Interventional Effects of Edible Bird’s Nest and Free Sialic Acids on LPS-Induced Brain Inflammation in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Experimental Animals
2.3. Instruments and Equipment
2.4. Determination of Sialic Acid Content
2.5. Animal Grouping and Biological Sample Collection
2.6. Behavioural Experiment
2.6.1. Morris Water Maze (MWM)
2.6.2. Open Field Test (OFT)
2.7. Measurement of Inflammatory Factor Levels
2.8. Nissl Staining and Immunofluorescence Staining of Hippocampus
2.9. Quantitative Real-Time PCR (qPCR) Analysis
2.10. Data Processing and Analysis
3. Results
3.1. Characterisation of Different Forms of Salivary Acids
3.2. Analysis of Body Weight Organ Index
3.3. Behavioural Analysis
3.3.1. MWM Analysis
3.3.2. OFT Analysis
3.4. Analysis of Brain Inflammatory Factors
3.5. Immunohistochemistry of the Hippocampus
3.6. NF-κB Inflammatory Signalling Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhou, S.; Chen, G.; Qi, M.; El-Assaad, F.; Wang, Y.; Dong, S.; Chen, L.; Yu, D.; Weaver, J.C.; Beretov, J.; et al. Gram Negative Bacterial Inflammation Ameliorated by the Plasma Protein Beta 2-Glycoprotein I. Sci. Rep. 2016, 6, 33656. [Google Scholar] [CrossRef] [PubMed]
- Ning, E.-J.; Sun, C.-W.; Wang, X.-F.; Chen, L.; Li, F.-F.; Zhang, L.-X.; Wang, L.-P.; Ma, Y.-N.; Zhu, J.; Li, X.; et al. Artemisia argyi polysaccharide alleviates intestinal inflammation and intestinal flora dysbiosis in lipopolysaccharide-treated mice. Food Med. Homol. 2024, 1, 9420008. [Google Scholar] [CrossRef]
- Catorce, M.N.; Gevorkian, G. LPS-induced Murine Neuroinflammation Model: Main Features and Suitability for Pre-clinical Assessment of Nutraceuticals. Curr. Neuropharmacol. 2016, 14, 155–164. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Kan, J.; Tang, M.; Zhu, Y.; Hu, B. Lipopolysaccharide Preconditioning Restricts Microglial Overactivation and Alleviates Inflammation-Induced Depressive-like Behavior in Mice. Brain Sci. 2023, 13, 549. [Google Scholar] [CrossRef]
- Meng, F.; Yu, W.; Duan, W.; Wang, T.; Liu, Y. Dexmedetomidine attenuates LPS-mediated BV2 microglia cells inflammation via inhibition of glycolysis. Fundam. Clin. Pharmacol. 2019, 34, 313–320. [Google Scholar] [CrossRef]
- Cao, Y.; Song, W.; Chen, X. Multivalent sialic acid materials for biomedical applications. Biomater. Sci. 2023, 11, 2620–2638. [Google Scholar] [CrossRef]
- Ling, A.J.W.; Chang, L.S.; Babji, A.S.; Latip, J.; Koketsu, M.; Lim, S.J. Review of sialic acid’s biochemistry, sources, extraction and functions with special reference to edible bird’s nest. Food Chem. 2022, 367, 130755. [Google Scholar] [CrossRef]
- Lu, P.; Wu, J.; Liu, X.; Hua, Y.; Zhan, X.; Gao, M.; Zhang, H. Regulation of bacteria growth of five probiotics and intestinal flora of pregnant women by bound sialic acid of edible bird’s nest. Food Ferment. Ind. 2023, 49, 53–61. [Google Scholar] [CrossRef]
- Unal, K.I.; Chang, L.S.; Wan Mustapha, W.A.; Mohd Razali, N.S.; Babji, A.S.; Lim, S.J. Extraction, structural analysis and biological activities of edible bird’s nest sialylated mucin (SiaMuc) glycoproteins: A review. Food Biosci. 2024, 61, 104791. [Google Scholar] [CrossRef]
- Young, W.; Egert, M.; Bassett, S.; Bibiloni, R. Detection of Sialic Acid-Utilising Bacteria in a Caecal Community Batch Culture Using RNA-Based Stable Isotope Probing. Nutrients 2015, 7, 2109–2124. [Google Scholar] [CrossRef]
- Zhang, W.; Zhao, G.P.; Lin, X.X.; Li, C.G.; Zhu, H.Q.; Bi, R.; Fang, B.; Xiong, W.; Yuan, M.; Wang, D.L.; et al. Maternal supplementation with edible birds’ nest during gestation and lactation enhances intestinal barrier function by upregulating Claudin-1 in rat offspring. J. Funct. Foods 2024, 116, 11. [Google Scholar] [CrossRef]
- Liu, Z.; Liu, M.; Meng, J.; Wang, L.; Chen, M. A review of the interaction between diet composition and gut microbiota and its impact on associated disease. J. Future Foods 2024, 4, 221–232. [Google Scholar] [CrossRef]
- Zhang, W.; Zhu, M.Z.; Liu, X.C.; Que, M.Y.; Dekyi, K.; Zheng, L.X.; Zhang, Y.C.; Lv, Y.P.; Fan, Q.Y.; Wang, X.Y.; et al. Edible bird’s nest regulates glucose and lipid metabolic disorders via the gut–liver axis in obese mice. Food Funct. 2024, 15, 7577–7591. [Google Scholar] [CrossRef] [PubMed]
- Cheng, X.-R.; Zhang, C.-X.; Zhao, X.-Y.; Li, Q.-S.; Song, Y.; Zhang, L.; Ma, J.-H.; Chen, Y.-Y.; Yuan, M.; Wang, D.-L. Prophylactic effects of sialylated glycopeptides from edible bird’s nest on neuroinflammation in lipopolysaccharide-treated mice via the gut-brain axis. Food Sci. Hum. Wellness 2024. [CrossRef]
- Xiaoyi, Z.; Jiahao, F.; Yijun, G.; Qiushi, L.; Man, Y.; Chenxi, Z.; Xiaoxian, L.; Dongliang, W.; Xiangrong, C. Research progress on neuroprotective effects of edible bird’s nests. Food Ferment. Ind. 2024, 50, 367–374. [Google Scholar] [CrossRef]
- Chenxi, Z.; Xiaoxian, L.; Weiyue, Z.; Dongliang, W.; Xiangrong, C. Research progress of the potentially regulatory effect of edible bird’s nest on females in different lifecycles. Food Ferment. Ind. 2023, 49, 328–336. [Google Scholar] [CrossRef]
- Payazdan, M.; Khatami, S.; Galehdari, H.; Delfan, N.; Shafiei, M.; Heydaran, S. The anti-inflammatory effects of sialic acid on the human glia cells by the upregulation of IL-4 and IL-10 genes’ expressions. Gene Rep. 2021, 24, 101218. [Google Scholar] [CrossRef]
- Careena, S.; Sani, D.; Tan, S.N.; Lim, C.W.; Hassan, S.; Norhafizah, M.; Kirby, B.P.; Ideris, A.; Stanslas, J.; Bin Basri, H.; et al. Effect of Edible Bird’s Nest Extract on Lipopolysaccharide-Induced Impairment of Learning and Memory in Wistar Rats. Evid. -Based Complement. Altern. Med. 2018, 2018, 9318789. [Google Scholar] [CrossRef]
- Yew, M.Y.; Koh, R.Y.; Chye, S.M.; Othman, I.; Soga, T.; Parhar, I.; Ng, K.Y. Edible bird’s nest improves motor behavior and protects dopaminergic neuron against oxidative and nitrosative stress in Parkinson’s disease mouse model. J. Funct. Foods 2018, 48, 576–585. [Google Scholar] [CrossRef]
- Loh, S.P.; Cheng, S.H.; Mohamed, W. Edible Bird’s Nest as a Potential Cognitive Enhancer. Front. Neurol. 2022, 13, 12. [Google Scholar] [CrossRef]
- Wang, H.; Ni, K.; Wang, Y. Determination of sialic acid in Edible bird’s nest. Chin. J. Pharm. Anal. 2006, 9, 1251–1253. [Google Scholar] [CrossRef]
- Fan, Y.; Fan, Y.; Liu, K.; Lonan, P.; Liao, F.; Huo, Y.; Zhong, X.; Liang, Y.; Wang, Y.; Hou, S.; et al. Edible Bird’s Nest Ameliorates Dextran Sulfate Sodium-Induced Ulcerative Colitis in C57BL/6J Mice by Restoring the Th17/Treg Cell Balance. Front. Pharmacol. 2021, 12, 632602. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.Y.; Bi, W.; Xiao, S.; Lan, X.; Cheng, X.F.; Zhang, J.W.; Lu, D.X.; Wei, W.; Wang, Y.P.; Li, H.M.; et al. Neuroinflammation induced by lipopolysaccharide causes cognitive impairment in mice. Sci. Rep. 2019, 9, 12. [Google Scholar] [CrossRef] [PubMed]
- Luo, H.; Hu, J.; Wang, Y.; Chen, Y.; Zhu, D.; Jiang, R.; Qiu, Z. In vivo and in vitro neuroprotective effects of Panax ginseng glycoproteins. Int. J. Biol. Macromol. 2018, 113, 607–615. [Google Scholar] [CrossRef] [PubMed]
- Fronza, M.G.; Baldinotti, R.; Fetter, J.; Rosa, S.G.; Sacramento, M.; Nogueira, C.W.; Alves, D.; Praticò, D.; Savegnago, L. Beneficial effects of QTC-4-MeOBnE in an LPS-induced mouse model of depression and cognitive impairments: The role of blood-brain barrier permeability, NF-κB signaling, and microglial activation. Brain Behav. Immun. 2022, 99, 177–191. [Google Scholar] [CrossRef]
- Song, Y.; Lin, Y.; Zhang, N. Detection Status and Composition Difference of Nutritional Components in Different Types of Edible Bird’s Nests. Food Nutr. China 2024, 30, 42–51. [Google Scholar] [CrossRef]
- Ormerod, B.K.; Hanft, S.J.; Asokan, A.; Haditsch, U.; Lee, S.W.; Palmer, T.D. PPARγ activation prevents impairments in spatial memory and neurogenesis following transient illness. Brain Behav. Immun. 2013, 29, 28–38. [Google Scholar] [CrossRef]
- Janelidze, S.; Mattsson, N.; Stomrud, E.; Lindberg, O.; Palmqvist, S.; Zetterberg, H.; Blennow, K.; Hansson, O. CSF biomarkers of neuroinflammation and cerebrovascular dysfunction in early Alzheimer disease. Neurology 2018, 91, E867–E877. [Google Scholar] [CrossRef]
- Setiawan, E.; Wilson, A.A.; Mizrahi, R.; Rusjan, P.M.; Miler, L.; Rajkowska, G.; Suridjan, I.; Kennedy, J.L.; Rekkas, P.V.; Houle, S. Role of Translocator Protein Density, a Marker of Neuroinflammation, in the Brain During Major Depressive Episodes. JAMA Psychiatry 2015, 72, 268–275. [Google Scholar] [CrossRef]
- Dou, X.; Zhang, Y.; Chen, Q.; Li, W.; Li, Y.; Yu, C.; Su, X. Down-regulation of TSPO expression doesn’t affect the productions of TNF-alpha, IL-1beta and IL-6 in LPS-stimulated BV-2 microglia. Chin. J. Cell. Mol. Immunol. 2014, 30, 897–900. [Google Scholar]
- Shao, S.; Zheng, Y.W.; Fu, Z.B.; Wang, J.X.; Zhang, Y.; Wang, C.; Qi, X.T.; Gong, T.T.; Ma, L.Y.; Lin, X.; et al. Ventral hippocampal CA1 modulates pain behaviors in mice with peripheral inflammation. Cell Rep. 2023, 42, 19. [Google Scholar] [CrossRef] [PubMed]
- Shishmanova-Doseva, M.; Atanasova, D.; Ioanidu, L.; Uzunova, Y.; Atanasova, M.; Peychev, L.; Tchekalarova, J. The anticonvulsant effect of chronic treatment with topiramate after pilocarpine-induced status epilepticus is accompanied by a suppression of comorbid behavioral impairments and robust neuroprotection in limbic regions in rats. Epilepsy Behav. 2022, 134, 14. [Google Scholar] [CrossRef] [PubMed]
- Gao, Z.W.; Li, Z.F.; Deng, R.; Liu, Q.; Xiao, Q.X.; Han, J.; Pu, C.X.; Zhang, Y. Dexmedetomidine improves postoperative neurocognitive disorder after cardiopulmonary bypass in rats. Neurol. Res. 2021, 43, 164–172. [Google Scholar] [CrossRef] [PubMed]
- Okuyama, S.; Makihata, N.; Yoshimura, M.; Amakura, Y.; Yoshida, T.; Nakajima, M.; Furukawa, Y. Oenothein B Suppresses Lipopolysaccharide (LPS)-Induced Inflammation in the Mouse Brain. Int. J. Mol. Sci. 2013, 14, 9767–9778. [Google Scholar] [CrossRef]
- Zhang, S.-S.; Feng, D.; An, J.-z.; Zhao, J.; Zhao, J.-y.; Guo, Y.; Jiang, Y.-j.; Yan, W.-j. Total Glycosides of Cistanche deserticola attenuates DSS-induced inflammatory bowel disease by regulating intestinal environmental homeostasis. Food Med. Homol. 2025, 2, 9420048. [Google Scholar] [CrossRef]
- Huang, Y.; Lu, Y.; Zhang, L.; Yan, J.; Jiang, J.; Jiang, H. Perineural Dexmedetomidine Attenuates Inflammation in Rat Sciatic Nerve via the NF-κB Pathway. Int. J. Mol. Sci. 2014, 15, 4049–4059. [Google Scholar] [CrossRef]
- Tang, Y.L.; Dong, X.Y.; Chen, G.F.; Ye, W.; Kang, J.W.; Tang, Y.; Feng, Z. Vagus Nerve Stimulation Attenuates Early Traumatic Brain Injury by Regulating the NF-κB/NLRP3 Signaling Pathway. Neurorehabil. Neural Repair. 2020, 34, 831–843. [Google Scholar] [CrossRef]
- Meunier, A.; Latrémolière, A.; Dominguez, E.; Mauborgne, A.; Philippe, S.; Hamon, M.; Mallet, J.; Benoliel, J.J.; Pohl, M. Lentiviral-mediated targeted NF-κB blockade in dorsal spinal cord glia attenuates sciatic nerve injury-induced neuropathic pain in the rat. Mol. Ther. 2007, 15, 687–697. [Google Scholar] [CrossRef]
- Ran, B.; Dan, Z.; Rui, Q.; Lin, X.; Wen, Z.; Li, C.; Man, Y.; Bing, F.; Wang, D.; Li, Y. Edible bird’s nest alleviates pneumonia caused by tobacco smoke inhalation through the TNFR1/NF-kappaB/NLRP3 pathway. Food Sci. Nutr. 2024, 12, 4196–4210. [Google Scholar] [CrossRef]
- Ren, M.; Ahmed, A.F.; Li, M.; Li, M.; Yan, Z.; Wang, J. A review: The mechanism of plant-derived polysaccharides on osteoblasts and osteoclasts. J. Future Foods 2024, 4, 183–192. [Google Scholar] [CrossRef]
- Sun, J.; Gou, Y.R.; Liu, J.; Chen, H.; Kan, J.; Qian, C.L.; Zhang, N.F.; Niu, F.X.; Jin, C.H. Anti-inflammatory activity of a water-soluble polysaccharide from the roots of purple sweet potato. RSC Adv. 2020, 10, 39673–39686. [Google Scholar] [CrossRef] [PubMed]
- Jianhui, L.; Weiwei, W.; Qiuhui, H.; Xuyang, W.; Hui, X.; Anxiang, S.; Minhao, X.; Wenjian, Y. Bioactivities and molecular mechanisms of polysaccharides from Hericium erinaceus. J. Future Foods 2022, 2, 103–111. [Google Scholar] [CrossRef]
- Wu, J.R.; Lu, P.H.; Zhang, H.T.; Fan, Q.Y.; Liu, X.C. Comparison of prebiotic activity of dietary sialoglycoprotein and N-acetylneuraminic acid: Sialylation is a key factor. Food Biosci. 2023, 56, 11. [Google Scholar] [CrossRef]
- Wielgat, P.; Braszko, J.J. Significance of the cell adhesion molecules and sialic acid in neurodegeneration. Adv. Med. Sci. 2012, 57, 23–30. [Google Scholar] [CrossRef]
- Yuan, L. Extraction and Purification of Sialic Acid from Edible Bird’s Nest Fragment and Its Effect on Learning and Memory Abilities of Young Rats. Master’s Thesis, Jiangnan University, Wuxi, China, 2016. [Google Scholar]
- Bing, W.; Bing, Y.; Karim, M.; Honghua, H.; Yun, S.; McGreevy, P.; Petocz, P.; Held, S.; Brand-Miller, J. Dietary sialic acid supplementation improves learning and memory in piglets. Am. J. Clin. Nutr. 2007, 85, 561–569. [Google Scholar]
- Shi, R.Y.; Dan, B.; Lü, L.J. Bioactive effects advances of natural polysaccharides. J. Future Foods 2023, 3, 234–239. [Google Scholar] [CrossRef]
- Bian, H.T.; Wang, G.H.; Huang, J.J.; Liang, L.; Zheng, Y.G.; Wei, Y.Y.; Wang, H.; Xiao, L.; Wang, H.L. Dihydrolipoic acid protects against lipopolysaccharide-induced behavioral deficits and neuroinflammation via regulation of Nrf2/HO-1/NLRP3 signaling in rat. J. Neuroinflamm. 2020, 17, 13. [Google Scholar] [CrossRef]
- Lee, C.H.; Hamdan, N.; Nyakuma, B.B.; Wong, S.L.; Wong, K.Y.; Tan, H.Y.; Jamaluddin, H.; Lee, T.H. Purification, identification and molecular docking studies of antioxidant and anti-inflammatory peptides from Edible Bird’s Nest. Food Chem. 2024, 454, 15. [Google Scholar] [CrossRef]
- Lee, C.H.; Hamdan, N.; Nyakuma, B.B.; Wong, S.L.; Wong, K.Y.; Jamaluddin, H.; Lee, T.H. Functional and biological activities of Edible Bird’s Nest (EBN) protein by proteomic and bioinformatic analyses. J. Food Meas. Charact. 2024, 18, 3018–3031. [Google Scholar] [CrossRef]
- Chu, W.Y.; Phan, C.W.; Lim, S.J.; Babji, A.S. Insights on the molecular mechanism of neuroprotection exerted by edible bird?s nest and its bioactive constituents. Food Sci. Hum. Wellness 2023, 12, 1008–1019. [Google Scholar] [CrossRef]
- Li, C.; Xu, X.H.; Lin, X.X.; Yuan, M.; Wang, D.L.; Zhang, X.K. Edible bird’s nest plays an immune regulation by influencing intestinal flora changes in mice. J. Funct. Foods 2024, 118, 13. [Google Scholar] [CrossRef]
- Clemente, J.C.; Manasson, J.; Scher, J.U. The role of the gut microbiome in systemic inflammatory disease. BMJ-Br. Med. J. 2018, 360, 16. [Google Scholar] [CrossRef] [PubMed]
- Zheng, J.Y.; Lou, L.H.; Fan, J.J.; Huang, C.L.; Mei, Q.X.; Wu, J.H.; Guo, Y.C.; Lu, Y.Y.; Wang, X.P.; Zeng, Y. Commensal Escherichia coli Aggravates Acute Necrotizing Pancreatitis through Targeting of Intestinal Epithelial Cells. Appl. Environ. Microbiol. 2019, 85, 15. [Google Scholar] [CrossRef] [PubMed]
- Ye, X.-S.; Tian, W.-J.; Wang, G.-H.; Lin, K.; Zhu, S.-X.; Xia, Y.-Y.; Sun, B.-L.; Shu, X.-J.; Liu, W.; Chen, H.-F. The food and medicine homologous Chinese Medicine from Leguminosae species: A comprehensive review on bioactive constituents with neuroprotective effects on nervous system. Food Med. Homol. 2025, 2, 9420033. [Google Scholar] [CrossRef]
- Ono, J.; Shime, H.; Takaki, H.; Takashima, K.; Funami, K.; Yoshida, S.; Takeda, Y.; Matsumoto, M.; Kasahara, M.; Seya, T. The TLR3/TICAM-1 signal constitutively controls spontaneous polyposis through suppression of c-Myc in Apc Min/+ mice. J. Biomed. Sci. 2017, 24, 9. [Google Scholar] [CrossRef]
- Tao, S.S.; Zhu, L.X.; Lee, P.K.; Lee, W.M.; Knox, K.; Chen, J.; Di, Y.P.; Chen, Y. Negative Control of TLR3 Signaling by TICAM1 Down-Regulation. Am. J. Respir. Cell Mol. Biol. 2012, 46, 660–667. [Google Scholar] [CrossRef]
- Li, Z.L.; Gao, W.K.; Yuan, H.; Pan, X.L.; Yuan, R.Q.; Wang, W.J.; Guan, L.; Hu, L.L.; Chen, Y.; Cheng, Z.L.; et al. Suppression of intestinal Ticam1 ameliorated MASH via Akkermansia muciniphila QAA37749.1 mediated betaine transformation. Biochim. Biophys. Acta-Mol. Basis Dis. 2025, 1871, 16. [Google Scholar] [CrossRef]
Gene | Forward Primer (5’-3’) | Reverse Primer (5’-3’) |
---|---|---|
β-actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCAT |
TICAM1 | CAAGCTATGTAACACACCGCT | TGGTAACCCTAAGGAGACACTG |
NF-κB p65 | ACTGCCGGGATGGCTACTAT | TCTGGATTCGCTGGCTAATGG |
MYD88 | CAGGAGATGATCCGGCAACT | CATGCGGCGACACCTTTTC |
Iκκβ | GGCACCCAATGATTTGCCAC | TCTAAGAGCCGATGCGATGT |
COX-2 | TTCCAATCCATGTCAAAACCGT | AGTCCGGGTACAGTCACACTT |
CHUK | AAGGCCATTCACTATTCTGAGGT | GTCGTCCATAGGGGCTCTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qian, N.; Zhang, C.-X.; Fang, G.-D.; Qiu, S.; Song, Y.; Yuan, M.; Wang, D.-L.; Cheng, X.-R. Interventional Effects of Edible Bird’s Nest and Free Sialic Acids on LPS-Induced Brain Inflammation in Mice. Nutrients 2025, 17, 531. https://doi.org/10.3390/nu17030531
Qian N, Zhang C-X, Fang G-D, Qiu S, Song Y, Yuan M, Wang D-L, Cheng X-R. Interventional Effects of Edible Bird’s Nest and Free Sialic Acids on LPS-Induced Brain Inflammation in Mice. Nutrients. 2025; 17(3):531. https://doi.org/10.3390/nu17030531
Chicago/Turabian StyleQian, Nan, Chen-Xi Zhang, Guan-Dong Fang, Shuang Qiu, Yu Song, Man Yuan, Dong-Liang Wang, and Xiang-Rong Cheng. 2025. "Interventional Effects of Edible Bird’s Nest and Free Sialic Acids on LPS-Induced Brain Inflammation in Mice" Nutrients 17, no. 3: 531. https://doi.org/10.3390/nu17030531
APA StyleQian, N., Zhang, C.-X., Fang, G.-D., Qiu, S., Song, Y., Yuan, M., Wang, D.-L., & Cheng, X.-R. (2025). Interventional Effects of Edible Bird’s Nest and Free Sialic Acids on LPS-Induced Brain Inflammation in Mice. Nutrients, 17(3), 531. https://doi.org/10.3390/nu17030531