nagl, V.; Berthiller, F. Emerging mycotoxins: Beyond traditionally determined food contaminants. J. Agric. Food Chem. 2017, 65, 7052–7070. [Google Scholar] [CrossRef]
- Jestoi, M. Emerging Fusarium -mycotoxins fusaproliferin, beauvericin, enniatins, and moniliformin—A review. Crit. Rev. Food Sci. Nutr. 2008, 48, 21–49. [Google Scholar] [CrossRef] [PubMed]
- Fraeyman, S.; Croubels, S.; Devreese, M.; Antonissen, G. Emerging Fusarium and Alternaria mycotoxins: Occurrence, toxicity and toxicokinetics. Toxins 2017, 9, 228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- EFSA Panel on Contaminants in the Food Chain (CONTAM). Scientific opinion on the risks to human and animal health related to the presence of beauvericin and enniatins in food and feed. EFSA J. 2014, 12, 3802. [Google Scholar] [CrossRef]
- Khoshal, A.K.; Novak, B.; Martin, P.G.P.; Jenkins, T.; Neves, M.; Schatzmayr, G.; Oswald, I.P.; Pinton, P. Co-occurrence of DON and emerging mycotoxins in worldwide finished pig feed and their combined toxicity in intestinal cells. Toxins 2019, 11, 727. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mielniczuk, E.; Skwaryło-Bednarz, B. Fusarium Head Blight, mycotoxins and strategies for their reduction. Agronomy 2020, 10, 509. [Google Scholar] [CrossRef] [Green Version]
- Redondo-Blanco, S.; Fernández, J.; López-Ibánez, S.; Miguélez, E.M.; Villar, C.J.; Lombó, F. Plant phytochemicals in food preservation: Antifungal bioactivity: A review. J. Food Prot. 2020, 83, 163–171. [Google Scholar] [CrossRef] [Green Version]
- Boutigny, A.-L.; Barreau, C.; Atanasova-Penichon, V.; Verdal-Bonnin, M.-N.; Pinson-Gadais, L.; Richard-Forget, F. Ferulic acid, an efficient inhibitor of type B trichothecene biosynthesis and Tri gene expression in Fusarium liquid cultures. Mycol. Res. 2009, 113, 746–753. [Google Scholar] [CrossRef]
- Gauthier, L.; Bonnin-Verdal, M.-N.; Marchegay, G.; Pinson-Gadais, L.; Ducos, C.; Richard-Forget, F.; Atanasova-Penichon, V. Fungal biotransformation of chlorogenic and caffeic acids by Fusarium graminearum: New insights in the contribution of phenolic acids to resistance to deoxynivalenol accumulation in cereals. Int. J. Food Microbiol. 2016, 221, 61–68. [Google Scholar] [CrossRef]
- Kulik, T.; Stuper-Szablewska, K.; Bilska, K.; Buśko, M.; Ostrowska-Kołodziejczak, A.; Załuski, D.; Perkowski, J. Sinapic acid affects phenolic and trichothecene profiles of F. culmorum and F. graminearum sensu stricto. Toxins 2017, 9, 264. [Google Scholar] [CrossRef] [Green Version]
- Ferruz, E.; Atanasova-Pénichon, V.; Bonnin-Verdal, M.-N.; Marchegay, G.; Pinson-Gadais, L.; Ducos, C.; Lorán, S.; Ariño, A.; Barreau, C.; Richard-Forget, F. Effects of phenolic acids on the growth and production of T-2 and HT-2 toxins by Fusarium langsethiae and F. sporotrichioides. Molecules 2016, 21, 449. [Google Scholar] [CrossRef] [Green Version]
- Schöneberg, T.; Kibler, K.; Sulyok, M.; Musa, T.; Bucheli, T.D.; Mascher, F.; Bertossa, M.; Voegele, R.T.; Vogelgsang, S. Can plant phenolic compounds reduce Fusarium growth and mycotoxin production in cereals? Food Addit. Contam. 2018, 35, 2455–2470. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Samapundo, S.; De Meulenaer, B.; Osei-Nimoh, D.; Lamboni, Y.; Debevere, J.; Devlieghere, F. Can phenolic compounds be used for the protection of corn from fungal invasion and mycotoxin contamination during storage? Food Microbiol. 2007, 24, 465–473. [Google Scholar] [CrossRef] [PubMed]
- Atanasova-Penichon, V.; Bernillon, S.; Marchegay, G.; Lornac, A.; Pinson-Gadais, L.; Ponts, N.; Zehraoui, E.; Barreau, C.; Richard-Forget, F. Bioguided isolation, characterization, and biotransformation by Fusarium verticillioides of maize kernel compounds that inhibit fumonisin production. Mol. Plant Microbe Interact. 2014, 27, 1148–1158. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gauthier, L.; Atanasova-Penichon, V.; Chéreau, S.; Richard-Forget, F. Metabolomics to decipher the chemical defense of cereals against Fusarium graminearum and deoxynivalenol accumulation. Int. J. Mol. Sci. 2015, 16, 24839–24872. [Google Scholar] [CrossRef] [PubMed]
- Atanasova-Penichon, V.; Barreau, C.; Richard-Forget, F. Antioxidant secondary metabolites in cereals: Potential involvement in resistance to Fusarium and mycotoxin accumulation. Front. Microbiol. 2016, 7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hadjout, S.; Chéreau, S.; Atanasova-Pénichon, V.; Marchegay, G.; Mekliche, L.; Boureghda, H.; Barreau, C.; Touati-Hattab, S.; Bouznad, Z.; Richard-Forget, F. Phenotypic and biochemical characterization of new advanced durum wheat breeding lines from Algeria that show resistance to Fusarium Head Blight and to mycotoxin accumulation. J. Plant Pathol. 2017. [Google Scholar] [CrossRef]
- Anjorin, T.S.; Salako, E.A.; Makun, A.H. Control of toxigenic fungi and mycotoxins with phytochemicals: Potentials and challenges. In Mycotoxin and Food Safety in Developing Countries; InTechOpen: London, UK, 2013; pp. 181–202. [Google Scholar] [CrossRef] [Green Version]
- Snini, S.P.; Mathieu, F. Biocontrol agents and natural compounds against mycotoxinogenic Fungi. Toxins 2020, 12, 353. [Google Scholar] [CrossRef]
- Ponts, N.; Pinson-Gadais, L.; Verdal-Bonnin, M.-N.; Barreau, C.; Richard-Forget, F. Accumulation of deoxynivalenol and its 15-acetylated form is significantly modulated by oxidative stress in liquid cultures of Fusarium graminearum: DON-ADON accumulation is modulated by oxidative stress. FEMS Microbiol. Lett. 2006, 258, 102–107. [Google Scholar] [CrossRef] [Green Version]
- Schöneberg, T.; Kibler, K.; Wettstein, F.E.; Bucheli, T.D.; Forrer, H.R.; Musa, T.; Mascher, F.; Bertossa, M.; Keller, B.; Vogelgsang, S. Influence of temperature, humidity duration and growth stage on the infection and mycotoxin production by Fusarium langsethiae and Fusarium poae in oats. Plant Pathol. 2019, 68, 173–184. [Google Scholar] [CrossRef] [Green Version]
- Boutigny, A.L.; Atanasova-Penichon, V.; Benet, M.; Barreau, C.; Richard-Forget, F. Natural phenolic acids from wheat bran inhibit Fusarium culmorum trichothecene biosynthesis in vitro by repressing Tri gene expression. Eur. J. Plant Pathol. 2010, 127, 275–286. [Google Scholar] [CrossRef]
- Fletcher, E.; Baetz, K. Multi-faceted systems biology approaches present a cellular landscape of phenolic compound inhibition in Saccharomyces cerevisiae. Front. Bioeng. Biotechnol. 2020, 8, 1126. [Google Scholar] [CrossRef] [PubMed]
- Wen, A.; Delaquis, P.; Stanich, K.; Toivonen, P. Antilisterial activity of selected phenolic acids. Food Microbiol. 2003, 20, 305–311. [Google Scholar] [CrossRef]
- Almajano, M.P.; Carbó, R.; Delgado, M.E.; Gordon, M.H. Effect of pH on the antimicrobial activity and oxidative stability of oil-in-water emulsions containing caffeic acid. J. Food Sci. 2007, 72, C258–C263. [Google Scholar] [CrossRef] [PubMed]
- Borges, A.; Ferreira, C.; Saavedra, M.J.; Simões, M. Antibacterial activity and mode of action of ferulic and gallic acids against pathogenic bacteria. Microb. Drug Resist. 2013, 19, 256–265. [Google Scholar] [CrossRef]
- Tsujiyama, S.-I.; Ueno, M. Formation of 4-vinyl guaiacol as an intermediate in bioconversion of ferulic acid by Schizophyllum commune. Biosci. Biotechnol. Biochem. 2008, 72, 212–215. [Google Scholar] [CrossRef] [Green Version]
- Falconnier, B.; Lapierre, C.; Lesage-Meessen, L.; Yonnet, G.; Brunerie, P.; Colonna-Ceccaldi, B.; Corrieu, G.; Asther, M. Vanillin as a product of ferulic acid biotransformation by the white-rot fungus Pycnoporus cinnabarinus I-937: Identification of metabolic pathways. J. Biotechnol. 1994, 37, 123–132. [Google Scholar] [CrossRef]
- Motedayen, N.; Maznah, B.T.I.; Forough, N. Bioconversion of ferulic acid to vanillin by combined action of Aspergillus niger K8 and Phanerochaete crysosporium ATCC 24725. Afr. J. Biotechnol. 2013, 12, 6618–6624. [Google Scholar] [CrossRef] [Green Version]
- Okai, N.; Masuda, T.; Takeshima, Y.; Tanaka, K.; Yoshida, K.; Miyamoto, M.; Ogino, C.; Kondo, A. Biotransformation of ferulic acid to protocatechuic acid by Corynebacterium glutamicum ATCC 21420 engineered to express vanillate O-demethylase. AMB Express 2017, 7, 130. [Google Scholar] [CrossRef] [Green Version]
- Venkatesagowda, B. Enzymatic Kraft lignin demethylation and fungal O-demethylases like vanillate-O-demethylase and syringate O-demethylase catalyzed catechol-Fe3+ complexation method. J. Microbiol. Meth. 2018, 152, 126–134. [Google Scholar] [CrossRef]
- Shalaby, S.; Larkov, O.; Lamdan, N.-L.; Goldshmidt-Tran, O.; Horwitz, B.A. Plant phenolic acids induce programmed cell death of a fungal pathogen: MAPK signaling and survival of Cochliobolus heterostrophus. Environ. Microbiol. 2016, 18, 4188–4199. [Google Scholar] [CrossRef]
- Liang, D.; Xing, F.; Selvaraj, J.N.; Liu, X.; Wang, L.; Hua, H.; Zhou, L.; Zhao, Y.; Wang, Y.; Liu, Y. Inhibitory effect of cinnamaldehyde, citral, and eugenol on aflatoxin biosynthetic gene expression and aflatoxin B1 biosynthesis in Aspergillus flavus. J. Food Sci. 2015, 80, M2917–M2924. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Jin, J.; Liu, X.; Wang, Y.; Liu, Y.; Zhao, Y.; Xing, F. Effect of Cinnamaldehyde on morphological alterations of Aspergillus ochraceus and expression of key genes involved in ochratoxin A biosynthesis. Toxins 2018, 10, 340. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Montibus, M.; Pinson-Gadais, L.; Richard-Forget, F.; Barreau, C.; Ponts, N. Coupling of transcriptional response to oxidative stress and secondary metabolism regulation in filamentous fungi. Crit. Rev. Microbiol. 2015, 41, 295–308. [Google Scholar] [CrossRef] [PubMed]
- Gil-Serna, J.; Vázquez, C.; Patiño, B. Genetic regulation of aflatoxin, ochratoxin A, trichothecene, and fumonisin biosynthesis: A review. Int. Microbiol. 2020, 23, 89–96. [Google Scholar] [CrossRef]
- Montibus, M.; Ducos, C.; Bonnin-Verdal, M.N.; Bormann, J.; Ponts, N.; Richard-Forget, F.; Barreau, C. The bZIP transcription factor Fgap1 mediates oxidative stress response and trichothecene biosynthesis but not virulence in Fusarium graminearum. PLoS ONE 2013, 8. [Google Scholar] [CrossRef]
- Reverberi, M.; Gazzetti, K.; Punelli, F.; Scarpari, M.; Zjalic, S.; Ricelli, A.; Fabbri, A.A.; Fanelli, C. Aoyap1 regulates OTA synthesis by controlling cell redox balance in Aspergillus ochraceus. Appl. Microbiol. Biotechnol. 2012, 95, 1293–1304. [Google Scholar] [CrossRef]
- Turner, A.S.; Lees, A.K.; Rezanoor, H.N.; Nicholson, P. Refinement of PCR-detection of Fusarium avenaceum and evidence from DNA marker studies for phenetic relatedness to Fusarium tricinctum. Plant Pathol. 1998, 47, 278–288. [Google Scholar] [CrossRef]
- Elbelt, S.; Siou, D.; Gelisse, S.; Cruaud, C.; Lannou, C.; Lebrun, M.-H.; Laval, V. Optimized real time QPCR assays for detection and quantification of Fusarium and Microdochium species involved in wheat head blight as defined by MIQE guidelines. J. Mol. Biol. 2018, 272534. [Google Scholar] [CrossRef]
- Fanelli, F.; Ferracane, R.; Ritieni, A.; Logrieco, A.F.; Mulè, G. Transcriptional regulation of enniatins production by Fusarium avenaceum. J. Appl. Microbiol. 2014, 116, 390–399. [Google Scholar] [CrossRef]
- McIlvaine, T.C. A buffer solution for colorimetric comparison. J. Biol. Chem. 1921, 49, 183–186. [Google Scholar]
Phenolic Acids | CAF | FER | CHLO | COUM | SIN | SYR |
---|---|---|---|---|---|---|
IC50 (mM) | 5.1 | 1.4 | 5.2 | 1.4 | 3.4 | 3.4 |
Phenolic Acid | pKa Value | Dry Fungal Biomass (mg) | Enniatins (A, A1, B, B1) Sum (µg · g−1 of Dry Biomass) | ||
---|---|---|---|---|---|
pH 3 | pH 6 | pH 3 | pH 6 | ||
Control | − | 46.0 ± 8.6 | 72.7 ± 1.4 | 1664.7 ± 175.6 | 1627.9 ± 179.5 |
CAF | 4.62 | 72.6 ± 15.5 * | 65.3 ± 1.1 * | 1.23 ± 0.9 * | 967.3 ± 176.5 |
FER | 4.58 | 26.4 ± 2.9 | 79.6 ± 3.4 * | < LOD | 621.0 ± 149.0 * |
CHLO | 2.66 | 67.1 ± 2.4 * | 71.1 ± 3.4 | 31.6 ± 6.1 * | 1872.3 ± 309.0 |
COUM | 4.64 | 65.1 ± 3.4 | 68.5 ± 1.4 | 0.6 ± 0.2 * | 441.5 ± 87.7 * |
SIN | 6.61 | 29.6 ± 0.1 | 76.5 ± 0.3 | 128.5 ± 33.3 * | 1443.5 ± 309.6 |
SYR | 3.90 | 31.8 ± 2.1 | 72.5 ± 1.4 | 336.0 ± 41.5 * | 1662.1 ± 569.6 |
Medium | Gene | |
---|---|---|
esyn1 | kivr | |
FDM + FER/FDM | −3.4 | −3.1 |
FDM pH 4 + FER/FDM pH 4 | −11.50 | −8.40 |
FDM pH 7 + FER/FDM pH 7 | −0.75 | −0.6 |
Strain | Source | Host | Country and Year of Isolation | Sum of Enniatins 1 (µg · g−1) |
---|---|---|---|---|
FaLH27 | Canadian collection of fungal cultures | Winter wheat | Canada, 2011 | 1152.4 ± 98.2 |
I612 | INRAE/MycSA collection | Wheat | Scotland, 2010 | 2948.7 ± 21.0 |
I497 | INRAE/MycSA collection | Soft Wheat | France, 2007 | 995.3 ± 13.3 |
I495 | INRAE/MycSA collection | Soft Wheat | France, 2007 | 1360.3 ± 91.6 |
I112 | INRAE/MycSA collection | Corn | France, 2001 | 105.2 ± 30.2 |
CBS 143.25 | Centraal Bureau voor Shimmelkulturen, The Netherlands | N/A 2 | N/A 2, 1926 | 31.3 ± 2.8 |
Gene | Sequence Forwards (5′-3′) | Sequence Reverse (5′-3′) | Product (bp) | Accession No. |
---|---|---|---|---|
kivr | CGGAGACTAGACCACAGTAT | GCAAAGACGACAGAACTACA | 151 | JPYM01000010.1 |
esyn1 | GAGTCCTCTCCCAAGTTC | AGTTGAAGACCACGAGAT | 102 | AF351597.2; AF351594.2; EF040582.1; Z18755.3; |
rpb2 | CCGAGGATCTCGAACTTTAC | CTTCCTCTTGTTCTCTCTTCTC | 105 | MH582082.1; MK560856.1 MK185026.1; MK185027.1, MK572784.1 |
ef1α | ACTTCCCCTCCAGGATGTCT | GTTACCACGTCGGATGTCCT | 232 | JQGD01000010.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gautier, C.; Pinson-Gadais, L.; Verdal-Bonnin, M.-N.; Ducos, C.; Tremblay, J.; Chéreau, S.; Atanasova, V.; Richard-Forget, F. Investigating the Efficiency of Hydroxycinnamic Acids to Inhibit the Production of Enniatins by Fusarium avenaceum and Modulate the Expression of Enniatins Biosynthetic Genes. Toxins 2020, 12, 735. https://doi.org/10.3390/toxins12120735
Gautier C, Pinson-Gadais L, Verdal-Bonnin M-N, Ducos C, Tremblay J, Chéreau S, Atanasova V, Richard-Forget F. Investigating the Efficiency of Hydroxycinnamic Acids to Inhibit the Production of Enniatins by Fusarium avenaceum and Modulate the Expression of Enniatins Biosynthetic Genes. Toxins. 2020; 12(12):735. https://doi.org/10.3390/toxins12120735
Chicago/Turabian StyleGautier, Charlotte, Laetitia Pinson-Gadais, Marie-Noelle Verdal-Bonnin, Christine Ducos, Judith Tremblay, Sylvain Chéreau, Vessela Atanasova, and Florence Richard-Forget. 2020. "Investigating the Efficiency of Hydroxycinnamic Acids to Inhibit the Production of Enniatins by Fusarium avenaceum and Modulate the Expression of Enniatins Biosynthetic Genes" Toxins 12, no. 12: 735. https://doi.org/10.3390/toxins12120735
APA StyleGautier, C., Pinson-Gadais, L., Verdal-Bonnin, M.-N., Ducos, C., Tremblay, J., Chéreau, S., Atanasova, V., & Richard-Forget, F. (2020). Investigating the Efficiency of Hydroxycinnamic Acids to Inhibit the Production of Enniatins by Fusarium avenaceum and Modulate the Expression of Enniatins Biosynthetic Genes. Toxins, 12(12), 735. https://doi.org/10.3390/toxins12120735