Impact of Docosahexaenoic Acid on Gene Expression during Osteoclastogenesis in Vitro—A Comprehensive Analysis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Mouse Bone Marrow Macrophage (BMM) Culture and the Induction of Osteoclast Formation
2.2. Tartrate-Resistant Acid Phosphatase (TRAP) Staining
2.3. Gene Expression Analysis Using Agilent Whole Mouse Genome Oligo Microarrays
2.4. Quantification of mRNA by Real-Time PCR
2.5. Data Analyses
Gene | Primer sequence (5′–3′) positions in mRNA | Product size (bp) |
---|---|---|
GAPDH | F:TACAGCAACAGGGTGGTGGAC | 233 |
R:GTGGGTGCAGCGAACTTTATT | ||
DC-STAMP | F:AAAACCCTTGGGCTGTTCTT | 399 |
R:CTTCGCATGCAGGTATTCAA | ||
Tspan7 | F:TGTAATCCTGTTACAGGTTGTGTTG | 147 |
R:CCACACTCACTTTTAAATTGATCTGATG | ||
Siglec-15 | F:TACTTCTGCCGCGTGGAGTT | 114 |
R:CAGCACCGAGATGTTGACGA | ||
Mst1r | F:CACGACCCACCTTCAGAGCCCTAGT | 300 |
R:TTGTCCTAGGCCCAGAGGCAGCTTG |
3. Results
3.1. Stage-Dependent Effect of DHA on sRANKL-Induced Osteoclastogenesis
3.2. Effect of DHA and EPA on Osteoclast Formation
3.3. Gene Expression Profiles of BMMs Cultured with or without sRANKL in the Presence or Absence of DHA
Ontology Term | Gene | Fold change downregulated by DHA |
---|---|---|
GO:0030316 | Calcr | 0.43 |
Dcstamp | 0.44 | |
osteoclast differentiation | Nfatc1 | 0.47 |
Ostm1 | 0.45 | |
GO:0072674 | Gpr55 | 0.36 |
multinuclear osteoclast differentiation | ||
GO:0036035 | Dcstamp | 0.44 |
osteoclast development | ||
GO:0045672 | Car2 | 0.49 |
positive regulation of osteoclast differentiation | Itgb3 | 0.50 |
GO:2001204 | Siglec-15 | 0.35 |
regulation of osteoclast development | ||
GO:0045670 | Esrra | 0.48 |
regulation of osteoclast differentiation |
3.4. Gene ontology (GO) Enrichment on Biological Process Ontology
3.5. Effect of DHA and EPA on Osteoclast Differentiation-Related Genes
4. Discussion
5. Conclusions
Acknowledgments
Conflict of Interest
References
- Högström, M.; Nordström, P.; Nordström, A. N-3 fatty acids are positively associated with peak bone mineral density and bone accrual in healthy men: The NO2 study. Am. J. Clin. Nutr. 2007, 85, 803–807. [Google Scholar]
- Farina, E.K.; Kiel, D.P.; Roubenoff, R.; Schaefer, E.J.; Cupples, L.A.; Tucker, K.L. Plasma phosphatidylcholine concentrations of polyunsaturated fatty acids are differentially associated with hip bone mineral density and hip fracture in older adults: The framingham osteoporosis study. J. Bone Miner. Res. 2012, 27, 1222–1230. [Google Scholar] [CrossRef]
- Figueredo, C.M.; Martinez, G.L.; Koury, J.C.; Fischer, R.G.; Gustafsson, A. Serum levels of long-chain polyunsaturated fatty acids in patients with periodontal disease. J. Periodontol. 2013, 84, 675–682. [Google Scholar] [CrossRef]
- Dunstan, J.A.; Mori, T.A.; Barden, A.; Beilin, L.J.; Taylor, A.L.; Holt, P.G.; Prescott, S.L. Fish oil supplementation in pregnancy modifies neonatal alergen-specific immune responses and clinical outcomes in infants at high risk of atopy: A randomized, controlled trial. J. Allergy Clin. Immunol. 2003, 112, 1178–1184. [Google Scholar] [CrossRef]
- Vaughan, V.C.; Hassing, M.-R.; Lewandowski, P.A. Marine polyunsaturated fatty acids and cancer therapy. Br. J. Cancer 2013, 108, 486–492. [Google Scholar] [CrossRef]
- Kim, Y.-J.; Kim, O.Y.; Cho, Y.; Chung, J.H.; Jung, Y.-S.; Hwang, G.-S.; Shin, M.-J. Plasma phospholipid fatty acid composition in ischemic stroke: Importance of docosahexaenoic acid in the risk for intracranial atherosclerotic stenosis. Atherosclerosis 2012, 225, 418–424. [Google Scholar] [CrossRef]
- Quinn, J.F.; Raman, R.; Thomas, R.G.; Yurko-Mauro, K.; Nelson, E.B.; Dyck, C.V.; Galvin, J.E.; Emond, J.; Jack, C.R.; Weiner, M.; et al. Docosahexaenoic acid supplementation and cognitive decline in alzheimer disease: A randomized trial. JAMA 2010, 304, 1903–1911. [Google Scholar] [CrossRef]
- Park, Y.; Lee, A.; Shim, S.C.; Lee, J.H.; Choe, J.Y.; Ahn, H.; Choi, C.B.; Sung, Y.K.; Bae, S.C. Effect of n-3 polyunsaturated fatty acid supplementation in patients with rheumatoid arthritis: A 16-week randomized, double-blind, placebo-controlled, parallel-design multicenter study in Korea. J. Nutr. Biochem. 2013, 24, 1367–1372. [Google Scholar] [CrossRef]
- Rizos, E.C.; Evangelia, E.; Ntzani, E.E.; Eftychia Bika, E.; Kostapanos, M.S.; Elisaf, M.S. Association between omega-3 fatty acid supplementation and risk of major cardiovascular disease events: A systematic review and meta-analysis. JAMA 2012, 308, 1204–1033. [Google Scholar]
- Mori, T.A.; Bao, D.Q.; Burke, V.; Puddey, I.B.; Beilin, L.J. Docosahexaenoic acid but not eicosapentaenoic acid lowers ambulatory blood pressure and heart rate in humans. Hypertension 1999, 34, 253–260. [Google Scholar] [CrossRef]
- Rousseau-Ralliard, D.; Moreau, D.; Guilland, J.C.; Raederstorff, D.; Grynberg, A. Docosahexaenoic acid, but not eicosapentaenoic acid, lowers ambulatory blood pressure and shortens interval qt in spontaneously hypertensive rats in vivo. Prostaglandins Leukot. Essent. Fatty Acids 2009, 80, 269–277. [Google Scholar] [CrossRef]
- Yuan, J.; Akiyama, M.; Nakahama, K.; Sato, T.; Uematsu, H.; Morita, I. The effects of polyunsaturated fatty acids and their metabolites on osteoclastogenesis in vitro. Prostaglandins Other Lipid Mediat. 2010, 92, 85–90. [Google Scholar] [CrossRef]
- Zhu, M.; Van Dyke, T.E.; Gyurko, R. Resolvin E1 regulates osteoclast fusion via DC-STAMP and NFATc1. FASEB J. 2013, 29. [Google Scholar] [CrossRef]
- Wardhana; Surachmanto, E.S.; Datau, E.A. The role of omega-3 fatty acids contained in olive oil on chronic inflammation. Acta Med. Indones. 2011, 43, 138–143. [Google Scholar]
- Kobayashi, Y.; Take, I.; Yamashita, T.; Mizoguchi, T.; Ninomiya, T.; Hattori, T.; Kurihara, S.; Ozawa, H.; Udagawa, N.; Takahashi, N. Prostaglandin e2 receptors ep2 and ep4 are down-regulated during differentiation of mouse osteoclasts from their precursors. J. Biol. Chem. 2005, 280, 24035–24042. [Google Scholar] [CrossRef]
- Jiang, J.; Lv, H.S.; Lin, J.H.; Jiang, D.F.; Chen, Z.K. Ltb4 can directly stimulate human osteoclast formation from pbmc independent of rankl. Artif. Cells Blood Substit. Immobil. Biotechnol. 2005, 33, 391–403. [Google Scholar] [CrossRef]
- Chen, Z.K.; Lv, H.S.; Jiang, J. Ltb4 can stimulate human osteoclast differentiation dependent of rankl. Artif. Cells Blood Substit. Immobil. Biotechnol. 2010, 38, 52–56. [Google Scholar] [CrossRef]
- Krönke, G.; Uderhardt, S.; Katzenbeisser, J.; Schett, G. The 12/15-lipoxygenase pathway promotes osteoclast development and differentiation. Autoimmunity 2009, 42, 383–385. [Google Scholar] [CrossRef]
- Fong, L.; Muhlhausler, B.S.; Gibson, R.A.; Xian, C.J. Perinatal maternal dietary supplementation of ω3-fatty acids transiently affects bone marrow microenvironment, osteoblast and osteoclast formation, and bone mass in male offspring. Endocrinology 2012, 153, 2455–2465. [Google Scholar] [CrossRef]
- Kukita, T.; Wada, N.; Kukita, A.; Kakimoto, T.; Sandra, F.; Toh, K.; Nagata, K.; Iijima, T.; Horiuchi, M.; Matsusaki, H.; et al. Rankl-induced dc-stamp is essential for osteoclastogenesis. J. Exp. Med. 2004, 200, 941–946. [Google Scholar] [CrossRef]
- Yagi, M.; Ninomiya, K.; Fujita, N.; Suzuki, T.; Iwasaki, R.; Morita, K.; Hosogane, N.; Matsuo, K.; Toyama, Y.; Suda, T.; et al. Induction of dc-stamp by alternative activation and downstream signaling mechanisms. J. Bone Miner. Res. 2007, 22, 992–1001. [Google Scholar] [CrossRef]
- Courtial, N.; Smink, J.J.; Kuvardina, O.N.; Leutz, A.; Göthert, J.R.; Lausen, J. Tal1 regulates osteoclast differentiation through suppression of the master regulator of cell fusion dc-stamp. FASEB J. 2012, 26, 523–532. [Google Scholar] [CrossRef]
- Ishida-Kitagawa, N.; Tanaka, K.; Bao, X.; Kimura, T.; Miura, T.; Kitaoka, Y.; Hayashi, K.; Sato, M.; Maruoka, M.; Ogawa, T.; et al. Siglec-15 protein regulates formation of functional osteoclasts in concert with dnax-activating protein of 12 kda (dap12). J. Biol. Chem. 2012, 287, 17493–17502. [Google Scholar] [CrossRef]
- Asagiri, M.; Sato, K.; Usami, T.; Ochi, S.; Nishina, H.; Yoshida, H.; Morita, I.; Wagner, E.F.; Mak, T.W.; Serfling, E.; et al. Autoamplification of nfatc1 expression determines its essential role in bone homeostasis. J. Exp. Med. 2005, 202, 1261–1269. [Google Scholar] [CrossRef]
- Iwai, K.; Ishii, M.; Ohshima, S.; Miyatake, K.; Saeki, Y. Expression and function of transmembrane-4 superfamily (tetraspanin) proteins in osteoclasts: Reciprocal roles of tspan-5 and net-6 during osteoclastogenesis. Allergol. Int. 2007, 56, 457–463. [Google Scholar] [CrossRef]
- Bassani, S.; Cingolani, L.A.; Valnegri, P.; Folci, A.; Zapata, J.; Gianfelice, A.; Sala, C.; Goda, Y.; Passafaro, M. The x-linked intellectual disability protein tspan7 regulates excitatory synapse development and ampar trafficking. Neuron 2012, 73, 1143–1158. [Google Scholar] [CrossRef]
- Bolia, A.; Gerek, Z.N.; Keskin, O.; Banu Ozkan, S.; Dev, K.K. The binding affinities of proteins interacting with the pdz domain of pick1. Proteins 2012, 80, 1393–1408. [Google Scholar] [CrossRef]
- Ammendrup-Johnsen, I.; Thorsen, T.S.; Gether, U.; Madsen, K.L. Serine 77 in the pdz domain of pick1 is a protein kinase cα phosphorylation site regulated by lipid membrane binding. Biochemistry 2012, 51, 586–596. [Google Scholar] [CrossRef]
- Rucci, N.; DiGiacinto, C.; Orrù, L.; Millimaggi, D.; Baron, R.; Teti, A. A novel protein kinase c alpha-dependent signal to erk1/2 activated by alphavbeta3 integrin in osteoclasts and in chinese hamster ovary (cho) cells. J. Cell Sci. 2005, 118, 3263–3275. [Google Scholar] [CrossRef]
- Sato, K.; Suematsu, A.; Nakashima, T.; Takemoto-Kimura, S.; Aoki, K.; Morishita, Y.; Asahara, H.; Ohya, K.; Yamaguchi, A.; Takai, T.; et al. Regulation of osteoclast differentiation and function by the camk-creb pathway. Nat. Med. 2006, 12, 1410–1416. [Google Scholar]
- Kurihara, N.; Tatsumi, J.; Arai, F.; Iwama, A.; Suda, T. Macrophage-stimulating protein (msp) and its receptor, ron, stimulate human osteoclast activity but not proliferation: Effect of msp distinct from that of hepatocyte growth factor. Exp. Hematol. 1998, 26, 1080–1085. [Google Scholar]
© 2013 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Akiyama, M.; Nakahama, K.-i.; Morita, I. Impact of Docosahexaenoic Acid on Gene Expression during Osteoclastogenesis in Vitro—A Comprehensive Analysis. Nutrients 2013, 5, 3151-3162. https://doi.org/10.3390/nu5083151
Akiyama M, Nakahama K-i, Morita I. Impact of Docosahexaenoic Acid on Gene Expression during Osteoclastogenesis in Vitro—A Comprehensive Analysis. Nutrients. 2013; 5(8):3151-3162. https://doi.org/10.3390/nu5083151
Chicago/Turabian StyleAkiyama, Masako, Ken-ichi Nakahama, and Ikuo Morita. 2013. "Impact of Docosahexaenoic Acid on Gene Expression during Osteoclastogenesis in Vitro—A Comprehensive Analysis" Nutrients 5, no. 8: 3151-3162. https://doi.org/10.3390/nu5083151
APA StyleAkiyama, M., Nakahama, K.-i., & Morita, I. (2013). Impact of Docosahexaenoic Acid on Gene Expression during Osteoclastogenesis in Vitro—A Comprehensive Analysis. Nutrients, 5(8), 3151-3162. https://doi.org/10.3390/nu5083151