Rutin Increases Muscle Mitochondrial Biogenesis with AMPK Activation in High-Fat Diet-Induced Obese Rats
Abstract
:1. Introduction
2. Experimental Section
2.1. Reagents
2.2. Animals and Experimental Design
2.3. Sample Collection
2.4. Blood Biochemical Measurements
2.5. Hepatic and Fecal Lipids Analyses
2.6. Histological Analysis
2.7. Electron Microscopic Analysis
2.8. Real-time Quantitative Reverse-transcription Polymerase Chain Reaction (qRT-PCR)
| Name | GeneBank No. | Primer sequence (5’-3’) | Amplicon Size (bp) |
|---|---|---|---|
| aP2 | NM_053365 | F: TCACCCCAGATGACAGGAAA | 140 |
| R: CATGACACATTCCACCACCA | |||
| β-actin | NM_031144 | F: GGCACCACACTTTCTACAAT | 123 |
| R: AGGTCTCAAACATGATCTGG | |||
| CPT-1 | NM_031559 | F: TCGGCAGACCTATTTTGCAC | 143 |
| R: ATTTGGCGTAGCTGTCGATG | |||
| R: ATGGCTTGAGGATCTGGGAG | |||
| NRF1 | NM_001100708 | F: CTGTGGCTGATGGAGAGGTG | 189 |
| R: CACTGTTAAGGGCCATGGTG | |||
| PGC-1α | NM_031347 | F: GCACCAGAAAACAGCTCCAA | 130 |
| R: TTACTGAAGTTGCCATCCCG | |||
| SIRT1 | XM_003751934.1 | F: GTTCTGACTGGAGCTGGGGT | 119 |
| R: ATGGCTTGAGGATCTGGGAG | |||
| SREBP-1c | AF286470 | F: AGGAGGCCATCTTGTTGCTT | 134 |
| R: GTTTTGACCCTTAGGGCAGC | |||
| PPAR-γ | NM_001145366 | F: TGTGGGGATAAAGCATCAGC | 175 |
| R: CAAGGCACTTCTGAAACCGA | |||
| Tfam | NM_031326 | F: TGGGCTTAGAGAAGGAAGCC | 107 |
| R: TGCTGACCGAGGTCTTTTTG |
2.9. Mitochondrial DNA (mtDNA) Content Analysis
2.10. AMPK Activity Assay
2.11. Statistical Analysis
3. Results
3.1. Effect of Rutin Supplementation on Body Weight, Energy Intake, and Fat Accumulation


| Variables | NOR | HFD | HFD + Rutin |
|---|---|---|---|
| Initial body weight (g) | 92.36 ± 1.41 | 91.10 ± 1.76 | 92.12 ± 1.68 |
| Final body weight (g) | 487.40 ± 12.59 c | 573.64 ± 7.22 a | 528.54 ± 9.05 b |
| Food intake (g/day) | 24.97 ± 0.57 a | 21.96 ± 0.30 b | 21.63 ± 0.38 b |
| Total food intake (kg/12 weeks) | 2.02 ± 0.05 a | 1.78 ± 0.02 b | 1.75 ± 0.03 b |
| Food efficiency (g gain/g consumed) | 0.19 ± 0.002 c | 0.27 ± 0.003 a | 0.25 ± 0.006 b |
| Energy intake (kcal/day) | 77.42 ± 1.77 b | 101.99 ± 1.40 a | 100.45 ± 1.79 a |
| Total energy intake (kcal/12 weeks) | 6271 ± 144 b | 8261 ± 113 a | 8137 ± 145 a |
| Energy efficiency (g gain/kcal consumed) | 0.06 ± 0.001 a | 0.06 ± 0.001 a | 0.05 ± 0.001 b |
| Liver weight (g/100 g body weight) | 2.65 ± 0.06 | 2.44 ± 0.03 | 2.54 ± 0.09 |
| Adipose tissue weight (g/100 g body weight) | |||
| Epididymal | 2.30 ± 0.18 b | 3.84 ± 0.16 a | 3.28 ± 0.18 a |
| Retroperitoneal | 2.28 ± 0.16 b | 4.29 ± 0.19 a | 2.94 ± 0.26 b |
| Total | 4.58 ± 0.33 b | 8.14 ± 0.29 a | 6.22 ± 0.33 b |
3.2. Effect of Rutin on Serum Lipid Profiles
| Serum Lipid Profiles | NOR | HFD | HFD + Rutin |
|---|---|---|---|
| Serum lipids (mmol/L) | |||
| Triglyceride | 1.03 ± 0.12 a,b | 1.25 ± 0.09 a | 0.71 ± 0.04 b |
| Total cholesterol | 2.32 ± 0.14 a,b | 2.65 ± 0.12 a | 2.16 ± 0.15 a,b |
| HDL cholesterol | 1.45 ± 0.21 b | 1.3 ± 0.13 b | 2.1 ± 0.32 a |
| LDL cholesterol | 0.7 ± 0.17 a,b | 1.09 ± 0.12 a | 0.49 ± 0.22 b |
| Atherogenic index (AI) | 0.91 ± 0.27 a,b | 1.7 ± 0.36 a | 0.51 ± 0.24 b |
| AST (IU/L) | 65.8 ± 4.0 | 69.7 ± 4.1 | 66.0 ± 2.5 |
| ALT (IU/L) | 8.8 ± 3.1 | 6.2 ± 2.4 | 7.2 ± 2.9 |
3.3. Alterations in Hepatic and Fecal Lipid Profiles by Rutin Supplementation
| Hepatic and Fecal Lipid Profiles | NOR | HFD | HFD + Rutin |
|---|---|---|---|
| Hepatic lipids (μmol/g) | |||
| Total lipid | 26.7 ± 1.3 b | 42.2 ± 1.3 a | 30.9 ± 1.9 b |
| Triglyceride | 3.79 ± 0.69 c | 11.70 ± 1.76 a | 7.33 ± 1.36 b |
| Total cholesterol | 1.26 ± 0.10 b | 2.70 ± 0.21 a | 1.75 ± 0.13 b |
| Fecal lipids (μmol/g) | |||
| Total lipid | 23.9 ± 1.6 b | 28.5 ± 1.0 a,b | 38.0 ± 3.8 a,* |
| Triglyceride | 0.36 ± 0.04 b | 0.47 ± 0.04 a,b | 0.66 ± 0.09 a |
3.4. Influence of Rutin on Liver Weight and Serum AST and ALT Activities
3.5. Effect of Rutin on Expression of Adipogenic Genes and AMPK Activity in Adipose Tissue

3.6. Effect of Rutin on Mitochondrial Morphology and Content (mtDNA) in Skeletal Muscle

3.7. Effect of Rutin on Mitochondrial Gene Expression and AMPK Activity in Skeletal Muscle

4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Caballero, B. The global epidemic of obesity: An overview. Epidemiol. Rev. 2007, 29, 1–5. [Google Scholar] [PubMed]
- Mokdad, A.H.; Ford, E.S.; Bowman, B.A.; Dietz, W.H.; Vinicor, F.; Bales, V.S.; Marks, J.S. Prevalence of obesity, diabetes, and obesity-related health risk factors, 2001. JAMA 2003, 289, 76–79. [Google Scholar] [CrossRef] [PubMed]
- Bonen, A.; Parolin, M.L.; Steinberg, G.R.; Calles-Escandon, J.; Tandon, N.N.; Glatz, J.F.; Luiken, J.J.; Heigenhauser, G.J.; Dyck, D.J. Triacylglycerol accumulation in human obesity and type 2 diabetes is associated with increased rates of skeletal muscle fatty acid transport and increased sarcolemmal FAT/CD36. FASEB J. 2004, 18, 1144–1146. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.Y.; Hickner, R.C.; Cortright, R.L.; Dohm, G.L.; Houmard, J.A. Lipid oxidation is reduced in obese human skeletal muscle. Am. J. Physiol. Endocrinol. Metab. 2000, 279, E1039–E1044. [Google Scholar] [PubMed]
- Kelley, D.E.; He, J.; Menshikova, E.V.; Ritov, V.B. Dysfunction of mitochondria in human skeletal muscle in type 2 diabetes. Diabetes 2002, 51, 2944–2950. [Google Scholar] [CrossRef] [PubMed]
- Boudina, S.; Sena, S.; O’Neill, B.T.; Tathireddy, P.; Young, M.E.; Abel, E.D. Reduced mitochondrial oxidative capacity and increased mitochondrial uncoupling impair myocardial energetics in obesity. Circulation 2005, 112, 2686–2695. [Google Scholar] [CrossRef] [PubMed]
- Bergeron, R.; Ren, J.M.; Cadman, K.S.; Moore, I.K.; Perret, P.; Pypaert, M.; Young, L.H.; Semenkovich, C.F.; Shulman, G.I. Chronic activation of AMP kinase results in NRF-1 activation and mitochondrial biogenesis. Am. J. Physiol. Endocrinol. Metab. 2001, 281, E1340–E1346. [Google Scholar] [PubMed]
- Jager, S.; Handschin, C.; St-Pierre, J.; Spiegelman, B.M. AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1alpha. Proc. Natl. Acad. Sci. U.S.A. 2007, 104, 12017–12022. [Google Scholar] [CrossRef] [PubMed]
- Reznick, R.M.; Shulman, G.I. The role of AMP-activated protein kinase in mitochondrial biogenesis. J. Physiol. 2006, 574, 33–39. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Puigserver, P.; Andersson, U.; Zhang, C.; Adelmant, G.; Mootha, V.; Troy, A.; Cinti, S.; Lowell, B.; Scarpulla, R.C.; et al. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 1999, 98, 115–124. [Google Scholar] [CrossRef]
- Ekstrand, M.I.; Falkenberg, M.; Rantanen, A.; Park, C.B.; Gaspari, M.; Hultenby, K.; Rustin, P.; Gustafsson, C.M.; Larsson, N.G. Mitochondrial transcription factor a regulates mtDNA copy number in mammals. Hum. Mol. Genet. 2004, 13, 935–944. [Google Scholar] [CrossRef] [PubMed]
- Okura, T.; Koda, M.; Ando, F.; Niino, N.; Tanaka, M.; Shimokata, H. Association of the mitochondrial DNA 15497G/A polymorphism with obesity in a middle-aged and elderly Japanese population. Hum. Genet. 2003, 113, 432–436. [Google Scholar] [CrossRef] [PubMed]
- Liguori, R.; Mazzaccara, C.; Pasanisi, F.; Buono, P.; Oriani, G.; Finelli, C.; Contaldo, F.; Sacchetti, L. The mtDNA 15497 G/A polymorphism in cytochrome b in severe obese subjects from Southern Italy. Nutr. Metab. Cardiovasc. Dis. 2006, 16, 466–470. [Google Scholar] [CrossRef] [PubMed]
- Gerhart-Hines, Z.; Rodgers, J.T.; Bare, O.; Lerin, C.; Kim, S.H.; Mostoslavsky, R.; Alt, F.W.; Wu, Z.; Puigserver, P. Metabolic control of muscle mitochondrial function and fatty acid oxidation through SIRT1/PGC-1alpha. EMBO J. 2007, 26, 1913–1923. [Google Scholar] [CrossRef] [PubMed]
- McGarry, J.D.; Brown, N.F. The mitochondrial carnitine palmitoyltransferase system from concept to molecular analysis. Eur. J. Biochem. 1997, 244, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Kurisawa, M.; Chung, J.E.; Uyama, H.; Kobayashi, S. Enzymatic synthesis and antioxidant properties of poly (rutin). Biomacromolecules 2003, 4, 1394–1399. [Google Scholar] [CrossRef] [PubMed]
- La Casa, C.; Villegas, I.; de la Lastra, C.A.; Motilva, V.; Calero, M.M. Evidence for protective and antioxidant properties of rutin, a natural flavone, against ethanol induced gastric lesions. J. Ethnopharmacol. 2000, 71, 45–53. [Google Scholar] [CrossRef]
- Sheu, J.R.; Hsiao, G.; Chou, P.H.; Shen, M.Y.; Chou, D.S. Mechanisms involved in the antiplatelet activity of rutin, a glycoside of the flavonol quercetin, in human platelets. J. Agric. Food Chem. 2004, 52, 4414–4418. [Google Scholar] [CrossRef] [PubMed]
- Choi, I.; Park, Y.; Choi, H.; Lee, E.H. Anti-adipogenic activity of rutin in 3T3-L1 cells and mice fed with high-fat diet. Biofactors 2006, 26, 273–281. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.L.; Yen, G.C. Effects of flavonoids and phenolic acids on the inhibition of adipogenesis in 3T3-L1 adipocytes. J. Agric. Food Chem. 2007, 55, 8404–8410. [Google Scholar] [CrossRef] [PubMed]
- Panchal, S.K.; Poudyal, H.; Arumugam, T.V.; Brown, L. Rutin attenuates metabolic changes, nonalcoholic steatohepatitis, and cardiovascular remodeling in high-carbohydrate, high-fat diet-fed rats. J. Nutr. 2011, 141, 1062–1069. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.H.; Lin, M.C.; Wang, H.C.; Yang, M.Y.; Jou, M.J.; Wang, C.J. Rutin inhibits oleic acid induced lipid accumulation via reducing lipogenesis and oxidative stress in hepatocarcinoma cells. J. Food Sci. 2011, 76, T65–T72. [Google Scholar] [CrossRef] [PubMed]
- Reeves, P.G. Components of the AIN-93 diets as improvements in the AIN-76A diet. J. Nutr. 1997, 127, 838S–841S. [Google Scholar] [PubMed]
- Friedewald, W.T.; Levy, R.I.; Fredrickson, D.S. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin. Chem. 1972, 18, 499–502. [Google Scholar] [PubMed]
- Rosenfeld, L. Lipoprotein analysis. Early methods in the diagnosis of atherosclerosis. Arch. Pathol. Lab Med. 1989, 113, 1101–1110. [Google Scholar] [PubMed]
- Bligh, E.G.; Dyer, W.J. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 1959, 37, 911–917. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.S.; Kim, I.H.; Kim, C.T.; Kim, Y. Reduction of body weight by dietary garlic is associated with an increase in uncoupling protein mRNA expression and activation of AMP-activated protein kinase in diet-induced obese mice. J. Nutr. 2011, 141, 1947–1953. [Google Scholar] [CrossRef] [PubMed]
- Kelley, D.E.; Goodpaster, B.; Wing, R.R.; Simoneau, J.A. Skeletal muscle fatty acid metabolism in association with insulin resistance, obesity, and weight loss. Am. J. Physiol. 1999, 277, E1130–E1141. [Google Scholar] [PubMed]
- Turner, N.; Bruce, C.R.; Beale, S.M.; Hoehn, K.L.; So, T.; Rolph, M.S.; Cooney, G.J. Excess lipid availability increases mitochondrial fatty acid oxidative capacity in muscle: Evidence against a role for reduced fatty acid oxidation in lipid-induced insulin resistance in rodents. Diabetes 2007, 56, 2085–2092. [Google Scholar] [CrossRef] [PubMed]
- Koves, T.R.; Ussher, J.R.; Noland, R.C.; Slentz, D.; Mosedale, M.; Ilkayeva, O.; Bain, J.; Stevens, R.; Dyck, J.R.; Newgard, C.B.; et al. Mitochondrial overload and incomplete fatty acid oxidation contribute to skeletal muscle insulin resistance. Cell Metab. 2008, 7, 45–56. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.L.; Wu, C.H.; Huang, S.L.; Yen, G.C. Phenolic compounds rutin and o-coumaric acid ameliorate obesity induced by high-fat diet in rats. J. Agric. Food Chem. 2009, 57, 425–431. [Google Scholar] [CrossRef] [PubMed]
- Rosen, E.D.; Walkey, C.J.; Puigserver, P.; Spiegelman, B.M. Transcriptional regulation of adipogenesis. Genes Dev. 2000, 14, 1293–1307. [Google Scholar] [PubMed]
- White, U.A.; Stephens, J.M. Transcriptional factors that promote formation of white adipose tissue. Mol. Cell Endocrinol. 2010, 318, 10–14. [Google Scholar] [CrossRef] [PubMed]
- Xu, A.; Wang, Y.; Xu, J.Y.; Stejskal, D.; Tam, S.; Zhang, J.; Wat, N.M.; Wong, W.K.; Lam, K.S. Adipocyte fatty acid-binding protein is a plasma biomarker closely associated with obesity and metabolic syndrome. Clin. Chem. 2006, 52, 405–413. [Google Scholar] [CrossRef] [PubMed]
- Rossmeisl, M.; Flachs, P.; Brauner, P.; Sponarova, J.; Matejkova, O.; Prazak, T.; Ruzickova, J.; Bardova, K.; Kuda, O.; Kopecky, J. Role of energy charge and amp-activated protein kinase in adipocytes in the control of body fat stores. Int. J. Obes. Relat. Metab. Disord. 2004, 28 (Suppl. 4), S38–S44. [Google Scholar] [CrossRef] [PubMed]
- Park, S.Y.; Bok, S.H.; Jeon, S.M.; Park, Y.B.; Lee, S.J.; Jeong, T.S.; Choi, M.S. Effect of rutin and tannic acid supplements on cholesterol metabolism in rats. Nutr. Res. 2002, 22, 283–295. [Google Scholar] [CrossRef]
- Lee, Y.S.; Li, P.; Huh, J.Y.; Hwang, I.J.; Lu, M.; Kim, J.I.; Ham, M.; Talukdar, S.; Chen, A.; Lu, W.J.; et al. Inflammation is necessary for long-term but not short-term high-fat diet-induced insulin resistance. Diabetes 2011, 60, 2474–2483. [Google Scholar] [CrossRef] [PubMed]
- Esposito, E.; Iacono, A.; Bianco, G.; Autore, G.; Cuzzocrea, S.; Vajro, P.; Canani, R.B.; Calignano, A.; Raso, G.M.; Meli, R. Probiotics reduce the inflammatory response induced by a high-fat diet in the liver of young rats. J. Nutr. 2009, 139, 905–911. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Ausman, L.M.; Russell, R.M.; Greenberg, A.S.; Wang, X.D. Increased apoptosis in high-fat diet-induced nonalcoholic steatohepatitis in rats is associated with c-Jun NH2-terminal kinase activation and elevated proapoptotic Bax. J. Nutr. 2008, 138, 1866–1871. [Google Scholar] [PubMed]
- Gauthier, M.S.; Favier, R.; Lavoie, J.M. Time course of the development of non-alcoholic hepatic steatosis in response to high-fat diet-induced obesity in rats. Br. J. Nutr. 2006, 95, 273–281. [Google Scholar] [CrossRef] [PubMed]
- Kappel, V.D.; Cazarolli, L.H.; Pereira, D.F.; Postal, B.G.; Zamoner, A.; Reginatto, F.H.; Silva, F.R. Involvement of GLUT-4 in the stimulatory effect of rutin on glucose uptake in rat soleus muscle. J. Pharm. Pharmacol. 2013, 65, 1179–1186. [Google Scholar] [CrossRef] [PubMed]
- Kappel, V.D.; Zanatta, L.; Postal, B.G.; Silva, F.R. Rutin potentiates calcium uptake via voltage-dependent calcium channel associated with stimulation of glucose uptake in skeletal muscle. Arch. Biochem. Biophys. 2013, 532, 55–60. [Google Scholar] [CrossRef] [PubMed]
- Canto, C.; Auwerx, J. PGC-1alpha, SIRT1 and AMPK, an energy sensing network that controls energy expenditure. Curr. Opin. Lipidol. 2009, 20, 98–105. [Google Scholar] [CrossRef] [PubMed]
- Gleyzer, N.; Vercauteren, K.; Scarpulla, R.C. Control of mitochondrial transcription specificity factors (TFB1M and TFB2M) by nuclear respiratory factors (NRF-1 and NRF-2) and PGC-1 family coactivators. Mol. Cell Biol. 2005, 25, 1354–1366. [Google Scholar] [CrossRef] [PubMed]
- Kelly, D.P.; Scarpulla, R.C. Transcriptional regulatory circuits controlling mitochondrial biogenesis and function. Genes Dev. 2004, 18, 357–368. [Google Scholar] [CrossRef] [PubMed]
- Manach, C.; Morand, C.; Texier, O.; Favier, M.L.; Agullo, G.; Demigne, C.; Regerat, F.; Remesy, C. Quercetin metabolites in plasma of rats fed diets containing rutin or quercetin. J. Nutr. 1995, 125, 1911–1922. [Google Scholar] [PubMed]
- Toledo, F.G.; Watkins, S.; Kelley, D.E. Changes induced by physical activity and weight loss in the morphology of intermyofibrillar mitochondria in obese men and women. J. Clin. Endocrinol. Metab. 2006, 91, 3224–3227. [Google Scholar] [CrossRef] [PubMed]
- Toledo, F.G.; Menshikova, E.V.; Ritov, V.B.; Azuma, K.; Radikova, Z.; DeLany, J.; Kelley, D.E. Effects of physical activity and weight loss on skeletal muscle mitochondria and relationship with glucose control in type 2 diabetes. Diabetes 2007, 56, 2142–2147. [Google Scholar] [CrossRef] [PubMed]
- Umanskaya, A.; Santulli, G.; Xie, W.; Andersson, D.C.; Reiken, S.R.; Marks, A.R. Genetically enhancing mitochondrial antioxidant activity improves muscle function in aging. Proc. Natl. Acad. Sci. U.S.A. 2014, 111, 15250–15255. [Google Scholar] [CrossRef] [PubMed]
- Santulli, G.; Xie, W.; Reiken, S.R.; Marks, A.R. Mitochondrial calcium overload is a key determinant in heart failure. Proc. Natl. Acad. Sci. U.S.A. 2015. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.A.; Wei, Y.; Sowers, J.R. Role of mitochondrial dysfunction in insulin resistance. Circ. Res. 2008, 102, 401–414. [Google Scholar] [CrossRef] [PubMed]
- Santulli, G.; Pagano, G.; Sardu, C.; Xie, W.; Reiken, S.; D’Ascia, S.L.; Cannone, M.; Marziliano, N.; Trimarco, B.; Guise, T.A.; et al. Calcium release channel RyR2 regulates insulin release and glucose homeostasis. J. Clin. Invest. 2015, 125, 1968–1978. [Google Scholar] [CrossRef] [PubMed]
- Manach, C.; Morand, C.; Demigne, C.; Texier, O.; Regerat, F.; Remesy, C. Bioavailability of rutin and quercetin in rats. FEBS Lett. 1997, 409, 12–16. [Google Scholar] [CrossRef]
- Escande, C.; Nin, V.; Price, N.L.; Capellini, V.; Gomes, A.P.; Barbosa, M.T.; O’Neil, L.; White, T.A.; Sinclair, D.A.; Chini, E.N. Flavonoid apigenin is an inhibitor of the NAD+ ase CD38: Implications for cellular NAD+ metabolism, protein acetylation, and treatment of metabolic syndrome. Diabetes 2013, 62, 1084–1093. [Google Scholar] [CrossRef] [PubMed]
- Dong, J.; Zhang, X.; Zhang, L.; Bian, H.X.; Xu, N.; Bao, B.; Liu, J. Quercetin reduces obesity-associated ATM infiltration and inflammation in mice: A mechanism including AMPKα1/SIRT1. J. Lipid Res. 2014, 55, 363–374. [Google Scholar] [CrossRef] [PubMed]
- Howitz, K.T.; Bitterman, K.J.; Cohen, H.Y.; Lamming, D.W.; Lavu, S.; Wood, J.G.; Zipkin, R.E.; Chung, P.; Kisielewski, A.; Zhang, L.L.; et al. Small molecule activators of sirtuins extend saccharomyces cerevisiae lifespan. Nature 2003, 425, 191–196. [Google Scholar] [CrossRef] [PubMed]
- Aura, A.M.; Martin-Lopez, P.; O’Leary, K.A.; Williamson, G.; Oksman-Caldentey, K.M.; Poutanen, K.; Santos-Buelga, C. In vitro metabolism of anthocyanins by human gut microflora. Eur. J. Nutr. 2005, 44, 133–142. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Seo, S.; Lee, M.-S.; Chang, E.; Shin, Y.; Oh, S.; Kim, I.-H.; Kim, Y. Rutin Increases Muscle Mitochondrial Biogenesis with AMPK Activation in High-Fat Diet-Induced Obese Rats. Nutrients 2015, 7, 8152-8169. https://doi.org/10.3390/nu7095385
Seo S, Lee M-S, Chang E, Shin Y, Oh S, Kim I-H, Kim Y. Rutin Increases Muscle Mitochondrial Biogenesis with AMPK Activation in High-Fat Diet-Induced Obese Rats. Nutrients. 2015; 7(9):8152-8169. https://doi.org/10.3390/nu7095385
Chicago/Turabian StyleSeo, Sangjin, Mak-Soon Lee, Eugene Chang, Yoonjin Shin, Soojung Oh, In-Hwan Kim, and Yangha Kim. 2015. "Rutin Increases Muscle Mitochondrial Biogenesis with AMPK Activation in High-Fat Diet-Induced Obese Rats" Nutrients 7, no. 9: 8152-8169. https://doi.org/10.3390/nu7095385
APA StyleSeo, S., Lee, M.-S., Chang, E., Shin, Y., Oh, S., Kim, I.-H., & Kim, Y. (2015). Rutin Increases Muscle Mitochondrial Biogenesis with AMPK Activation in High-Fat Diet-Induced Obese Rats. Nutrients, 7(9), 8152-8169. https://doi.org/10.3390/nu7095385

