Pleurotus eryngii Mushrooms Fermented with Human Fecal Microbiota Protect Intestinal Barrier Integrity: Immune Modulation and Signalling Pathways Counter Deoxycholic Acid-Induced Disruption in Healthy Colonic Tissue
Abstract
1. Introduction
2. Materials and Methods
2.1. Source of P. eryngii Supernatant
2.2. Cell Culture of Caco-2 Cells and Sodium Deoxycholate (SDC)
2.3. Cell Experimental SDC Conditions Standardization Assays
2.4. Treatment of Caco-2 Cells with FSs and SDC
2.5. Preparation of Specimens for TJ Gene Expression Analysis
2.6. Ussing Chamber Experiment
2.6.1. Study Participants and Ethics
2.6.2. Collection of Colonic Biopsies
2.6.3. Experimental Procedure
2.6.4. Measurement of FITC–Dextran and HRP
2.7. Samples Processing for Cytokines and Receptors Gene Expression Analysis
Gene | Primer Sequences (5′-3′) | Reference |
---|---|---|
Human β-actin F | GCGCGGCTACAGCTTCA | [41] |
Human β-actin R | CTTAATGTCACGCACGATTTCC | [41] |
Human ZO-1 F | TTCACGCAGTTACGAGCAAG | [42] |
Human ZO-1 R | TTGGTGTTTGAAGGCAGAGC | [42] |
Human Occludin F | ACAAGCGGTTTTATCCAGAGTC | [42] |
Human Occludin R | GTCATCCACAGGCGAAGTTAAT | [42] |
Human Claudin-1 F | TGGTCAGGCTCTCTTCACTG | [42] |
Human Claudin-1 R | TTGGATAGGGCCTTGGTGTT | [42] |
Human IL-1β F | ACAGATGAAGTGCTCCTTCCA | [43] |
Human IL-1β R | GTCGGAGATTCGTAGCTGGAT | [43] |
Human TNF-α F | TCTCGAACCCCGAGTGACAA | [44] |
Human TNF-α R | TATCTCTCAGCTCCACGCCA | [44] |
Human IFN-γ F | ATCCAGTTACTGCCGGTTTG | [45] |
Human IFN-γ R | GAAGCACCAGGCATGAAATC | [45] |
Human IL-6 F | AGACAGCCACTCACCTCTTCAG | NM_000600 |
Human IL-6 R | TTCTGCCAGTGCCTCTTTGCTG | NM_000600 |
Human IL-8 F | GAGAGTGATTGAGAGTGGACCAC | NM_000584 |
Human IL-8 R | CACAACCCTCTGCACCCAGTTT | NM_000584 |
Human IL-10 F | GGAGAACCTGAAGACCCTCA | [46] |
Human IL-10 R | GATGTCAAACTCACTCATGGC | [46] |
Human IL-13 F | ACGGTCATTGCTCTCACTTGCC | NM_002188 |
Human IL-13 R | CTGTCAGGTTGATGCTCCATACC | NM_002188 |
Human IL-17 F | CGGACTGTGATGGTCAACCTGA | NM_002190 |
Human IL-17 R | GCACTTTGCCTCCCAGATCACA | NM_002190 |
Human Dectin-1 F | AACCACAGCTACCCAAGAAAAC | [47] |
Human Dectin-1 R | GGGCACACTACACAGTTGGTC | [47] |
Human TLR-2 F | CTTCACTCAGGAGCAGCAAGCA | NM_003264 |
Human TLR-2 R | ACACCAGTGCTGTCCTGTGACA | NM_003264 |
Human TLR-4 F | CCCTGAGGCATTTAGGCAGCTA | NM_138554 |
Human TLR-4 R | AGGTAGAGAGGTGGCTTAGGCT | NM_138554 |
Human NF-kB F | GGGGATGGTGAGAAGGTTGG | NM_001319226.2 |
Human NF-kB R | GCAGTGCCATCTGTGGTTGA | NM_001319226.2 |
Human CR3 F | AAGTCCTCGTTGTCCGTTCC | MW027613.1 |
Human CR3 R | CTGCAGCCATTTAACAGCCC | MW027613.1 |
Human mTOR F | GCCGCGCGAATATTAAAGGA | NM_001386500.1 |
Human mTOR R | CTGGTTTCCTCATTCCGGCT | NM_001386500.1 |
2.8. Quantitative Analysis of Cytokine Secretion
2.9. Statistical Analysis
3. Results
3.1. Effect of SDC on Cell Viability and Tight Junctions in Caco-2 Cells
3.2. FS-PEWS Enhances Tight Junction Genes to Sustain Barrier Integrity Under SDC-Induced Stress in Caco-2 Cells
3.3. Fermented P. eryngii Mushrooms Preserve Viability of Colonic Specimens
3.4. Fermentation Supernatant of P. eryngii Mushrooms Preserve and Attenuate SDC-Induced Increased Paracellular and Transcellular Permeability, Respectively
3.5. FS-PEWS Modulates Epithelial Barrier Integrity and Immune Response Under Stress in Colonic Specimens
3.6. Absence of Detectable Cytokine Secretion in Both In Vitro and Ex Vivo Systems
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cummings, J.H.; Antoine, J.-M.; Azpiroz, F.; Bourdet-Sicard, R.; Brandtzaeg, P.; Calder, P.; Gibson, G.; Guarner, F.; Isolauri, E.; Pannemans, D.; et al. PASSCLAIM--gut Health and Immunity. Eur. J. Nutr. 2004, 43, 118–173. [Google Scholar] [CrossRef] [PubMed]
- Farhadi, A.; Banan, A.; Fields, J.; Keshavarzian, A. Intestinal barrier: An interface between health and disease. J. Gastroenterol. Hepatol. 2003, 18, 479–497. [Google Scholar] [CrossRef] [PubMed]
- Groschwitz, K.; Hogan, S. Intestinal barrier function: Molecular regulation and disease pathogenesis. J. Allergy Clin. Immunol. 2009, 124, 3–20. [Google Scholar] [CrossRef] [PubMed]
- Bischoff, S.; Barbara, G.; Buurman, W.; Ockhuizen, T.; Schulzke, J.; Serino, M.; Tilg, H.; Watson, A.; Wells, J. Intestinal permeability—A new target for disease prevention and therapy. BMC Gastroenterol. 2014, 14, 189. [Google Scholar] [CrossRef]
- Slifer, Z.; Blikslager, A. The Integral Role of Tight Junction Proteins in the Repair of Injured Intestinal Epithelium. Int. J. Mol. Sci. 2020, 21, 972. [Google Scholar] [CrossRef]
- Zeng, H.; Safratowich, B.; Cheng, W.-H.; Larson, K.; Briske-Anderson, M. Deoxycholic Acid Modulates Cell-Junction Gene Expression and Increases Intestinal Barrier Dysfunction. Molecules 2022, 27, 723. [Google Scholar] [CrossRef]
- Zhang, Y.; Gao, X.; Gao, S.; Liu, Y.; Wang, W.; Feng, Y.; Pei, L.; Sun, Z.; Liu, L.; Wang, C. Effect of gut flora mediated-bile acid metabolism on intestinal immune microenvironment. Immunology 2023, 170, 301–318. [Google Scholar] [CrossRef]
- Camilleri, M. Leaky gut: Mechanisms, measurement and clinical implications in humans. Gut 2019, 68, 1516–1526. [Google Scholar] [CrossRef]
- Al-Sadi, R.; Guo, S.; Ye, D.; Rawat, M.; Ma, T. TNF-α Modulation of Intestinal Tight Junction Permeability Is Mediated by NIK/IKK-α Axis Activation of the Canonical NF-κB Pathway. Am. J. Pathol. 2016, 186, 1151–1165. [Google Scholar] [CrossRef]
- Aden, K.; Breuer, A.; Rehman, A.; Geese, H.; Tran, F.; Sommer, J.; Waetzig, G.; Reinheimer, T.; Schreiber, S.; Rose-John, S.; et al. Classic IL-6R signalling is dispensable for intestinal epithelial proliferation and repair. Oncogenesis 2016, 5, e270. [Google Scholar] [CrossRef]
- Rawat, M.; Nighot, M.; Al-Sadi, R.; Gupta, Y.; Viszwapriya, D.; Yochum, G.; Koltun, W.; Ma, T. IL1B Increases Intestinal Tight Junction Permeability by Up-regulation of MIR200C-3p, Which Degrades Occludin mRNA. Gastroenterology 2020, 159, 1375–1389. [Google Scholar] [CrossRef] [PubMed]
- Zeng, H.; Umar, S.; Rust, B.; Lazarova, D.; Bordonaro, M. Secondary Bile Acids and Short Chain Fatty Acids in the Colon: A Focus on Colonic Microbiome, Cell Proliferation, Inflammation, and Cancer. Int. J. Mol. Sci. 2019, 20, 1214. [Google Scholar] [CrossRef] [PubMed]
- Vincenzo, F.; Puca, P.; Lopetuso, L.; Petito, V.; Masi, L.; Bartocci, B.; Murgiano, M.; Felice, M.; Petronio, L.; Gasbarrini, A.; et al. Bile Acid-Related Regulation of Mucosal Inflammation and Intestinal Motility: From Pathogenesis to Therapeutic Application in IBD and Microscopic Colitis. Nutrients 2022, 14, 2664. [Google Scholar] [CrossRef]
- Cardoso-Silva, D.; Delbue, D.; Itzlinger, A.; Moerkens, R.; Withoff, S.; Branchi, F.; Schumann, M. Intestinal Barrier Function in Gluten-Related Disorders. Nutrients 2019, 11, 2325. [Google Scholar] [CrossRef]
- Dai, D.; Dai, F.; Chen, J.; Jin, M.; Li, M.; Hu, D.; Liu, Z.; Zhang, Z.; Xu, F.; Chen, W. Integrated multi-omics reveal important roles of gut contents in intestinal ischemia–reperfusion induced injuries in rats. Commun. Biol. 2022, 5, 938. [Google Scholar] [CrossRef]
- Salim, S.; Söderholm, J. Importance of disrupted intestinal barrier in inflammatory bowel diseases. Inflamm. Bowel Dis. 2011, 17, 362–381. [Google Scholar] [CrossRef]
- Hanning, N.; Edwinson, A.; Ceuleers, H.; Peters, S.; De Man, J.; Hassett, L.; De Winter, B.; Grover, M. Intestinal barrier dysfunction in irritable bowel syndrome: A systematic review. Ther. Adv. Gastroenterol. 2021, 14, 1756284821993586. [Google Scholar] [CrossRef]
- Lu, H.; Zhou, Y.; Yang, L.; Zhou, Q.; Wang, X.; Qiu, S.; Cheng, B.; Zeng, X. Involvement and repair of epithelial barrier dysfunction in allergic diseases. Front. Immunol. 2024, 15, 1348272. [Google Scholar] [CrossRef]
- Li, X.; Atkinson, M. The Role for Gut Permeability in the Pathogenesis of Type 1 Diabetes—A Solid or Leaky Concept? Pediatr. Diabetes 2015, 16, 485–492. [Google Scholar] [CrossRef]
- Shen, W.; Wolf, P.; Carbonero, F.; Zhong, W.; Reid, T.; Gaskins, H.; McIntosh, M. Intestinal and systemic inflammatory responses are positively associated with sulfidogenic bacteria abundance in high-fat-fed male C57BL/6J mice. J. Nutr. 2014, 144, 1181–1187. [Google Scholar] [CrossRef]
- Pellegrini, C.; Fornai, M.; D’Antongiovanni, V.; Antonioli, L.; Bernardini, N.; Derkinderen, P. The intestinal barrier in disorders of the central nervous system. Lancet Gastroenterol. Hepatol. 2023, 8, 66–80. [Google Scholar] [CrossRef] [PubMed]
- Stolfi, C.; Maresca, C.; Monteleone, G.; Laudisi, F. Implication of Intestinal Barrier Dysfunction in Gut Dysbiosis and Diseases. Biomedicines 2022, 10, 289. [Google Scholar] [CrossRef] [PubMed]
- Ríos-Covián, D.; Ruas-Madiedo, P.; Margolles, A.; Gueimonde, M.; Reyes-Gavilán, C.G.D.L.; Salazar, N. Intestinal Short Chain Fatty Acids and their Link with Diet and Human Health. Front. Microbiol. 2016, 7, 185–194. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Qi, L.; Biju, B.; Belobrajdic, D.P.; Feng, Q.; Zhang, W. Role of Dietary Nutrients in the Modulation of Gut Microbiota: A Narrative Review. Nutrients 2020, 12, 381. [Google Scholar] [CrossRef]
- Gibson, G.R.; Hutkins, R.; Sanders, M.E.; Prescott, S.L.; Reimer, R.A.; Salminen, S.J.; Scott, K.; Stanton, C.; Swanson, K.; Cani, P.; et al. The International Scientific Association for Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of prebiotics. Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 491–502. [Google Scholar] [CrossRef]
- Pham, V.T.; Seifert, N.; Richard, N.; Raederstorf, D.; Steinert, R.; Prudence, K.; Mohajeri, M.H. The effects of fermentation products of Prebiotic Fibres on Gut Barrier and Immune Functions in Vitro. PeerJ 2018, 6, e5288. [Google Scholar] [CrossRef]
- Saxami, G.; Kerezoudi, E.; Mitsou, E.; Koutrotsios, G.; Zervakis, G.; Pletsa, V.; Kyriacou, A. Fermentation Supernatants of Pleurotus eryngii Mushroom Ameliorate Intestinal Epithelial Barrier Dysfunction in Lipopolysaccharide-Induced Caco-2 Cells via Upregulation of Tight Junctions. Microorganisms 2021, 9, 2071. [Google Scholar] [CrossRef]
- Kerezoudi, E.; Vlasopoulou, M.; Mitsou, E.; Saxami, G.; Koutrotsios, G.; Taflampa, I.; Mountzouris, K.; Rangel, I.; Brummer, R.; Zervakis, G.; et al. In vitro fermentation of whole matrix, digested products and β-glucan enriched extract of Pleurotus eryngii mushrooms distinctively impact the fecal microbiota of healthy older adults. Hum. Nutr. Metab 2024. submitted. [Google Scholar]
- Yu, Q.; Guo, M.; Zhang, B.; Wu, H.; Zhang, Y.; Zhang, L. Analysis of Nutritional Composition in 23 Kinds of Edible Fungi. J. Food Qual. 2020, 2020, 8821315. [Google Scholar] [CrossRef]
- Hu, Q.; Yuan, B.; Wu, X.; Du, H.; Gu, M.; Han, Y.; Yang, W.; Song, M.; Xiao, H. Dietary Intake of Pleurotus eryngii Ameliorated Dextran-Sodium-Sulfate-Induced Colitis in Mice. Mol. Nutr. Food Res. 2019, 63, e1801265. [Google Scholar] [CrossRef]
- Wang, X.; Qu, Y.; Wang, Y.; Wang, X.; Xu, J.; Zhao, H.; Zheng, D.; Sun, L.; Tai, G.; Zhou, Y.; et al. β-1,6-Glucan From Pleurotus eryngii Modulates the Immunity and Gut Microbiota. Front. Immunol. 2022, 13, 859923. [Google Scholar] [CrossRef] [PubMed]
- Kerezoudi, E.; Saxami, G.; Zervakis, G.; Pletsa, V.; Brummer, R.; Kyriacou, A.; Rangel, I. Effects of In Vitro Fermented Pleurotus eryngii on Intestinal Barrier Integrity and Immunomodulation in a Lipopolysaccharide-Induced Colonic Model. Biomedicines 2025, 13, 430. [Google Scholar] [CrossRef]
- Vlassopoulou, M.; Paschalidis, N.; Savvides, A.L.; Saxami, G.; Mitsou, E.K.; Kerezoudi, Ε.; Koutrotsios, G.; Zervakis, G.I.; Georgiadis, P.; Kyriacou, A.; et al. Immunomodulating Activity of Pleurotus eryngii Mushrooms Following Their In Vitro Fermentation by Human Fecal Microbiota. J. Fungi 2022, 8, 329. [Google Scholar] [CrossRef] [PubMed]
- Mitsou, E.K.; Saxami, G.; Stamoulou, E.; Kerezoudi, E.; Terzi, E.; Koutrotsios, G.; Bekiaris, G.; Zervakis, G.; Mountzouris, K.; Pletsa, V.; et al. Effects of rich in β-glucans edible mushrooms on aging gut microbiota characteristics: An in vitro study. Molecules 2020, 25, 2806. [Google Scholar] [CrossRef]
- Koutrotsios, G.; Mountzouris, K.; Chatzipavlidis, I.; Zervakis, G. Bioconversion of lignocellulosic residues by Agrocybe cylindracea and Pleurotus ostreatus mushroom fungi--assessment of their effect on the final product and spent substrate properties. Food Chem. 2014, 161, 127–135. [Google Scholar] [CrossRef]
- Zervakis, G.; Koutrotsios, G.; Katsaris, P. Composted versus raw olive mill waste as substrates for the production of medicinal mushrooms: An assessment of selected cultivation and quality parameters. Biomed. Res. Int. 2013, 2013, 546830. [Google Scholar] [CrossRef]
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef]
- Wallon, C.; Braaf, Y.; Wolving, M.; Olaison, G.; Söderholm, J. Endoscopic biopsies in Ussing chambers evaluated for studies of macromolecular permeability in the human colon. Scand. J. Gastroenterol. 2005, 40, 586–595. [Google Scholar] [CrossRef]
- Tabat, M.; Marques, T.; Markgren, M.; Löfvendahl, L.; Brummer, R.; Wall, R. Acute Effects of Butyrate on Induced Hyperpermeability and Tight Junction Protein Expression in Human Colonic Tissues. Biomolecules 2020, 10, 766. [Google Scholar] [CrossRef]
- Ganda Mall, J.P.; Casado-Bedmar, M.; Winberg, M.; Brummer, R.; Schoultz, I.; Keita, Å. A β-Glucan-Based Dietary Fiber Reduces Mast Cell-Induced Hyperpermeability in Ileum From Patients With Crohn’s Disease and Control Subjects. Inflamm. Bowel Dis. 2017, 24, 166–178. [Google Scholar] [CrossRef]
- Saxami, G.; Karapetsas, A.; Lamprianidou, E.; Kotsianidis, I.; Chlichlia, A.; Tassou, C.; Zoumpourlis, V.; Galanis, A. Two potential probiotic lactobacillus strains isolated from olive microbiota exhibit adhesion and anti-proliferative effects in cancer cell lines. J. Funct. Foods 2016, 24, 461–471. [Google Scholar] [CrossRef]
- Chen, M.; Liu, Y.; Xiong, S.; Wu, M.; Li, B.; Ruan, Z.; Hu, X. Dietary l-tryptophan alleviated LPS-induced intestinal barrier injury by regulating tight junctions in a Caco-2 cell monolayer model. Food Funct. 2019, 10, 2390–2398. [Google Scholar] [CrossRef]
- Li, J.; Moran, T.; Swanson, E.; Julian, C.; Harris, J.; Bonen, D.; Hedl, M.; Nicolae, D.; Abraham, C.; Cho, J. Regulation of IL-8 and IL-1beta expression in Crohn’s disease associated NOD2/CARD15 mutations. Hum. Mol. Genet. 2004, 13, 1715–1725. [Google Scholar] [CrossRef]
- Furrie, E.; Macfarlane, S.; Kennedy, A.; Cummings, J.; Walsh, S.; O’neil, D.; Macfarlane, G. Synbiotic therapy (Bifidobacterium longum/Synergy 1) initiates resolution of inflammation in patients with active ulcerative colitis: A randomised controlled pilot trial. Gut 2005, 54, 242–249. [Google Scholar] [CrossRef] [PubMed]
- Duary, R.K.; Batish, V.; Grover, S. Immunomodulatory activity of two potential probiotic strains in LPS-stimulated HT-29 cells. Genes Nutr. 2014, 9, 398. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Wu, M.; Lin, Y.; Xie, S.; Huang, T.; Liu, P.; Nie, R.; Meng, Q.; Luo, N.; Chen, Y.; et al. IL-33 promotes IL-10 production in macrophages: A role for IL-33 in macrophage foam cell formation. Exp. Mol. Med. 2017, 49, e388. [Google Scholar] [CrossRef]
- Tang, Y.; Govers, C.; Wichers, H.; Mes, J. Macrophages treated with non-digestible polysaccharides reveal a transcriptionally unique phenotype. J. Funct. Foods 2017, 36, 280–289. [Google Scholar] [CrossRef]
- Vincenzo, F.; Gaudio, A.; Petito, V.; Lopetuso, L.; Scaldaferri, F. Gut microbiota, intestinal permeability, and systemic inflammation: A narrative review. Intern. Emerg. Med. 2024, 19, 275–293. [Google Scholar] [CrossRef]
- Shi, L.; Jin, L.; Huang, W. Bile Acids, Intestinal Barrier Dysfunction, and Related Diseases. Cells 2023, 12, 1888. [Google Scholar] [CrossRef]
- Barrasa, J.; Olmo, N.; Pérez-Ramos, P.; Santiago-Gómez, A.; Lecona, E.; Turnay, J.; Lizarbe, M. Deoxycholic and chenodeoxycholic bile acids induce apoptosis via oxidative stress in human colon adenocarcinoma cells. Apoptosis 2011, 16, 1054–1067. [Google Scholar] [CrossRef]
- Ju, J.; Zhang, C.; Yang, J.; Yang, Q.; Yin, P.; Sun, X. Deoxycholic acid exacerbates intestinal inflammation by modulating interleukin-1 β expression and tuft cell proportion in dextran sulfate sodium-induced murine colitis. PeerJ 2023, 11, e14842. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Wang, S.; Zhu, W.; Xu, Z.; Xiao, L.; Wu, J.; Meng, Y.; Zhang, J.; Cheng, C. Deoxycholic acid inducing chronic atrophic gastritis with colonic mucosal lesion correlated to mucosal immune dysfunction in rats. Sci. Rep. 2024, 14, 15798. [Google Scholar] [CrossRef] [PubMed]
- Stenman, L.; Holma, R.; Eggert, A.; Korpela, R. A novel mechanism for gut barrier dysfunction by dietary fat: Epithelial disruption by hydrophobic bile acids. Am. J. Physiol. Gastrointest. Liver Physiol. 2013, 304, 227–234. [Google Scholar] [CrossRef] [PubMed]
- Hegyi, P.; Maléth, J.; Walters, J.; Hofmann, A.; Keely, S. Guts and Gall: Bile Acids in Regulation of Intestinal Epithelial Function in Health and Disease. Physiol. Rev. 2018, 98, 983–2023. [Google Scholar] [CrossRef]
- Chen, Z.; Tang, J.; Wang, P.; Zhu, J.; Liu, Y. GYY4137 Attenuates Sodium Deoxycholate-Induced Intestinal Barrier Injury Both In Vitro and In Vivo. Biomed. Res. Int. 2019, 2019, 5752323. [Google Scholar] [CrossRef]
- Liu, L.; Dong, W.; Wang, S.; Zhang, Y.; Liu, T.; Xie, R.; Wang, B.; Cao, H. Deoxycholic acid disrupts the intestinal mucosal barrier and promotes intestinal tumorigenesis. Food Funct. 2018, 9, 5588–5597. [Google Scholar] [CrossRef]
- Srinivasan, B.; Kolli, A.; Esch, M.; Abaci, H.; Shuler, M.; Hickman, J. TEER measurement techniques for in vitro barrier model systems. J. Lab. Autom. 2016, 20, 107–126. [Google Scholar] [CrossRef]
- Liang, L.; Saunders, C.; Sanossian, N. Food, gut barrier dysfunction, and related diseases: A new target for future individualized disease prevention and management. Food Sci. Nutr. 2023, 11, 1671–1704. [Google Scholar] [CrossRef]
- Chen, J.; Zhou, M.; Chen, L.; Yang, C.; Deng, Y.; Li, J.; Sun, S. Evaluation of Physicochemical Properties and Prebiotics Function of a Bioactive Pleurotus eryngii Aqueous Extract Powder Obtained by Spray Drying. Nutrients 2024, 16, 1555. [Google Scholar] [CrossRef]
- Clarke, L. A guide to Ussing chamber studies of mouse intestine. Am. J. Physiol. Gastrointest. Liver Physiol. 2009, 296, G1151–G1166. [Google Scholar] [CrossRef]
- Dawson, P.; Karpen, S. Intestinal transport and metabolism of bile acids. J. Lipid Res. 2015, 56, 1085–1099. [Google Scholar] [CrossRef] [PubMed]
- Sivaprakasam, S.; Bhutia, Y.; Yang, S.; Ganapathy, V. Short-Chain Fatty Acid Transporters: Role in Colonic Homeostasis. Compr. Physiol. 2017, 8, 299–314. [Google Scholar] [PubMed]
- Schreiber, F.; Balas, I.; Robinson, M.; Bakdash, G. Border Control: The Role of the Microbiome in Regulating Epithelial Barrier Function. Cells 2024, 13, 477. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Cen, M.; Shen, Y.; Zhu, Y.; Cheng, F.; Tang, L.; Hu, W.; Dai, N. Deoxycholic Acid-Induced Gut Dysbiosis Disrupts Bile Acid Enterohepatic Circulation and Promotes Intestinal Inflammation. Dig. Dis. Sci. 2021, 66, 568–576. [Google Scholar] [CrossRef]
- Meyer, F.; Wendling, D.; Demougeot, C.; Prati, C.; Verhoeven, F. Cytokines and intestinal epithelial permeability: A systematic review. Autoimmun. Rev. 2023, 22, 103331. [Google Scholar] [CrossRef]
- Han, F.; Fan, H.; Yao, M.; Yang, S.; Han, J. Oral administration of yeast β-glucan ameliorates inflammation and intestinal barrier in dextran sodium sulfate-induced acute colitis. Inflamm. JFF 2017, 35, 115–126. [Google Scholar]
- Christodoulou, P.; Vlassopoulou, M.; Zervou, M.; Xanthakos, E.; Moulos, P.; Koutrotsios, G.; Zervakis, G.I.; Kerezoudi, E.N.; Mitsou, E.K.; Saxami, G.; et al. In Vitro Fermentation of Pleurotus eryngii Mushrooms by Human Fecal Microbiota: Metataxonomic Analysis and Metabolomic Profiling of Fermentation Products. J. Fungi 2023, 9, 128. [Google Scholar] [CrossRef]
- Boulaka, A.; Christodoulou, P.; Vlassopoulou, M.; Koutrotsios, G.; Bekiaris, G.; Zervakis, G.; Mitsou, E.; Saxami, G.; Kyriacou, A.; Zervou, M.; et al. Genoprotective Properties and Metabolites of β-Glucan-Rich Edible Mushrooms Following Their In Vitro Fermentation by Human Faecal Microbiota. Molecules 2020, 25, 3554. [Google Scholar] [CrossRef]
- Ghosh, S.; Whitley, C.S.; Haribabu, B.; Jala, V. Regulation of Intestinal Barrier Function by Microbial Metabolites. Cell. Mol. Gastroenterol. Hepatol. 2021, 11, 1463–1482. [Google Scholar] [CrossRef]
- Rath, E.; Haller, D. Intestinal epithelial cell metabolism at the interface of microbial dysbiosis and tissue injury. Mucosal Immunol. 2022, 15, 595–604. [Google Scholar] [CrossRef]
- Wegler, C.; Ölander, M.; Wiśniewski, J.; Lundquist, P.; Zettl, K.; Åsberg, A.; Hjelmesæth, J.; Andersson, T.; Artursson, P. Global variability analysis of mRNA and protein concentrations across and within human tissues. NAR Genom. Bioinform. 2019, 2, lqz010. [Google Scholar] [CrossRef] [PubMed]
- Harnik, Y.; Buchauer, L.; Ben-Moshe, S.; Averbukh, I.; Levin, Y.; Savidor, A.; Eilam, R.; Moor, A.; Itzkovitz, S. Spatial discordances between mRNAs and proteins in the intestinal epithelium. Nat. Metab. 2021, 3, 1680–1693. [Google Scholar] [CrossRef] [PubMed]
- Fortelny, N.; Overall, C.; Pavlidis, P.; Freue, G. Can we predict protein from mRNA levels? Nature 2017, 547, E19–E20. [Google Scholar] [CrossRef] [PubMed]
- Jia, X.; He, X.; Huang, C.; Li, J.; Dong, Z.; Liu, K. Protein translation: Biological processes and therapeutic strategies for human diseases. Signal Transduct. Target Ther. 2024, 9, 44. [Google Scholar] [CrossRef]
- Lee, J.; Hammarén, H.; Savitski, M.; Baek, S. Control of protein stability by post-translational modifications. Nat. Commun. 2023, 14, 201. [Google Scholar] [CrossRef]
- Li, D.; Wu, M. Pattern recognition receptors in health and diseases. Signal Transduct. Target Ther. 2021, 6, 291. [Google Scholar] [CrossRef]
- Kawai, T.; Ikegawa, M.; Ori, D.; Akira, S. Decoding Toll-like receptors: Recent insights and perspectives in innate immunity. Immunity 2024, 57, 649–673. [Google Scholar] [CrossRef]
- Guo, Q.; Jin, Y.; Chen, X.; Ye, X.; Shen, X.; Lin, M.; Zeng, C.; Zhou, T.; Zhang, J. NF-κB in biology and targeted therapy: New insights and translational implications. Signal Transduct. Target Ther. 2024, 9, 53. [Google Scholar]
- Jiang, X.; Hao, J.; Zhu, Y.; Liu, Z.; Li, L.; Zhou, Y.; Li, Y.; Teng, L.; Wang, D. The anti-obesity effects of a water-soluble glucan from Grifola frondosa via the modulation of chronic inflammation. Front. Immunol. 2022, 13, 962341. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kerezoudi, E.N.; Zervakis, G.I.; Pletsa, V.; Kyriacou, A.; Brummer, R.J.; Rangel, I. Pleurotus eryngii Mushrooms Fermented with Human Fecal Microbiota Protect Intestinal Barrier Integrity: Immune Modulation and Signalling Pathways Counter Deoxycholic Acid-Induced Disruption in Healthy Colonic Tissue. Nutrients 2025, 17, 694. https://doi.org/10.3390/nu17040694
Kerezoudi EN, Zervakis GI, Pletsa V, Kyriacou A, Brummer RJ, Rangel I. Pleurotus eryngii Mushrooms Fermented with Human Fecal Microbiota Protect Intestinal Barrier Integrity: Immune Modulation and Signalling Pathways Counter Deoxycholic Acid-Induced Disruption in Healthy Colonic Tissue. Nutrients. 2025; 17(4):694. https://doi.org/10.3390/nu17040694
Chicago/Turabian StyleKerezoudi, Evangelia N., Georgios I. Zervakis, Vasiliki Pletsa, Adamantini Kyriacou, Robert J. Brummer, and Ignacio Rangel. 2025. "Pleurotus eryngii Mushrooms Fermented with Human Fecal Microbiota Protect Intestinal Barrier Integrity: Immune Modulation and Signalling Pathways Counter Deoxycholic Acid-Induced Disruption in Healthy Colonic Tissue" Nutrients 17, no. 4: 694. https://doi.org/10.3390/nu17040694
APA StyleKerezoudi, E. N., Zervakis, G. I., Pletsa, V., Kyriacou, A., Brummer, R. J., & Rangel, I. (2025). Pleurotus eryngii Mushrooms Fermented with Human Fecal Microbiota Protect Intestinal Barrier Integrity: Immune Modulation and Signalling Pathways Counter Deoxycholic Acid-Induced Disruption in Healthy Colonic Tissue. Nutrients, 17(4), 694. https://doi.org/10.3390/nu17040694